Phylogenic classification and virulence genes profiles of uropathogenic E. coli and diarrhegenic E. coli strains isolated from community acquired infections.

The emergence of E.coli strains displaying patterns of virulence genes from different pathotypes shows that the current classification of E.coli pathotypes may be not enough, the study aimed to compare the phylogenetic groups and urovirulence genes of uropathogenic Escherichia coli (UPEC) and diarrheagenic E.coli (DEC) strains to extend the knowledge of E.coli classification into different pathotypes. A total of 173 UPEC and DEC strains were examined for phylogenetic typing and urovirulence genes by PCR amplifications. In contrast to most reports, phylogenetic group A was the most prevalent in both UPEC and DEC strains, followed by B2 group. Amplification assays revealed that 89.32% and 94.29% of UPEC and DEC strains, respectively, carried at least one of the urovirulence genes, 49.5% and 31.4% of UPEC and DEC strains, respectively, carried ≥ 2 of the urovirulence genes, fim H gene was the most prevalent (66.9% and 91.4%) in UPEC and DEC strains respectively. Twenty different patterns of virulence genes were identified in UPEC while 5 different patterns in DEC strains. Strains with combined virulence patterns of four or five genes were belonged to phylogenetic group B2. Our finding showed a closer relationship between the DEC and UPEC, so raised the suggestion that some DEC strains might be potential uropathogens. These findings also provide different insights into the phylogenetic classification of E. coli as pathogenic or commensals where group A can be an important pathogenic type as well as into the classification as intestinal or extra- intestinal virulence factors.

Introduction

Escherichia coli are normal inhabitants of gastrointestinal tract of humans and many animals, however some E.coli strains acquired specific virulence genes that enable them to cause intestinal and extra-intestinal infections in humans such as diarrhea and urinary tract infections [1]. Diarrheagenic E.coli (DEC) represent a leading bacterial cause of diarrhea all over the world. DEC pathotypes are characterized by their specific virulence determinants [2]. E.coli strains causing extra-intestinal infections are known as extra-intestinal pathogenic E.coli (ExPEC) [3]. Molecular and epidemiological studies have identified ExPEC as a distinct E. coli type. ExPEC strains usually carry characteristic virulence factors that allow colonization of the host mucosa and conferring their pathogenic potential [4].

Urinary tract infection (UTI) is the most common extra-intestinal infection caused by E.coli [5], which occur mainly due to the spread of Uropathogenic Escherichia coli (UPEC) strains from the intestine to the urinary tract [6]. These strains become pathogenic by acquiring new virulence properties encoded by specific genes, allowing them to colonize host mucosal surfaces and invade the normally sterile urinary tract [5]. Surface virulence factors (adhesins) are very important virulence factor of UPEC as the main attachment factor, P fimbriae is associated with pyelonephritis and is encoded by pap genes. [7]. Other adhesins that act as virulence factors are S fimbrial adhesin, which is coded by sfa genes and Type 1 fimbriae which is encoded by the fim gene cluster[8, 9, 10,11]. A part from adhesins, important virulence factors of UPEC strains are the toxins that cause an inflammatory response. The most important secreted virulence factor is a lipoprotein toxin called α-haemolysin (HlyA) which is encoded by hlyA gene [12]. Regarding phylogenetic typing, E.coli strains are classified into four major phylogenetic groups (phylogroups) named as A, B1, B2, and D [13], moreover these phylogenetic groups are intertwined with virulence patterns [1]. Each E.coli type has characteristic patterns, which allow them to colonize and invade their host [14]. However, exceptions exist where some UPEC strains have been reported to carry DEC markers [15], on the other hand, some DEC strains carry virulence factors associated with UPEC [5, 15]. Interestingly, E.coli strains that carry genetic determinants from different E.coli pathotypes are now termed as “heteropathogenic E.coli” [14, 16, 17], so the current classification of E.coli pathotypes may be not enough [18, 19]. These findings raised the suggestion that some DEC strains might be potential uropathogens. The current study has investigated a collection of DEC and UPEC strains isolated from clinical cases regarding the presence of urovirulence determinants and phylogenetic grouping. The aim was to detect whether DEC strains share virulence properties with the UPEC pathotypes and to recognize their phylogenetic diversity.

Materials and methods

A total of 173 E.coli strains were included in the study were recovered from patients of both sex and different ages presenting symptomatic UTIs and diarrhea. A total of 103 isolates were recovered from urine samples of patients with UTIs (UPEC) during outpatient treatment (patients who visited an acute day ward were considered to be outpatients). E.coli UTI was diagnosed by clinical symptoms such frequency, urgency, dysuria, small-volume voids or lower abdominal pain in addition to urine culture with a colony count >105 CFU E.coli/ml in midstream urine sample. Seventy strains were recovered from the stool samples of patients with diarrhea (DEC) during outpatient treatment. Diarrhea was diagnosed by, passage of loose stools for three times or more daily, in addition to one or more of characteristic clinical symptoms (nausea, vomiting, abdominal pain or cramps, fecal urgency, or dysentery). The samples of the study were collected from outpatients' clinics, Minia University Hospitals, Egypt during the period from January to March 2018.

Ethics statement

The study protocol was approved by Minia Faculty of Medicine Review Board (code: 46 A at 2/1/2018). Written informed consents were obtained from all patients for the use of their samples.

Bacterial isolates

Urine samples were cultured on chromogenic media (CHROMagar™ Orientation, Paris, France), while diarrhea samples were cultured on MacConkey and EMB agar. The isolates were confirmed as E.coli by standard bacteriological and biochemical tests including indole, urease, citrate and sugar fermentation tests. E. coli as the sole urine and stool Cultures microorganism were only included. Strains confirmed as E. coli were kept in trypticase soy broth with sterilized 15% glycerol at—20°C. The DEC strains were identified as enteroaggregative E. coli (EAEC) by PCR technique [20].

DNA extraction

DNA was extracted by using the QIAamp DNA extraction Mini kit (Qiagen, Hilden, Germany) according to manufacturer’s instructions. DNA was used immediately or stored at—20°C until used.

Phylogenetic analysis

E. coli isolates were classified into phylogenetic groups by targeting two marker genes (chuA and yjaA) and a DNA fragment TSPE4.C2 (Table 1) by triplex PCR as described previously [21]. Additional sub-grouping scheme proposed by Branger et al, 2005 was used [22].

Table 1

Primers sequences used for PCR assays.

Genes	Primer sequence	Size fragment (bp)	Reference
CVD432	CTGGCGAAAGACTGTATCATCAATGTATAGAAATCCGCTGTT	630	[20]
ChuA	F-GACGAACCAACGGTCAGGATR-TGCCGCCAGTACCAAAGACA	279	[21]
yjaA	F-TGAAGTGTCAGGAGACGCTGR-ATGGAGAATGCGTTCCTCAAC	211	[21]
TspE4C2	F-GAGTAATGTCGGGGCATTCAR-CGCGCCAACAAAGTATTACG	154	[21]
fimH	F: TGCAGAACGGATAAGCCGTGGR: GCAGTCACCTGCCCTCCGGTA	506	[23]
Sfa (sfa/foc)	F: CTCCGGAGAACTGGGTGCATCTTACR: CGGAGGAGTAATTACAAACCTGGCA	410	[24]
pap A	F: ATGGCAGTGGTGTTTTGGTGR:CGTCCCACCATACGTGCTCTTC	720	[23]
pap E/F	F: GCAACAGCAACGCTGGTTGCATCATR: AGAGAGAGCCACTCTTATACGGACA	336	[25]
hly A	F: AACAAGGATAAGCACTGTTCTGGCTR: ACCATATAAGCGGTCATTCCCGTCA	1170	[25]
iroN	F AAGTCAAAGCAGGGGTTGCCCGR GACGCCGACATTAAGACGCAG	665	[26]

Detection of virulence genes

Specific primers were used to amplify sequences of 6 different virulence genes. Primer sequences and predicted sizes of the PCR products are shown in (Table 1). The amplification reactions were carried out using Biometra, UNO II thermal cycler (Goettingen, Germany) under the following conditions: initial denaturation at 95°C for 5 min, followed by 35 cycles of: 30 s at 94°C for, 30s at 63°C, then 30 s at 72°C, with a final extension step at 72°C for 5 min. PCR was performed in a 25 ml reaction mixture containing1 ul of template DNA (*100 ng/ml), 12.5 ml of PCR mastermix (Maxima Hot Start Green PCR Master Mix, USA), and 1 ul (10 pmol) of each primer and 9.5 ml of nuclease free water. PCR products were resolved on 2% agarose gel and visualized under a UV transilluminator (Biometra).

Statistical analysis

The chi -square test or the Fisher’s exact test was used. P <0.05 was considered statistically significant (two-tailed).

Results

Phylogenetic grouping and virulence genes were characterized in103 UPEC isolates and 70 DEC isolates (EAEC) using PCR assay. Regarding the phylogenetic analysis, the predominant groups were A1 (31.1% UPEC, 37.1% DEC) with no significant difference (p value = 0.723); A0 (23.3%UPEC, 12.9%DEC; p value = 0.068) followed by group B2 then group D1. Phylogenetic groups D2 and B1 were detected only in UPEC isolates and were not detected in DEC isolates. There were no significant difference between phylogenetic distribution in UPE and DEC isolates (Fig 1 and S1 Fig). Six virulence genes were examined in103 UPEC isolates and 70 DEC isolates (EAEC) to compare between the virulence repertoires of them. The six studied virulence genes were detected in UPEC isolates while only 4 genes were detected in DEC isolates. The most frequently detected virulence gene in UPEC and DEC isolates was fimH (UPEC isolates: n = 69/103, 66.9%; DEC isolates: n = 64/70, 91.4%). The frequencies of iroN gene were detected in a similar percentage for both types of isolates; (UPEC: 37/103, 35.9%; DEC: 25/70, 35.7%). papA gene was detected in a percentage of (UPEC isolates: 14/103, 13.5%; DEC isolates: 8/70, 11.4%) and hlyA gene was found in only one isolate of UPEC (0.9%) and 2 isolates of DEC (2.9%). The sfa and papE genes were detected in UPEC isolates in (44/103, 42.7%) and (17/103, 17.1%) respectively but were not detected in DEC isolates at all. There were no significant differences between virulence genes in UPEC and DEC isolates, except for sfa gene (p value = 0.012) (Fig 2 and S2–S6 Figs).

Fig 1

Phylogenetic distribution of UPEC and DEC isolates.

Fig 2

Distribution of the virulence genes among UPEC & DEC isolates.

Based on the distribution of the various genes, all the studied strains exhibited 21 virulence gene patterns, referred to as Ec (Table 2). UPEC isolates showed 20 Ec patterns while DEC isolates showed 5 Ec patterns only. Ec1 was characterized by the presence of the fimH gene only which was the most noted pattern and found in 24 UPEC isolates (23.3%) and 44 DEC isolates (62.9%). Ec3 (fimH & iroN genes) was the most frequent combined virulence pattern (11, 10.67% of UPEC and 14, 20%) of DEC isolates) followed by Ec5 (fimH &sfa genes; 9, 8.7% of UPEC isolates) and Ec10 (fimH, papE &iroN), (3, 2.91% of UPEC; 6, 8.57% of DEC isolates. The distribution of virulence patterns in phylogenic groups are summarized in Table 2.

Table 2

Virulence patterns (EC) distribution among Phylogenetic groups of UPEC and DEC E.coli isolates.

Virulence pattern	Phylogenetic group							IsolatesN (%)
	A0	A1	B1	B2 2	B2 3	D1	D2	UPEC	DEC
Ec1(UPEC/DEC)	9 /5	8/16	1/-	2/6	1/11	3/6	-	24 (23.3%)	44 (62.9%)
Ec2	2	2	-	1	6	1	-	12(11.65%)	0
Ec3(UPEC/DEC)	2/2	5/8	1	-/2	1/2	2	-	11(10.67%)	14 (20%)
Ec4(UPEC/DEC)	5/2	3/2	1	-	-	1	1	11(10.67%)	4 (5.71%)
Ec5	3	5	-	-	-	1	-	9 (8.7%)	0
Ec6	-	2	-	2	2	-	-	6 (5.8%)	0
Ec7	-	1	2	2	-	-	-	5 (4.85%)	0
Ec8	-	1	-	-	-	2	-	3 (2.91%)	0
Ec9	-	-	1	-	-	2	-	3 (2.91%)	0
Ec10(UPEC/DEC)	-	-	-	1/2	-/2	-/2	2	3 (2.91%)	6 (8.57%)
Ec11	-	-	-	-	-	1	1	2 (1.94%)	0
Ec12	-	1	-	1	-	-	-	2 (1.94%)	0
Ec13	2	-	-	-	-	-	-	2 (1.94%)	0
Ec14	-	-	-	-	2	-	-	2 (1.94%)	0
Ec15	-	-	-	2	-	-	-	2 (1.94%)	0
Ec16	-	2	-	-	-	-	-	2 (1.94%)	0
Ec17	-	1	-	-	-	-	-	1 (0.97%)	0
Ec18	-	1	-	-	-	-	-	1 (0.97%)	0
Ec19	1	-	-	-	-	-	-	1 (0.97%)	0
Ec20	-	-	-	-	1	-	-	11 (0.97%)	0
Ec21(UPEC/DEC)	-	-	-	-/2	-	-	-	0	2 (2.86%)
total(UPEC/DEC)	24/9	32/26	6/-	11/12	13/15	13/8	4/-	103(100%)	70(100%)

UPEC, uropathogenic E.coli; DEC, Diarrheagenic E.coli; Ec1include (fimH gene); Ec2 (sfa gene); Ec3 (fimH and iroN genes); Ec4 (no genes detected); Ec5 (fimH and sfa); Ec6 (fimH, sfa, papE and iroN genes); Ec7 ((fimH, sfa and iroN genes); Ec8 (fimH and papA); Ec9 (papE); Ec10 (fimH, papA and iroN genes); Ec11 (sfa and iroN genes); Ec12 (fimH, sfa, papE); Ec13 (sfa, papA and iroN genes); Ec14 (sfa, papA, papE and iroN genes); Ec15 (fimH, sfa, papA, papE and iroN genes); Ec16 ((fimH, papE and iroN genes), Ec17 (papA); Ec18 (papE); Ec19 ((fimH, sfa, papA); Ec20 (fimH, sfa, iroN and hly); Ec21 (fimH, iroN and hly genes).

Discussion

Each E.coli type has characteristic phylogenetic and virulence patterns, which allow them to colonize and invade their host [14]. The phylogenetic analysis classify E.coli pathotypes into 4 major phylogenetic groups A, B1, B2 and D [13]. Several previous studies have reported that B2 and D phylogroups are the most common among UPEC isolates [27, 28], while isolates in phylogenetic groups A and B1 were mostly identified as commensal E.coli isolates [29]. Our study has reported different findings, where the predominant phylogenetic group in UPEC isolates was A1 (31.1%), followed by B2 (23.3%), A0 (23.3%), and lastly D1 (12.6%), that agree with some previous studies [30, 31]. The predominance of phylogenetic group A in UPEC isolates which is usually associated with commensal strains suggesting that the gastrointestinal tract is the main source of strains that colonize the urinary tract [32, 33]. The distribution of virulence genes and phylogenetic types varies among different countries, for example, group A was the most prevalent in Russia [34], and also in China [35] in UPEC, so our findings can be explained by geographical variation.

Phylogenetic group A was also the predominant in DEC isolates of the current study, where the frequency of A1 type was (37.1%) and A0 was (12.9%). The predominance of phylogenetic group A in DEC isolates suggesting that the source of gastrointestinal tract infection can be endogenous even in immunocompetent persons. Although several previous reports showed that group B2 E.coli strains are rare in fecal samples of healthy persons [36, 37], group B2 was recorded in a high percent (38.5%) in our DEC isolates so our data reveals that acquiring the group B2 strain is important for developing of infection. On the other hand, previous studies, which investigated DEC isolates in Costa Rica [38] and Peru [39], showed that most of the isolates belonged to B1 and D groups respectively that disagrees with our study and reflects the diversity of DEC isolates in different countries. In order to find possible link between strain phylogeny and virulence genes, we analyzed an overall virulence profile (fimH, sfa, iroN, pap A, papE and hly A genes) in UPEC and DEC strains. The six studied virulence genes were detected in UPEC isolates while only 4 genes were detected in DEC isolates. The most frequent gene was fimH gene (66.9% of UPEC isolates and 91.4% of DEC). A similar prevalence (65.9%) was detected in a previous study in Egypt [40] and also in other countries [41, 42]. For the other virulence genes sfa, iroN, papA, papE and hly A; the prevalence in our study was 42.7%, 35.9%, 13.6%, 16.5%, and 0.9% respectively in UPEC isolates. Our results were near to some studies in percent of sfa and iroN but the percent of pap and hlyl genes was lower [42]. Our results showed that the UPEC strains have different virulence profiles compared with other studies, suggesting that the virulence profile depends on the regional geography and climate or may be other factors.

The frequencies of urovirulence genes, iroN and papA detection in DEC were similar to that of UPEC isolates. There were no significant differences between virulence genes in UPEC and DEC isolates, except for sfa gene (p value = 0.012). About 66/70, 94.3% of DEC isolates carry at least one urovirulence gene. These findings showed a closer relationship between DEC specially EAEC and UPEC that may be explained by the remarkable genome plasticity or gene transfer in E.coli strains which leads to appearance of virulent strains displaying virulence genes from different pathotypes in a single isolate [18]. This interesting finding has shown that the classical classification of strains into pathotypes of E.coli is limited and inaccurate [19]. Our results showed that virulence genes were more prevalent in phylogroups A, so group A can be pathogenic and the other phylogoups as well. These findings also provide different insights into classification of E.coli pathotypes. A close relationship between the DEC and UPEC strains was reported, showing that DEC particularly the EAEC pathotype is an emerging enteropathogen which can cause intestinal and extra -intestinal infections, particularly in developing countries.

PCR product for different phylogenetic types.

(TIF)

Click here for additional data file.

PCR product of Fim A gene (506bp).

(TIF)

Click here for additional data file.

PCR product of hly A gene (1170bpbp) and sfa gene (410bp).

(TIF)

Click here for additional data file.

PCR product of pap E gene (336bp).

(TIF)

Click here for additional data file.

PCR product of pap A gene (720bp).

(TIF)

Click here for additional data file.

PCR product of iroN A gene (665bp).

(TIF)

Click here for additional data file.

27 Jul 2019

PONE-D-19-16993

Phylogenic classification and virulence genes profiles of uropathogenic E. coli and diarrhegenic E. coli strains isolated from community acquired infections

PLOS ONE

Dear DR Khairy,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

In particular, a number of issues pertinent to the rationale of the study (Reviewer 1 - 1b) and the specifics on study groups utilized need to be included. This is in addition a number of other issues identified by both reviewers.

We would appreciate receiving your revised manuscript by Sep 10 2019 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Praveen Thumbikat

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

http://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

1. Please provide additional details regarding participant consent. In the ethics statement in the Methods and online submission information, please ensure that you have specified (1) whether consent was informed and (2) what type you obtained (for instance, written or verbal). If your study included minors, state whether you obtained consent from parents or guardians. If the need for consent was waived by the ethics committee, please include this information.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The paper entitled: “Phylogenic classification and virulence genes profiles of uropathogenic E. coli and

diarrhegenic E. coli strains isolated from community acquired infections” characterizes a number of E. coli isolates from diarrheal and urinary infections.

The main problems that I find in this paper are:

a) Virulence factors such as siderophores or adhesins, hemolysins, etc. are very common in commensal E. coli and it is not surprising that many DEC also have these genes. Having these genes doesn’t mean that the bacteria are UPEC. UPEC virulence is thought to be a multigenic phenomenon and describing all the potentially virulence genes is not very relevant.

b) It is not clear how they obtained the EAEC isolates; if they obtained from fecal cultures is very odd that all diarrheic samples were positive to EAEC. Normally you obtain 5-20% of different DEC pathotypes. If strains were obtained from a collection, why the authors concentrate in EAEC and ignore DEC pathotypes?

c) Study group is not described either for UTI patients nor for diarrhea patients.

d) Many reports have shown that some intestinal pathotypes (DEC) can also cause urinary infection DAEC and EAEC, it is not a novel finding.

e) The association of some DEC or UPEC strains in this study with Clermon’s phylogenetic groups is not uncommon. Virulence genes are transferred horizontally.

Minor problems:

a) The manuscript contains many grammatical errors.

b) The discussion section is too long

c) Figures showing distributions of strains in Clermon’s phylogenetic groups are unnecessary.

d) Lines 39-41 text improvement is needed

e) 107-126 Confidence intervals 95% are not reported for frequency data. There is not p value reported next to percentage of positiveness.

f) Table 2 and table 3 could be join in one.

g) 149-151 Use UPEC instead of ExPEC because you are working only with urine infections associated isolates.

h) 159 Country names must be written with uppercase

i) 157-161 Improve English writing

j) The format of bibliographical references should be checked

Reviewer #2: Interesting article. It brings information that can be taken into account in future studies and analysis at a global level. Evaluations within the framework of general data are, however, rather geared towards parts of the globe and less in Europe (eg could be seen doi.org/10.1155/2019/5712371). Please review the English language. I've seen some errors to mention just one (page 4, 77, enteroaggragative). Please review the bibliography - it is not unitary written.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

2 Aug 2019

Reviewer comments 1 :

reviewer1`

a) Virulence factors such as siderophores or adhesins, hemolysins, etc. are very common in commensal E. coli and it is not surprising that many DEC also have these genes. Having these genes doesn’t mean that the bacteria are UPEC. UPEC virulence is thought to be a multigenic phenomenon and describing all the potentially virulence genes is not very relevant.

Response

Bacteria are classified as intestinal pathogenic E. coli (IPEC), which are associated with diarrhea, and extraintestinal pathogenic E. coli (ExPEC), which cause infections beyond the intestinal tract) not only on the basis of their virulence properties but also the site of infection (the diseases that they cause),, and their host of isolation (Russo TA, Johnson JR. 2000; Kaper, J. B. 2005; Kaper, J. B. et al 2004). The study was to compare the virulence genes in both UPEC isolated from patients with UTI and DEC isolated from patients suffering from diarrhea in Egypt, where the data is scarce. Our isolates were recovered from diagnosed clinical infections and from pure cultures, so they associated with the diseases caused by them

The hypothesis express, that uropathogenic E. coli (UPEC) strains than non-pathogenic strains acquiring new virulence factors by pathogenicity islands (Mladin et al., 2009).

Many reports lie in the same corner with us; (Connell I, et al. 1996) who reported that Expression of type 1 fimbriae (adhesin gene fimH ) has been closely associated with the early development of UTI (Connell I, et al. 1996. Proc. Natl. Acad. Sci. U. S. A. 93:9827–9832.) (Johnson JR and Russo TA. 2002; Köhler CD and Dobrindt U. 2011. And others) have demonstrated that the main ExPEC virulence factors, such as P fimbriae and α-hemolysin, are usually not present in intestinal pathogenic (IPEC) isolates.

Lee et al. (2010) found that among commensal strains, virulence factors were good predictors for urinary tract or blood stream infections, while Peirano et al. (2013) defined isolates positive for two or more of papA and/or papC, sfa/focDE, afa/draBC, kpsM II and iutA as ExPEC.

Our results agree with that UPEC virulence is thought to be a multigenic phenomenon as we found UPEC isolates exhibited 20 Ec patterns while DEC isolates exhibited 5 Ec patterns only. Combined virulence patterns are in UPEC. Some strains of E. coli can diverge from their commensal cohorts, taking on a more pathogenic nature. These strains acquire specific virulence factors (horizontal transfer of transposons, plasmids, bacteriophages, and pathogenicity islands).

-

- We also found that some virulence genes are not common in DEC isolates. sfa and papE genes were detected in UPEC isolates in (44/103, 42.7%) and (17/103, 17.1%) respectively but were not detected in DEC isolates at all.

VGs are ideal targets for determining the pathogenic potential of a given E. coli isolate (Kuhnert P, Boerlin P, Frey J. 2000. FEMS Microbiol. Rev. 24:107–117)

b) It is not clear how they obtained the EAEC isolates; if they obtained from fecal cultures is very odd that all diarrheic samples were positive to EAEC. Normally you obtain 5-20% of different DEC pathotypes. If strains were obtained from a collection, why the authors concentrate in EAEC and ignore DEC pathotypes?

We concentrated in EAEC because it is the most common type in Egypt (Ali et al., 2014; El Gamel et al., 2015). Other types are less frequent and their number in most of collections is not representative.

c) Study group is not described either for UTI patients or for diarrhea patients.

We thank the reviewer for comment. The revised manuscript included the reviewer's suggestion.

d) Many reports have shown that some intestinal pathotypes (DEC) can also cause urinary infection DAEC and EAEC, it is not a novel finding.

There are no studies done in Egypt to associate between DEC isolates and UPEC isolates. So we tried to study this issue in a new geographical area. Only one or 2 reports have studied the virulence factors of DEC (eae, bfp) in UTI.

The pathogenic E. coli strains use a complex multistep mechanism of pathogenesis involving a number of virulence factors depending upon the pathotype, which consists of attachment, host cell surface modification, invasin, a variety of toxins, and secretion systems which eventually lead toxins to the target host cells (kapper. 2004). Thus, VGs are ideal targets for determining the pathogenic potential of a given E. coli isolate (Kuhnert P, Boerlin P, Frey J. 2000).

e) The association of some DEC or UPEC strains in this study with Clermon’s phylogenetic groups is not uncommon. Virulence genes are transferred horizontally.

The phylogenetic grouping was done to identify the prevalence of different phylogenetic groups in Egypt and comparing between UPEC and DEC isolates to increase the knowledge about the geographical distributions of these types. In contrast to most reports, phylogenetic group A was the most prevalent in both UPEC and DEC strains, followed by B2 group. The predominance of phylogenetic group A which is usually associated with commensal strains suggesting that the gastrointestinal tract is the main source of strains that may be colonize the urinary tract. This increases and highlights the emergence of virulent phylogroups A and B1. This result was similar to some previous studies (Rahman et al., 2017). Although other studies showed the more prevalence of phylogenetic groups B2 and D (ElSayed Gawad et al., 2018). It was surprising that B1 type was not detected in DEC isolates at all.

Minor problems

a) The manuscript contains many grammatical errors.

We thank the reviewer for comment. The revised manuscript included the reviewer's suggestion

b) The discussion section is too long

We thank the reviewer for comment. The revised manuscript included the reviewer's suggestion

c) Figures showing distributions of strains in Clermon’s phylogenetic groups are unnecessary.

We thank the reviewer for comment. The revised manuscript included the reviewer's suggestion

d) We thank the reviewer for comment. The revised manuscript included the reviewer's suggestion

Lines 39-41 text improvement is needed

Done

e) 107-126 Confidence intervals 95% are not reported for frequency data. There is not p value reported next to percentage of positiveness.

We thank the reviewer for comment. The revised manuscript included the reviewer's suggestion

f) Table 2 and table 3 could be join in one.

We thank the reviewer for comment. The revised manuscript included the reviewer's suggestion

g) 149-151 Use UPEC instead of ExPEC because you are working only with urine infections associated isolates.

Ok

h) 159 Country names must be written with uppercase

Ok

i) 157-161 Improve English writing

We thank the reviewer for comment. The revised manuscript included the reviewer's suggestion

j) The format of bibliographical references should be checked

We thank the reviewer for comment. The revised manuscript included the reviewer's suggestion

Reviewer #2: Interesting article. It brings information that can be taken into account in future studies and analysis at a global level. Evaluations within the framework of general data are, however, rather geared towards parts of the globe and less in Europe (eg could be seen doi.org/10.1155/2019/5712371). Please review the English language. I've seen some errors to mention just one (page 4, 77, enteroaggragative). Please review the bibliography - it is not unitary written.

We thank the reviewer for comment. The revised manuscript included the reviewer's suggestion

Submitted filename: Response to Reviewers.docx

Click here for additional data file.

30 Aug 2019

[EXSCINDED]

Phylogenic classification and virulence genes profiles of uropathogenic E. coli and diarrhegenic E. coli strains isolated from community acquired infections

PONE-D-19-16993R1

Dear Dr. Khairy,

We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements.

Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.

Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

With kind regards,

Praveen Thumbikat

Section Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #2: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #2: (No Response)

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #2: No

4 Sep 2019

PONE-D-19-16993R1

Phylogenic classification and virulence genes profiles of uropathogenic E. coli and diarrhegenic E. coli  strains isolated from community acquired infections

Dear Dr. Khairy:

I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

For any other questions or concerns, please email plosone@plos.org.

Thank you for submitting your work to PLOS ONE.

With kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Praveen Thumbikat

Section Editor

PLOS ONE