Changhong Qiu1, Fei Huang2, Qing Zhang1, Wei Chen1, Huiting Zhang1. 1. Department of General Surgery, The First People's Hospital of ZhaoQing, ZhaoQing, China. 2. Department of General Surgery, The Seventh Affiliated Hospital of Sun Yat-Sen University (Shen Zhen), Shen Zhen, China.
Abstract
BACKGROUND: To study the expression of microribonucleic acid (miR)-205 in breast cancer and its effects on the proliferation and apoptosis of breast cancer cells. METHODS: Breast cancer cell line MCF-7 cells with stable expression of miR-205-3p were constructed. Cell proliferation, invasion, and apoptosis were detected via MTT assay, transwell assay, and flow cytometry, respectively. The expressions of Ezrin, LaminA/C, cleaved caspase-3, Bcl-2, and Bax were detected via Western blotting. The expressions of miR-205-3p in breast cancer tissues and para-carcinoma tissues were detected via quantitative PCR (qPCR). RESULTS: In transfection group, cell proliferation and invasion capacities were increased significantly (P < 0.01), but apoptotic cells were significantly reduced (P < 0.01). In addition, the expressions of Ezrin, LaminA/C, and cleaved caspase-3 in the transfection group were significantly decreased (P < 0.01), but the Bcl-2/Bax ratio was significantly increased (P < 0.01). The miR-205-3p expression in tumor tissues of breast cancer patients was significantly higher than that in para-carcinoma tissue, but Ezrin, LaminA/C, and cleaved caspase-3 expressions in tumor tissues were remarkably declined (P < 0.01), while the Bcl-2/Bax ratio was remarkably increased (P < 0.01). Moreover, the 5-year survival of patients with high expression of miR-205-3p was significantly shorter than patients with normal or low expression (P < 0.01). CONCLUSION: Highly expressed miR-205-3p can promote the proliferation and invasion and reduce the apoptosis of breast cancer cells, and the high expression of miR-205-3p can significantly reduce the survival time of patients.
BACKGROUND: To study the expression of microribonucleic acid (miR)-205 in breast cancer and its effects on the proliferation and apoptosis of breast cancer cells. METHODS:Breast cancer cell line MCF-7 cells with stable expression of miR-205-3p were constructed. Cell proliferation, invasion, and apoptosis were detected via MTT assay, transwell assay, and flow cytometry, respectively. The expressions of Ezrin, LaminA/C, cleaved caspase-3, Bcl-2, and Bax were detected via Western blotting. The expressions of miR-205-3p in breast cancer tissues and para-carcinoma tissues were detected via quantitative PCR (qPCR). RESULTS: In transfection group, cell proliferation and invasion capacities were increased significantly (P < 0.01), but apoptotic cells were significantly reduced (P < 0.01). In addition, the expressions of Ezrin, LaminA/C, and cleaved caspase-3 in the transfection group were significantly decreased (P < 0.01), but the Bcl-2/Bax ratio was significantly increased (P < 0.01). The miR-205-3p expression in tumor tissues of breast cancerpatients was significantly higher than that in para-carcinoma tissue, but Ezrin, LaminA/C, and cleaved caspase-3 expressions in tumor tissues were remarkably declined (P < 0.01), while the Bcl-2/Bax ratio was remarkably increased (P < 0.01). Moreover, the 5-year survival of patients with high expression of miR-205-3p was significantly shorter than patients with normal or low expression (P < 0.01). CONCLUSION: Highly expressed miR-205-3p can promote the proliferation and invasion and reduce the apoptosis of breast cancer cells, and the high expression of miR-205-3p can significantly reduce the survival time of patients.
Both morbidity and mortality rates of breast cancer, as one of the common malignant tumors in women, are ranked 1st in a variety of female tumors, seriously threatening the female health1 The number of breast cancerpatients diagnosed and treated each year is not large in China compared with that in Western developed countries, but the incidence rate of breast cancer has displayed an increasing trend in the last 2 decades. In particular, breast cancer has become the malignant tumor with the highest incidence rate in women in big cities2 A variety of stress responses in cells will be produced when various external stimuli (various carcinogenic factors) act on breast epithelial cells, resulting in cell proliferation, thus leading to breast cancer3 At present, surgical operation is dominated in the clinical treatment approaches of breast cancer, but the range of surgical resection in clinic is wide, the trauma is large, and a lot of related complications often occur in patients after clinical surgical treatment, causing serious physiological and psychological damage to patients4.A large number of studies in recent years have revealed that various specific gene mutations were identified in tumorpatients and several microribonucleic acids (miRNAs) are closely related to the tumor metastasis and invasion5, 6 Osipov et al7 found high expression of miR‐205 in epithelial ovarian cancer cells, indicating that miR‐205 is possibly associated with the incidence of ovarian cancer. There is a great amount of research evidence proving that the miR‐205 expressions in a variety of tumors are lower than that in normal tissues8, 9, 10, 11 miRNAs are therefore applied in the diagnosis of cancer12, 13 For instance, miR‐205 presents as the potential biomarkers for early prognosis or diagnosis while its level is proposed in predicting lymph node metastasis in triple‐negative breast cancer patients14, 15 Moreover, it has been demonstrated that miR‐205/ASPP2 axis promoted cell migration and also increased cell proliferation, which may be potential diagnostic and therapeutic biomarkers in cervical and lung cancers16 miR‐205 enhances chemosensitivity of breast cancer cells to TAC chemotherapy by suppressing both VEGFA and FGF2, leading to evasion of apoptosis17 However, the exact role of miR‐205‐3p in the pathogenesis and development of breast cancer remains poorly understood. The present study aims to investigate the role and possible mechanism of miR‐205‐3p in breast cancer, in order to provide a theoretical basis for further elaborating the effect of miR‐205‐3p in the course of breast cancer.
PATIENTS AND METHODS
Patients and grouping
A total of 58 patients who were pathologically diagnosed with breast cancer, treated, and underwent mastectomy in Guangdong Provincial People's Hospital from June 2011 to June 2013 were collected. None of the patients received chemotherapy and radiotherapy before operation. The para‐carcinoma tissues of breast cancer (more than 5 cm away from the breast cancer tissues) were taken during operation as the control. All enrolled patients were females aged 42‐69 years with a median age of 56.2 years, and they all suffered from invasive ductal carcinoma. According to the tumor‐node‐metastasis (TNM) staging criteria issued by the International Union Against Cancer, patients were staged, and there were 8 cases in stage I, 41 cases in stage II, 6 cases in stage III, and 3 cases in stage IV. Inclusion criteria were as follows: (1) patients without severe hepatic and renal function impairment, (2) patients who agreed to be followed up, (3) patients without a history of serious cardiovascular and immune system diseases, and (4) patients without chronic or acute infectious diseases. All enrolled patients personally signed the informed consent and had complete clinical and pathological data and complete therapeutic regimens. The experimental scheme was reviewed and approved ethically by our hospital.
Detection of miR‐205‐3p expression level in breast cancer tissues
After breast cancer tissues and para‐carcinoma tissues were obtained, they were added into the tube (100 mg/mL) together with TRIzol, and smashed using an ultrasonic disruptor followed by being incubated on ice for 10 minutes, followed by centrifugation at 12 000 g and 4°C for 10 minutes. 700 μL supernatant was taken, added with chloroform, and manually vibrated for 10 times, followed by incubation on ice for 10 minutes and centrifugation at 12 000 g and 4°C for 10 minutes. After the supernatant was discarded, 1 mL freshly prepared 75% ethanol was added into each tube, followed by centrifugation at 12 000 g and 4°C for 15 minutes. The ethanol was discarded, the cap of the centrifuge tube was removed for natural air‐drying, and 30 μL diethyl pyrocarbonate (DEPC)‐treated water was added to dissolve the RNA. The optical density (OD) value and purity of RNA were measured. The reaction system was prepared strictly according to instructions of the reverse transcription kit (Invitrogen): 5 μg total RNA, 1 μL Oligo(dT)20, 1 μL 10 mmol/L dNTP, and 3 μL 0.1mol/L DTT were added, and DEPC‐treated water was also added until the total volume was 20 μL. After reaction at 60°C for 15 minutes and incubation at 37°C for 2 minutes, the reverse transcription was performed. After RT‐qPCR system was prepared, the amplification was performed on the RT‐qPCR instrument. Amplification conditions are as follows: pre‐denaturation at 92°C for 2 minutes, denaturation at 95°C for 20 seconds, annealing at 60°C for 40 seconds, extension at 72°C for 2 minutes, and a total of 35 cycles. Primers were synthesized by Invitrogen, and RNU6B was used as the internal control. The primer sequence was as follows: 5′‐CGG GAT TTC AGT GGA GTG AAG TTC‐3′ (miR‐205‐3p); 5′‐CTC GCT TCG GCA GCA CA‐3′ (RNU6B, sense) and 5′‐AAC GCT TCA CGA ATT TGC GT‐3′ (RNU6B, antisense). The expression of miR‐205‐3p was quantified as a relative expression to RNU6B using 2−△△CT method. All RT‐qPCR experiments were conducted according to the MIQE (minimum information for publication of quantitative real‐time PCR experiments) guidelines18 Each amplification reaction was performed in triplicate, and mean value of the three‐cycle threshold was used for further analysis. Based on the median expression of miR‐205‐3p, patients were further divided into high and low expression group.
Survival curve analysis
The miR‐205‐3p expression in cancer tissues of each patient with breast cancer was detected and compared with that in para‐carcinoma tissue, and divided into normal or low expression group and high expression group. Data of patients were recorded in detail, and patients were followed up for 5 years. The 5‐year survival rate of patients was recorded, and the survival curve was drawn. Influencing factors of patient's prognosis in both groups were analyzed via Cox multivariate regression analysis.
Cell culture and construction of cell lines with miR‐205‐3p overexpression
Humanbreast cancer MCF‐7 cell lines were purchased from the Kunming Cell Bank of the Chinese Academy of Sciences. After resuscitation, cells were cultured using Dulbecco's modified Eagle medium (DMEM) (Gibco) containing 10% fetal bovine serum (FBS) in an incubator with 5% CO2 at 37°C till the logarithmic growth phase. Then, cells were digested with trypsin and continued to be cultured, followed by passage till the 3rd generation used for the experiment. The gene sequence (5′‐GAUUUCAGUGGAGUGAAGUUC‐3′) of hsa‐miR‐205‐3p was found in the Sanger microRNA database, and primers were synthesized by Invitrogen: forward primer: 5′‐GAGGATCCCCGGGTACCGGTAGGCCTTT‐3′ and reverse primer: 5′‐CACACATTCCACAGGCTGCTACGGTGGTGGCGGCGGGCGGT‐3′. After amplification and electrophoretic separation using agarose gel, the target band was recycled. The GV369 vector (Shanghai GeneChem Co., Ltd.) was cut via double digestion, and the target fragment (5′‐GAUUUCAGUGGAGUGAAGUUC‐3′) was connected to the vector using T4 ligase (Takara), followed by plate clone using LB solid medium at 37°C and sequencing identification using positive colonies. The miR‐205‐3p lentivirus was packaged with the plasmid (TransGen), the titer was detected, and the miR‐205‐3p lentivirus was used to infect MCF‐7 cells after meeting requirements: After digestion, MCF‐7 cells were inoculated into a 24‐well plate at a density of 5 × 104/well. After culturing for 24 hours, 440 μL DMEM, 10 μL hsa‐miR‐205‐3p, and 50 μL polybrene were added into the centrifuge tube, mixed evenly, and inoculated into the plate. After culturing for 12 hours, the original medium was replaced with DMEM containing 10% FBS for culture for another 72 hours. Then, the fluorescence intensity of cells was observed under a microscope. After cells were screened using puromycin (Sigma) and cloned, the MCF‐7 cell lines with stable infection were constructed. Overexpression of miR‐205‐3p was then confirmed by real‐time quantitative polymerase chain reaction (RT‐qPCR) using RNU6B as an internal control.
Detection of cell proliferation and invasion capacities
Cell proliferation capacity was detected via methyl thiazolyl tetrazolium (MTT) assay: After cells in the logarithmic growth phase were digested, the cell density was adjusted to 1 × 104/well, and cells were inoculated into a 96‐well plate and divided into blank control group (MCF‐7 cells without any treatment), negative control group (MCF‐7cells inoculated with empty vector), and hsa‐miR‐205‐3p group (MCF‐7 cells inoculated with hsa‐miR‐205‐3p), followed by culture in an incubator for 24 hours. Then, 100 μL MTT was added to culture cells for another 4 hours, the supernatant was discarded, and 150 μL dimethyl sulfoxide (DMSO) was added into each well and vibrated on a shaking table for 1 minute. Finally, cell proliferation in each group was detected using a microplate reader.Cell invasion capacity was detected via transwell assay: After cells in the logarithmic growth phase were digested, the cell density was adjusted to 1.5 × 106/well, and the cell suspension was prepared and divided into blank control group (MCF‐7 cells without any treatment), negative control group (MCF‐7 cells inoculated with empty vector), and hsa‐miR‐205‐3p group (MCF‐7 cells inoculated with hsa‐miR‐205‐3p). 300 μL cell suspension was added into the upper side of polycarbonate transwell filter (Corning) containing 50 μL mixture of Matrigel (BD Biosciences) and DMEM (1:4), while 700 μL DMEM containing 10% FBS was added into the lower chamber, followed by culture in the incubator for 24 hours. After being removed from the chamber, cells were fixed with methanol and stained with crystal violet. The cell invasion was observed under the microscope, and the number of cells passing through the membrane was calculated.
Detection of apoptosis
Apoptosis was detected via flow cytometry using FITCAnnexin V Apoptosis Detection Kit (BD Bioscience): After cells in the logarithmic growth phase were digested, the cell density was adjusted to 2 × 106/well, and the cell suspension was prepared and divided into blank control group (MCF‐7 cells without any treatment), negative control group (MCF‐7 cells inoculated with empty vector), and hsa‐miR‐205‐3p group (MCF‐7 cells inoculated with hsa‐miR‐205‐3p). Then, the cell suspension was inoculated into a 6‐well plate and added with serum‐free DMEM, followed by culture in the incubator for 24 hours. After the culture solution was discarded, cells were washed with phosphate‐buffered saline (PBS), scraped off, centrifuged, and resuspended with PBS for 3 times strictly according to instructions of the apoptosis kit (BD Bioscience). The fluorescence maker was added and cells were incubated in a dark place at room temperature for 15 minutes, followed by sample loading and detection via flow cytometry. All samples should be detected within 1 hour to ensure the effect.
Detection of expression levels of related proteins
Cells in each group were cultured in the 6‐well plate, collected, followed by addition of radioimmunoprecipitation assay (RIPA) lysis solution (Wuhan Servicebio) and 1% protease inhibitor (Wuhan Servicebio) into each well (500 μL/well). After breast cancer tissues and para‐carcinoma tissues were obtained, they were added with RIPA lysis solution and 1% protease inhibitor (100 mg/mL) and smashed using the ultrasonic disruptor. The above cell suspension and tissue homogenate were incubated on ice, followed by centrifugation at 1000 g and 4°C for 10 minutes to obtain the total protein solution. The total protein concentration in each sample was detected using the BCA protein assay kit (PIERCE). After the protein loading buffer in an equal concentration was prepared, 10% gel was prepared and added with an equal amount of loading buffer, followed by sodium dodecyl sulfate polyacrylamide gel electrophoresis under constant pressure. Then, the protein was transferred onto a PVDF membrane (Millipore), and the target band was cut and sealed with freshly prepared 5% skim milk powder for 2 hours. Ezrin, LaminA/C, cleaved caspase‐3, Bcl‐2, Bax, and glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) antibodies (purchased from CST, USA, and prepared at a volume ratio of 1:1000) were incubated at 4°C overnight. After the band was washed with PBS with Tween‐20 (PBST) for 3 times (5 minutes per time), it was incubated with the horseradish peroxidase‐conjugated secondary antibody (1:5000, Shanghai YIHYSON Biotechnology Co., Ltd.) at room temperature for 1 hour, and then the membrane was washed with Tris‐buffered saline with Tween‐20 (TBST), followed by image development in a dark room: Enhanced chemiluminescence (ECL) solution was added, and images were obtained using the fluorescence imaging technique. The expression level of each protein was presented as Ezrin/GAPDH, LaminA/C/GAPDH, cleaved caspase‐3/GAPDH, and Bcl‐2/Bax, respectively.
Statistical analysis
In this study, three independent experiments were performed for in vitro assay. Data were presented as mean ± SD and processed using Statistical Product and Service Solutions (SPSS) 19.0 software (SPSS Inc.). Paired Student's t test was used for the comparison between two groups, chi‐square test was used for enumeration data, and analysis of variance was used for the comparison among groups. The homogeneity test of variance was performed, and Bonferroni's method was used for the pairwise comparison in case of homogeneity of variance, while Welch's method was used in case of heterogeneity of variance. The Pearson correlation analysis was adopted for correlation analysis. Cox proportional hazards model was performed for multivariate analysis of the independent factors for the survival of breast cancerpatients. P < 0.05 suggested that the difference was statistically significant.
RESULTS
miR‐205‐3p expression in breast cancer tissues
The miR‐205‐3p expressions in tumor tissues and para‐carcinoma tissues of breast cancerpatients were detected via RT‐qPCR. According to results, the miR‐205‐3p expression in tumor tissues of breast cancerpatients was increased significantly compared with that in para‐carcinoma tissues (1.87 ± 0.63 vs 1, P < 0.01) (Figure 1).
Figure 1
Detection of miR‐205‐3p expressions in tumor tissues and para‐carcinoma tissues in each group via RT‐qPCR. The miR‐205‐3p expression in tumor tissues of breast cancer patients is obviously higher than that in para‐carcinoma tissues, **
P < 0.01
Detection of miR‐205‐3p expressions in tumor tissues and para‐carcinoma tissues in each group via RT‐qPCR. The miR‐205‐3p expression in tumor tissues of breast cancerpatients is obviously higher than that in para‐carcinoma tissues, **
P < 0.01
Related protein expressions in breast cancer tissues
Ezrin, LaminA/C, cleaved caspase‐3, Bcl‐2, and Bax protein expressions in tumor tissues and para‐carcinoma tissues of breast cancerpatients were detected via Western blotting. Results manifested that compared with those in para‐carcinoma tissues, Ezrin, LaminA/C, and cleaved caspase‐3 expressions were significantly declined in tumor tissues (P < 0.01), but the Bcl‐2/Bax ratio was increased significantly (P < 0.01) (Figure 2).
Figure 2
Detection of related protein expressions in breast cancer tissues and para‐carcinoma tissues via Western blotting. (A) Protein bands. (B) Statistical graph of Ezrin protein expression level. (C) Statistical graph of LaminA/C protein expression level. (D) Statistical graph of cleaved caspase‐3 protein expression level. (E) Statistical graph of Bcl‐2/Bax protein expression level. Compared with those in para‐carcinoma tissues, Ezrin, LaminA/C, and cleaved caspase‐3 expressions are remarkably lower in breast cancer tissues, but the Bcl‐2/Bax ratio is higher. Data were presented as a fold change relative to GAPDH (mean ± SD). **
P < 0.01
Detection of related protein expressions in breast cancer tissues and para‐carcinoma tissues via Western blotting. (A) Protein bands. (B) Statistical graph of Ezrin protein expression level. (C) Statistical graph of LaminA/C protein expression level. (D) Statistical graph of cleaved caspase‐3 protein expression level. (E) Statistical graph of Bcl‐2/Bax protein expression level. Compared with those in para‐carcinoma tissues, Ezrin, LaminA/C, and cleaved caspase‐3 expressions are remarkably lower in breast cancer tissues, but the Bcl‐2/Bax ratio is higher. Data were presented as a fold change relative to GAPDH (mean ± SD). **
P < 0.01
Correlations of miR‐205‐3p with clinicopathological features of breast cancer patients
The miR‐205‐3p level was classified as high or low in relation to the median value (cutoff value = 1.704). The above patients were accordingly divided into low or normal expression group and high expression group based on the miR‐205‐3p expression level in breast cancer tissues, with para‐carcinoma tissues as the control. The clinicopathological data of patients in each group were recorded in details, and correlations of miR‐205‐3p expression level with clinicopathological data of patients were analyzed. Results showed that miR‐205‐3p was not related to the age and menstrual condition of breast cancerpatients, but statistically closely related to the size, TNM staging, lymph node metastasis, and recurrence of breast cancer (P < 0.05) (Table 1). Further univariate and multivariate analysis showed that miR‐205‐3p expression was an independent factor for the survival (recurrence‐free survival) of breast cancerpatients (Table 2).
Table 1
Clinicopathological data of breast cancer patients
Groups
n
miR‐205‐3p expression level
χ2
df
P value
Contingency coefficient
Low or normal expression
High expression
Age
≥50 y old
46
25
21
0.0611
1
0.8047
0.2472
<50 y old
12
7
5
Menstrual condition
Premenopause
38
20
18
0.2877
1
0.5917
0.5363
Postmenopause
20
12
8
Tumor size
≥2 cm
16
6
10
13.48
1
0.0002
3.672
<2 cm
42
36
6
TNM staging
Stages I and II
49
32
17
9.106
1
0.0025
3.108
Stages III and IV
9
1
8
Lymph node metastasis
Yes
22
7
15
5.625
1
0.0177
2.372
No
36
23
13
Recurrence
Yes
25
7
18
8.507
1
0.0035
2.917
No
33
22
11
Table 2
Multivariate analysis of clinicopathological factors for overall survival (Cox proportional hazards model)
Factors
Univariate analysis
Multivariate analysis
HR (95% CI)
P value
HR (95% CI)
P value
Age (≥50 y)
1.08 (0.43‐2.61)
0.796
/
/
Gender
0.53 (0.21‐1.63)
0.195
/
/
Tumor size (≥2 cm)
6.90 (2.36‐38.2)
0.006
10.6 (0.51‐567)
0.092
TNM staging (III‐IV/I‐II)
1.65 (1.35‐1.93)
0.021
2.76 (0.05‐236)
0.693
Lymph node metastasis (yes/no)
1.03 (1.01‐1.21)
0.031
1.16 (0.15‐25.6)
0.961
miR‐205‐3p expression (high/low)
26.7 (18.3‐45.7)
<0.0001
16.5 (2.61‐359)
0.002
Clinicopathological data of breast cancerpatientsMultivariate analysis of clinicopathological factors for overall survival (Cox proportional hazards model)
Correlation of miR‐205‐3p with prognosis of breast cancer patients
All breast cancerpatients enrolled were followed up for 5 years, the survival rate of patients was recorded, and the survival curve was drawn. According to results, the 5‐year survival rate of breast cancerpatients with low or normal expression of miR‐205‐3p was significantly higher than that in patients with high expression of miR‐205‐3p (P < 0.01) (Figure 3).
Figure 3
5‐year survival curves of breast cancer patients. The 5‐year survival rate of patients with low or normal expression of miR‐205‐3p is significantly higher than that in patients with high expression of miR‐205‐3p
5‐year survival curves of breast cancerpatients. The 5‐year survival rate of patients with low or normal expression of miR‐205‐3p is significantly higher than that in patients with high expression of miR‐205‐3p
Construction of cell lines with miR‐205‐3p overexpression
After humanbreast cancer MCF‐7 cells were transfected with miR‐205‐3p lentivirus, the miR‐205‐3p expression in each group was detected via RT‐qPCR. Results showed that miR‐205‐3p expression levels in cells in blank control group and negative control group were significantly lower than that in hsa‐miR‐205‐3p group (P < 0.01), indicating successful construction of MCF‐7 cell lines with miR‐205‐3p overexpression (Figure 4).
Figure 4
Detection of miR‐205‐3p expression after transfection by RT‐qPCR. After MCF‐7 cells were transfected with has‐miR‐205‐3p, total RNA was isolated for analysis of the expression of miR‐205‐3p by RT‐qPCR. The miR‐205‐3p expression level in cells in hsa‐miR‐205‐3p group is significantly higher than those in blank control group and negative control group, **
P < 0.01
Detection of miR‐205‐3p expression after transfection by RT‐qPCR. After MCF‐7 cells were transfected with has‐miR‐205‐3p, total RNA was isolated for analysis of the expression of miR‐205‐3p by RT‐qPCR. The miR‐205‐3p expression level in cells in hsa‐miR‐205‐3p group is significantly higher than those in blank control group and negative control group, **
P < 0.01
Effects of miR‐205‐3p on proliferation, invasion, and apoptosis of breast cancer cells
Effects of miR‐205‐3p on proliferation, invasion, and apoptosis of MCF‐7 cells were detected via MTT assay, transwell assay, and flow cytometry, respectively. Results showed that both cell proliferation and invasion capacities in hsa‐miR‐205‐3p group were significantly higher than those in blank control group and negative control group (P < 0.01, P < 0.01). After transfection with miR‐205‐3p, the number of apoptotic cells in hsa‐miR‐205‐3p group was significantly decreased compared with those in the blank control group and negative control group (P < 0.01) (Figure 5).
Figure 5
Effects of miR‐205‐3p on cell proliferation, invasion, and apoptosis. (A) Cell proliferation detected via MTT assay. (B) Cell invasion detected via transwell assay. (C) Apoptosis detected via flow cytometry. After transfection with miR‐205‐3p, both cell proliferation and invasion capacities in hsa‐miR‐205‐3p group are significantly higher than those in blank control group and negative control group, but the apoptosis level is obviously decreased, **
P < 0.01
Effects of miR‐205‐3p on cell proliferation, invasion, and apoptosis. (A) Cell proliferation detected via MTT assay. (B) Cell invasion detected via transwell assay. (C) Apoptosis detected via flow cytometry. After transfection with miR‐205‐3p, both cell proliferation and invasion capacities in hsa‐miR‐205‐3p group are significantly higher than those in blank control group and negative control group, but the apoptosis level is obviously decreased, **
P < 0.01
Effects of miR‐205‐3p on related protein expressions
Ezrin, LaminA/C, cleaved caspase‐3, Bcl‐2, and Bax protein expressions in each group were detected via Western blotting. Results demonstrated that compared with those in the blank control group and negative control group, Ezrin, LaminA/C, and cleaved caspase‐3 expressions were significantly declined in hsa‐miR‐205‐3p group (P < 0.01), but the Bcl‐2/Bax ratio was increased significantly (P < 0.01) (Figure 6).
Figure 6
Detection of related protein expressions in MCF‐7 cells via Western blotting. (A) Protein bands. (B) Statistical graph of Ezrin protein expression level. (C) Statistical graph of LaminA/C protein expression level. (D) Statistical graph of cleaved caspase‐3 protein expression level. (E) Statistical graph of Bcl‐2/Bax protein expression level. Compared with those in the blank control group and negative control group, Ezrin, LaminA/C, and cleaved caspase‐3 expressions are remarkably lower in hsa‐miR‐205‐3p group, but the Bcl‐2/Bax ratio is higher. Data were presented as a fold change relative to GAPDH (mean ± SD). **
P < 0.01
Detection of related protein expressions in MCF‐7 cells via Western blotting. (A) Protein bands. (B) Statistical graph of Ezrin protein expression level. (C) Statistical graph of LaminA/C protein expression level. (D) Statistical graph of cleaved caspase‐3 protein expression level. (E) Statistical graph of Bcl‐2/Bax protein expression level. Compared with those in the blank control group and negative control group, Ezrin, LaminA/C, and cleaved caspase‐3 expressions are remarkably lower in hsa‐miR‐205‐3p group, but the Bcl‐2/Bax ratio is higher. Data were presented as a fold change relative to GAPDH (mean ± SD). **
P < 0.01
DISCUSSION
Breast cancer ranks first in the common malignant tumors in women, the current incidence of which accounts for more than 10% of the systemic tumors and seriously affects the physical health of women19 Breast cancer occurs frequently in postmenopausal women mainly at the age of 45‐65 years. With the environmental deterioration and other factors, a younger trend of breast cancer occurrence has been shown in recent years20 The radical surgical resection, combined with radiotherapy and chemotherapy, marks the improvement regarding the survival time of early breast cancerpatients, but its therapeutic effect is not satisfactory on advanced breast cancer patients21 miRNA, as a kind of endogenous small noncoding RNA, plays an important role in cell differentiation, proliferation, and apoptosis through regulating the signaling pathway. Accumulative evidences indicate that a variety of miRNAs are involved in the regulation process of several tumors and play similar roles to tumor suppressor genes and oncogenes22, 23 The abnormal expressions of miR‐21 and miR‐205 are possibly related to the occurrence and development of breast cancer12 Li et al24 found that the miR‐205 expression level is increased in epithelial ovarian cancer, and is closely related to the proliferation and invasion of ovarian cancer. In this study, we found that the level of miR‐205‐3p was significantly upregulated in breast cancer tissues, and further in vitro assay by overexpressing miR‐205‐3p validated its role on proliferation, invasion, and apoptosis of cancer cells, which was in line with previous findings24.Our data showed that Ezrin and LaminA/C protein expressions in MCF‐7 cells with miR‐205‐3p overexpression were significantly decreased compared with those in normal cells, which was consistent with previous finding25 Ezrin protein is an important protein molecule in the ERM protein family, which, as a connexin between cytoskeleton and cell membrane, plays an important regulatory role in cell movement and adhesion, cytoskeletal remodeling, etc Ezrin protein also exerts important effects on the occurrence and metastasis of tumors26 It has been demonstrated that Ezrin functions as a prognostic factor and may predict potential lung metastasis in osteosarcoma and could also possibly be used as a new therapeutic target27 Ezrin is closely linked with the metastatic progression of cancer and is required in tumor‐induced angio/lymphangiogenesis in vivo, which is frequently abnormally expressed in aggressive cancer types28 Interestingly, there is some controversy in the literature regarding the role of Ezrin in cancer metastasis and invasion. It has been indicated that the overexpression of Ezrin might promote ovarian cancer cell invasion and might predict poor prognosis29 However, the study revealed that patients who had negative or low Ezrin expression had a significantly shorter survival than those whose tumors had moderate or high Ezrin expression,30 which is consistent with our finding that Ezrin expressions were significantly declined in breast cancer tissues. Also, it has been shown that radixin, as a member of the ERM (ezrin/radixin/moesin) protein family, along with moesin and ezrin, was reduced in lung adenocarcinoma, including early‐stage bronchioloalveolar carcinoma31 An intriguing implication of our finding suggests that ezrin may function as tumor suppressors in breast cancer, besides lung adenocarcinoma oncogenesis, and have a distinct function in tumor cell invasion. Analysis of caveolin‐1 expression in ovarian carcinoma cell lines demonstrated DNA methylation and histone deacetylation as a means to downregulate caveolin expression32 The similar mechanisms may reduce ezrin expression, in addition to genetic alterations associated with breast carcinogenesis.Expression of A‐type lamins increases the risk of death from colorectal cancer because its presence gives rise to increased invasiveness but not affect cell proliferation33 By contrast, previous data indicate that low expression of lamin A/C is associated with an increased disease recurrence in stage II and III colon cancer patients34 Moreover, evidence unraveled that cultured breast cancer cell lines expressed less lamin A/C compared with noncancerous mammary gland cells, which is in line with our result that LaminA/C was significantly decreased in breast cancer tissues35 The loss of lamin A/C expression is associated with variables of poor prognosis and shorter outcome in patients with breast cancer36 The loss of A‐type lamins was shown to induce changes in nuclear distribution of telomeres and to affect telomere function, thereby inducing chromosomal instability37 The malfunction of A‐type lamins will increase chromosomal instability and stimulate carcinogenesis. Increasing genomic instability may enhance tumor progression, including generation of tumor cell clones that have the capacity to cause disease recurrence.Mitochondrial pathway plays an important role in mediating the apoptosis process. Antiapoptotic protein Bcl‐2, proapoptotic protein Bax, and downstream cleaved caspase‐3 are involved in apoptosis cascade reaction and apoptosis of tumor cells38 Both in vitro and in vivo experiments in this study manifested that the increased miR‐205‐3p expression led to the significant decrease in the cleaved caspase‐3 expression, significant increase in the Bcl‐2/Bax ratio in cells, thus reducing the apoptosis level.Wei et al39 studied and found that miR‐205 has close correlations with clinical progression and prognosis of ovarian cancerpatients. In this study, correlations of miR‐205‐3p expression in tumor tissues with clinicopathological conditions and recurrence of breast cancerpatients were analyzed. According to results, the miR‐205‐3p expression was related to the size, TNM staging, metastasis, and recurrence of tumor, and the 5‐year survival rate of patients with high expression of miR‐205‐3p was obviously lower than that of patients with normal or low expression. Moreover, miR‐205‐3p was identified as an independent factor for the survival of breast cancerpatients. Our data demonstrate that correlation of miR‐205‐3p with prognosis of breast cancerpatients was established in those patients that died because the breast cancer but no other causes and miR‐205‐3p may serve as an important gene for prognosis evaluation of breast cancer. The limitation in our study still exists that the controversial result regarding the changes in Ezrin, LaminA/C in tumor tissues, and the potential mechanisms remain to be further investigated. We propose that cancer cells exhibit a variety of features indicative of atypical nuclei, while the changes in these indicators may be further related to tumor's pathological classification and cancer progression.In conclusion, significantly higher miR‐205‐3p expression is found in breast cancer tissues and associated with shorter survival of patients. Highly expressed miR‐205‐3p promotes the proliferation and invasion and reduces the apoptosis of breast cancer cells in vitro, suggesting therapeutic targeting miR‐205‐3p might be a novel approach for the treatment of breast cancer.
Authors: Martin Köbel; Elise Gradhand; Katharina Zeng; Wolfgang D Schmitt; Karen Kriese; Tilmann Lantzsch; Matthias Wolters; Jürgen Dittmer; Hans G Strauss; Christoph Thomssen; Steffen Hauptmann Journal: Int J Gynecol Pathol Date: 2006-04 Impact factor: 2.762
Authors: Ignacio Gonzalez-Suarez; Abena B Redwood; Stephanie M Perkins; Bart Vermolen; Daniel Lichtensztejin; David A Grotsky; Lucia Morgado-Palacin; Eric J Gapud; Barry P Sleckman; Teresa Sullivan; Julien Sage; Colin L Stewart; Sabine Mai; Susana Gonzalo Journal: EMBO J Date: 2009-07-23 Impact factor: 11.598
Authors: G Bulut; S-H Hong; K Chen; E M Beauchamp; S Rahim; G W Kosturko; E Glasgow; S Dakshanamurthy; H-S Lee; I Daar; J A Toretsky; C Khanna; A Uren Journal: Oncogene Date: 2011-06-27 Impact factor: 9.867
Authors: Ivan D Osipov; Ivan A Zaporozhchenko; Anna A Bondar; Marat M Zaripov; Vladimir E Voytsitskiy; Valentin V Vlassov; Pavel P Laktionov; Evgeny S Morozkin Journal: Adv Exp Med Biol Date: 2016 Impact factor: 2.622
Authors: Minghui Li; Yan Zhou; Tiansong Xia; Xin Zhou; Zebo Huang; Huo Zhang; Wei Zhu; Qiang Ding; Shui Wang Journal: Breast Cancer Res Treat Date: 2018-03-20 Impact factor: 4.872