| Literature DB >> 31557418 |
Yaling Zhai1, Yuanyuan Qi1, Xiaoqing Long1, Yanna Dou1, Dong Liu1, Genyang Cheng1, Jing Xiao1, Zhangsuo Liu1, Zhanzheng Zhao1.
Abstract
Peripheral blood mononuclear cells (PBMCs) play important roles in the pathogenesis of IgA nephropathy (IgAN). Our study aimed to provide a deep understanding of IgAN and focused on the dysregulation of hsa-miR-590-3p and its target gene HMGB2 in PBMCs. Three gene expression profile datasets (GSE14795, GSE73953 and GSE25590) were downloaded from the GEO database. The DEGs (differentially expressed genes)-miRNA network that was associated with IgAN was constructed by Cytoscape, and HMGB2 and hsa-miR-590-3p were selected for further exploration. The dual-luciferase reporter system was utilized to verify their interaction. Then, the expression levels of HMGB2 and hsa-miR-590-3p in PBMCs were detected by qPCR in another cohort, and the correlation of their expression levels with the clinical pathological manifestations and serum Gd-IgA1(galactose-deficient IgA1) levels was also investigated. HMGB2 was identified as the target gene of hsa-miR-590-3p. Furtherly, the elderly patients had higher HMGB2 expression levels than the expression levels of the younger patients. As the serum creatinine, serum BUN levels increased, the expression of HMGB2 decreased; Besides, the HMGB2 expression was positively correlated with serum complement 3(C3) levels, and it also had a negative correlation with the diastolic blood pressure, but not reach statistical significance. What is more, both hsa-miR-590-3p and HMGB2 expression had a slight correlation tendency with serum Gd-IgA1 levels in the whole population. In conclusion, HMGB2, the target gene of hsa-miR-590-3p, was identified to correlate with the severity of IgAN, and this provides more clues for the pathogenesis of IgAN.Entities:
Keywords: HMGB2; IgA nephropathy; hsa-miR-590-3p
Mesh:
Substances:
Year: 2019 PMID: 31557418 PMCID: PMC6815813 DOI: 10.1111/jcmm.14582
Source DB: PubMed Journal: J Cell Mol Med ISSN: 1582-1838 Impact factor: 5.310
Figure 1Flowchart of the analysis process
Information on the three gene expresssion profile dataset
| Before nomalization | After normalization | Platforms | |||
|---|---|---|---|---|---|
| IgAN sample count | Control sample count | IgAN sample count | Control sample count | ||
| GSE14795 | 12 | 8 | 8 | 6 | Affymetrix Human Genome U133A Array |
| GSE73953 | 15 | 16 (pooled) | 15 | 16 (poold) | Agilent‐014850 Whole Human Genome Microarray 4x44K G4112F |
| GSE25590 | 7 | 7 | 4 | 3 | GPL7731 Agilent‐019118 Human miRNA Microarray 2.0 |
The primer pairs for HMGB2, GAPDH and has‐mir‐590‐3p
| Sequence | ||
|---|---|---|
| HMGB2 | F | 5′‐GTGGCCTAGCTCGTCAAGTT‐3′ |
| R | 5′‐GCGTACGAGGACATTTTGCC‐3′ | |
| GAPDH | F | 5′‐GGGAAACTGTGGCGTGAT‐3′ |
| R | 5′‐GAGTGGGTGTCGCTGTTGA‐3′ | |
| hsa‐miR‐590‐3p | F | 5′‐TAATTTTATGTATAAGCTAGT‐3′ |
| R | 5′‐GTGCAGGGTCCGAGGT‐3′ | |
7miRNAs and 19 targeted genes associated with IgAN
| Gene symbol | Fold change (Log2 transformed) | microRNA |
|---|---|---|
|
| −1.65 | hsa‐miR‐519c‐3p |
|
| −1.75 | hsa‐miR‐520b |
|
| −1.21 | hsa‐miR‐920 |
|
| −1.29 | hsa‐miR‐590‐3p |
|
| −1.76 | hsa‐miR‐519c‐3p |
|
| −1.22 | hsa‐miR‐590‐3p |
|
| −1.13 | hsa‐miR‐384 |
|
| −1.85 | hsa‐miR‐648 |
|
| −1.29 | hsa‐miR‐590‐3p |
|
| −1.37 | hsa‐miR‐384 |
|
| −1.12 | hsa‐miR‐590‐3p |
|
| −1.29 | hsa‐miR‐873 |
|
| −1.57 | hsa‐miR‐648 |
|
| −1.17 | hsa‐miR‐648 |
|
| −1.33 | hsa‐miR‐384 |
|
| −1.65 | hsa‐miR‐384 |
|
| −1.29 | hsa‐miR‐384 |
|
| −1.42 | hsa‐miR‐873 |
|
| −1.09 | hsa‐miR‐384 |
GO and KEGG enrichment analysis results for DEGs identified in the three microarray
| Description | gene count | Pvalue | Genes |
|---|---|---|---|
| GO terms | |||
| GO:0044699‐single‐organism process | 18 | 1.00 × 10‐3 |
|
| GO:0044707‐single‐multicellular organism process | 13 | 4.07 × 10‐6 |
|
| GO:0032501‐multicellular organismal process | 13 | 7.82 × 10‐6 |
|
| GO:0048856‐anatomical structure development | 11 | 5.60 × 10‐5 |
|
| GO:0044767‐single‐organism developmental process | 11 | 1.13 × 10‐4 |
|
| GO:0032502‐developmental process | 11 | 1.32 × 10‐4 |
|
| GO:0060255‐regulation of macromolecule metabolic process | 11 | 1.57 × 10‐3 |
|
| GO:0019222‐regulation of metabolic process | 11 | 6.12 × 10‐3 |
|
| GO:0007275‐multicellular organism development | 10 | 1.02 × 10‐4 |
|
| GO:0048518‐positive regulation of biological process | 10 | 5.60 × 10‐4 |
|
| GO:0016043‐cellular component organization | 10 | 5.45 × 10‐3 |
|
| GO:0080090‐regulation of primary metabolic process | 10 | 6.26 × 10‐3 |
|
| GO:0071840‐cellular component organization or biogenesis | 10 | 6.85 × 10‐3 |
|
| GO:0031323‐regulation of cellular metabolic process | 10 | 6.93 × 10‐3 |
|
| GO:0048522‐positive regulation of cellular process | 9 | 5.74 × 10‐4 |
|
| GO:0048731‐system development | 8 | 1.59 × 10‐3 |
|
| GO:0006996‐organelle organization | 8 | 4.66 × 10‐3 |
|
| GO:0006464‐cellular protein modification process | 8 | 9.25 × 10‐3 |
|
| GO:0036211‐protein modification process | 8 | 9.25 × 10‐3 |
|
| GO:0048468‐cell development | 7 | 9.85 × 10‐5 |
|
| GO:1902589‐single‐organism organelle organization | 7 | 2.16 × 10‐3 |
|
| GO:0009893‐positive regulation of metabolic process | 7 | 3.75 × 10‐3 |
|
| GO:0030154‐cell differentiation | 7 | 3.83 × 10‐3 |
|
| GO:0065008‐regulation of biological quality | 7 | 4.32 × 10‐3 |
|
| GO:0048869‐cellular developmental process | 7 | 7.37 × 10‐3 |
|
|
| |||
| hsa00760‐Nicotinate and nicotinamide metabolism | 1 | 2.94 × 10‐2 |
|
| hsa00510‐N‐Glycan biosynthesis | 1 | 4.76 × 10‐2 |
|
Figure 2IgAN‐associated gene‐miRNA network
Figure 3HMGB2 is the target gene of hsa‐miR‐590‐3p (a) Binding site of hsa‐miR‐590‐3p in the HMGB2 wild‐type (WT) or mutation (MU) 3′‐UTR. (b) Luciferase reporter assays were performed to verify the binding of hsa‐miR‐590‐3p in 3′‐UTR of HMGB2. HEK293T cells cotransfected with hsa‐mir‐590‐3p mimics and pmiR‐GLO‐3’UTR‐HMGB2wt displayed significantly reduced luciferase activity compared with those cotransfected with NC and pmiR‐GLO‐3’UTR‐HMGB2mu (4.20 ± 0.30 vs 7.16 ± 0.51, P = .001). While the luciferase activity of cells cotransfected with hsa‐mir‐590‐3p mimics and pmiR‐GLO‐3’UTR‐HMGB2mu displayed no significant changes compared with cells cotransfected with NC and pmiR‐GLO‐3’UTR‐HMGB2mu
The baseline data of 37 patients with IgAN
| Characters | Mean ± SD or median(IQR) or n |
|---|---|
| Male/female | 23/14 |
| Age (year) | 42.11 ± 14.80 |
| With hypertension (%) | 26(70.27%) |
| SBP (mmHg) | 135.97 ± 17.61 |
| DBP (mmHg) | 86.00 ± 10.39 |
| 24 h proteinuria (g/d) | 1.75 (0.75,4.09) |
| SCR (μmol/L) | 117 (82,189.50) |
| BUN (mmol/L) | 6.60 (5.00,11.61) |
| Uric Acid (μmol/L) | 342.19 ± 82.37 |
| Albumin (g/L) | 35.23 ± 8.98 |
| TCHO (mmol/L) | 4.40 (3.59,5.43) |
| TG (mmol/L) | 1.93 (1.17, 2.60) |
| C3 (mg/L) | 1.21 (1.04,1.38) |
| C4 (mg/L) | 0.30 (0.25, 0.34) |
| Blood cell count in urine | 24.50 (5.25,48.75) |
| Oxford classification (n) | |
| M score (M0/M1) | 28/9 |
| E score (E0/E1) | 29/8 |
| S score (S0/S1) | 16/21 |
| C score(C0/C1/C2) | 17/18/2 |
| T score (T0/T1/T2) | 20/8/9 |
Figure 4Compared with healthy controls, patients with IgAN presented significantly lower HMGB2 expression (A: 0.91 (0.80, 1.13) vs 1.34 (1.10, 2.54), P = .003), and higher hsa‐mir‐590‐3p expression (B: 1.55 (0.96,1.90) vs 0.70(0.45,1.30), P = .012); The scatter plot showed significantly negative correlation between the expression of hsa‐mir‐590‐3p and HMGB2 (C: r = −0.386, P = .008); Serum Gd‐IgA1 levels were significantly elevated in IgAN patients (D: 3612.67(2310.67, 5883.02) vs 1981.79(1406.55, 2487.19) ng/ml, P = .004), and the slight correlation tendency was found with hsa‐mir‐590‐3p and HMGB2 expression (D: r = 0.270, P = .073; F: r = −0.236, P = .119) in the whole population
Figure 5The expression levels of HMGB2 were significant positively correlated with age and serum C3(age: r = 0.336, P = .042; serum C3: r = 0.416, P = .020; as shown in A, D), but negatively correlated with serum creatinine, BUN, diastolic blood pressure(serum creatinine: r = −0.335, P = .043; BUN: r = −0.414, P = .011; as shown in B, C); and had the trend of negative correlation with diastolic blood pressure(r = −0.320, P = .053, E)