Small non-coding RNA STnc640 regulates expression of fimA fimbrial gene and virulence of Salmonella enterica serovar Enteritidis.

BACKGROUND: Small non-coding RNAs (sRNAs) regulate bacterial gene expression at the post-transcriptional level. STnc640 is a type of sRNA that was identified in Salmonella Typhimurium.
RESULTS: In this study, STnc640 in Salmonella Enteritidis was confirmed to be an Hfq-dependent sRNA. TargetRNA software analysis showed that fimbrial genes fimA and bcfA were likely to be the target genes of STnc640. To investigate the target mRNAs and function of STnc640 in pathogenicity, we constructed the deletion mutant strain 50336△stnc640 and the complemented strain 50336△stnc640/pstnc640 in Salmonella Enteritidis 50336. The RT-qPCR results showed that the mRNA level of fimA was decreased, while bcfA was unchanged in 50336△stnc640 compared with that in the wild type (WT) strain. The adhesion ability of 50336△stnc640 to Caco-2 cells was increased compared to the 50336 WT strain. The virulence of 50336△stnc640 was enhanced in a one-day-old chicken model of S. Enteritidis disease as determined by quantifying the 50% lethal dose (LD50) of the bacterial strains.
CONCLUSIONS: The results demonstrate that STnc640 contributes to the virulence of Salmonella Enteritidis.

Background

Small non-coding RNAs (sRNAs) in bacteria are stable transcripts approximately 50–500 nucleotides in length, often encoded in intergenic regions (IGRs), that play important roles in regulating gene expression at the post-transcriptional level [1-4]. sRNAs regulate many physiological processes, including metabolism, iron homeostasis, outer membrane protein biosynthesis, quorum sensing, and virulence [5-8]. Many of these sRNAs require the RNA-chaperone Hfq [9]. Nearly 100 distinct sRNAs have been identified in Salmonella [10].

Salmonella enterica serovar Enteritidis is an important Gram-negative intracellular pathogen with a broad host range. It can infect young chickens and cause symptoms such as enteritis or systemic infection [11]. Adult chickens infected with Salmonella Enteritidis may have subclinical infections and become chronic carriers, leading to contamination of chicken meat and egg products and the resulting food-borne diarrheal illnesses in humans [12]. Adhesion to intestinal epithelial cells mediated by bacterial fimbriae is a necessary first step for colonization [13-16]. Whole-genome sequencing has identified 13 fimbriae operons in the Salmonella Enteritidis strain P125109 [17]. The fim operon directs the assembly of type I fimbriae, which are involved in reproductive tract infection and in egg contamination [15]. Type I fimbriae and other multiple fimbrial adhesins are also required for the colonization of the intestinal lumen and for the virulence of Salmonella Typhimurium in mice [18].

STnc640 is a novel Hfq-binding sRNA that was identified in Salmonella Typhimurium through deep sequencing and transcriptomic analysis of Hfq-bound sRNAs and mRNAs [19]. Here we constructed a stnc640 deletion mutant and characterized the role of this sRNA in bacterial adhesion and virulence.

Results

Hfq plays a positive role on STnc640 stability

To determine whether the stability of STnc640 depends on the sRNA chaperone protein Hfq, the abundance of stnc640 transcripts in S. Enteritidis WT strain 50336, mutant 50336△hfq and the complemented mutant 50336△hfq/phfq were determined using RT-qPCR. The abundance of stnc640 was significantly reduced in 50336△hfq, exhibiting only about 2% of that in the WT strain (P < 0.01) and was restored in the 50336△hfq/phfq mutant (Fig. 1). This indicated that Hfq played a positive role on STnc640 stability.

Fig. 1

Fold changes of the STnc640 gene mRNA level were measured in the mutant 50336△hfq and complementation strain 50336△hfq/phfq by RT-qPCR compared with the wild-type S. Enteritidis 50336. Assays were performed in triplicate. **Indicates statistically significant difference compared with the wild type strain (p < 0.01)

Candidate mRNA targets of STnc640

Candidate mRNA targets of STnc640 were predicted using TargetRNA2 [20]. There were nine consecutive hybridization seeds between the AU-rich region of STnc640 (nts 263–277) and bcfA (nts 37–51). There were 11 consecutive hybridization seeds between the coding sequences (codons 8–25) of fimA mRNA and STnc640 (codons 99–125).

Construction and growth characteristics of the mutant 50336△stnc640 and complemented strain 50336△stnc640/pstnc640

S. Enteritidis strain 50336 contains an stnc640 gene with 97% identity to the S. Typhimurium strain LT2 stnc640 gene. STnc640 was located in a non-coding region between the genes SEN1810 and icdA in S. Enteritidis. In the construction of the deletion and the complemented strains, a 460 bp DNA fragment of the non-coding region was deleted and complemented. We constructed an stnc640 deletion mutant 50336△stnc640 and compared its growth to the WT and complemented strains. The growth rate of 50336△stnc640 was significantly reduced during the log phase from 2 h to 3 h (P < 0.05) (Fig. 2).

Fig. 2

Growth curves of wild-type S. Enteritidis 50336, mutant 50336△stnc640, and complementation strain 50336△stnc640/pstnc640. OD600 values of triplicate cultures in LB medium were determined at 1 h intervals. Data are the means of three independent experiments. The box in the figure indicates that the growth was significantly reduced from 2 h to 3 h

STnc640 regulates fimA expression and affects adherence and invasion to Caco-2 cells

To determine whether bcfA and/or fimA expression are regulated by STnc640, we quantified bcfA and fimA expression using RT-qPCR. The fimA but not bcfA transcript abundance was reduced in the Δstnc640 mutant compared with the WT strain (Fig. 3). To investigate whether deleting stnc640 affected bacterial adhesion and invasion by regulating fimA, we performed bacterial adhesion and invasion assays. Δstnc640 was enhanced in adhering and invading to Caco-2 cells compared with the WT strain (Fig. 4).

Fig. 3

The mRNA levels of fimbrial genes fimA and bcfA were determined in the mutant 50336△stnc640 and 50336△stnc640/pstnc640 compared to wild-type S. Enteritidis 50336 by qRT-PCR. Assays were performed in triplicate

Fig. 4

Adherence to Caco-2 cells by wild-type S. Enteritidis 50336, mutant 50336△stnc640, and complementation strain 50336△stnc640/pstnc640. Data are expressed as mean ± standard deviation of triplicate experiments. *Indicates statistically significant difference compared with the wild type strain (p < 0.05)

Deleting stnc640 enhances virulence in chickens

LD50 assays were performed to analyze the effect of stnc640 on S. Enteritidis virulence in chickens. All of the chickens displayed intestinal hyperemia and diarrhea 10 h post infection. Higher mortality appeared when infected by 50336△stnc640 compared to the WT strain and the complemented strain. The mortality rates for 107, 108 and 109 CFU bacteria treatment were 5, 57 and 95% separately when infected by 50336△stnc640. The mortality rates for the above three dose treatment were 5, 50 and 85% separately when infected by the WT strain, and the rates were 0, 5 and 62% when infected by the complemented strain. The LD50s were calculated 14 days post-infection. The LD50 values of the WT strain 50336, 50336△stnc640 and 50336△stnc640/pstnc640 were 2.9 × 108, 2.0 × 108 and 5.1 × 108 CFU, respectively. This indicated that the virulence of 50336△stnc640 was enhanced approximately 1.5-fold compared with the WT. The virulence of complemented strain 50336△stnc640/pstnc640 has attenuated compared with the WT strain and the 50336△stnc640 mutant. Tests of isolation and identification of bacteria showed that all three strains of S. Enteritidis were widely distributed in the liver, spleen, and caecum of the infected chickens.

Discussion

sRNAs are a ubiquitous class of molecules that can regulate gene expression at the post-transcriptional level. Most sRNAs can interact with their target mRNAs by base-pairing actions and then modulate translation, degradation, or stability of mRNA [4]. In this study, an sRNA gene stnc640 of S. Enteritidis strain 50336 was cloned and showed 97% identity with stnc640 of S. Typhimurium. This indicated that stnc640 has very high homology within the genus. Identification of the STnc640 target gene is important for the study of sRNA function. To date, the target genes and the function of STnc640 remain unknown. We thus identified likely candidate mRNA targets of STnc640 (fimA and bcfA) by bioinformatics predication technology using TargetRNA2.

The growth rates of the WT strain, 50336△stnc640, and 50336△stnc640/pstnc640 were determined by measuring OD600. The growth rate of 50336△stnc640 was lower than those of the WT strain and 50336△stnc640/pstnc640 in the log phase. Many sRNAs can directly sense multiple environmental signals such as fluctuations in temperature, pH, and metabolites [3, 21]. The deletion of STnc640 apparently weakened environmental adaptation, leading to the decline in growth rate at the log phase, but the final concentration of bacteria was not affected.

The STnc640 candidate targets fimA and bcfA were verified by detecting their mRNA levels by RT-qPCR. The expression of fimA was down-regulated in 50336△stnc640 compared to the WT strain. This suggested that that STnc640 could regulate fimA expression. In other words, fimA was a likely target of STnc640. However, the regulation mechanism needs further study. FimA is a major fimbrial subunit in Salmonella enterica. The Type I fimbriae can alter virulence of S. Typhimurium toward mice [18]. Type I fimbriae are also involved in clearance of S. Enteritidis from the blood and in egg contamination by S. Enteritidis in laying hens [15]. Deletion of STnc640 led to a decrease of fimA expression, but the ability of adhesion to Caco-2 cells of the STnc640 mutant was stronger than that of the wild type strain. This indicated that there is no direct relationship between fimA expression and adhesion ability. Rajashekara found that deletion of the fimA gene in S. Enteritidis did not affect the ability to invade Caco-2 cells and colonize the chicken caecum [22], which is consistent with our result. Multiple fimbrial adhesins are required for Salmonella colonization of the chicken intestine tract. We supposed that up-regulation of other adhesion-related genes expression, but not down-regulation of the fimA gene, caused the adhesion ability enhancement in the STnc640 deletion mutant. Adhesion to and colonization of host cells are important factors for virulence. In our study, the STnc640 deletion in S. Enteritidis strengthened the ability to adhere to Caco-2 cells and thus increased the virulence in chickens. We inferred that STnc640 could inhibit S. Enteritidis virulence by affecting adhesion. For further confirm of whether STnc640 could inhibit virulence, overexpression of STnc640 in the wild type strain and comparison that with wild type need to be performed in the future.

Conclusions

Small non-coding RNA STnc640 could regulate the expression of fimA fimbrial gene in S. Enteritidis. The deletion of STnc640 in S. Enteritidis strengthened the ability to adhere to and colonize in Caco-2 cells and thus increased the virulence in chickens. It was supposed that STnc640 could inhibit S. Enteritidis virulence by affecting adhesion.

Methods

Bacterial strains, plasmids and cell culture conditions

The bacteria strains and plasmids used in this study are listed in Table 1. Salmonella Enteritidis wild type (WT) strain 50336, the mutants 50336△stnc640 and 50336△hfq, complemented mutants 50336△stnc640/pstnc640 and 50336△hfq/phfq, and E.coli DH5α were grown in Luria-Bertani broth (LB) or on LB agar plates at 37 °C. Strains containing temperature-sensitive plasmids such as pCP20 or pKD46 were grown at 30 °C. Strains harboring antibiotic resistance were cultured in LB containing 100 μg/ml of Ampicillin (Amp) or 34 μg/ml of chloramphenicol (Cm) when appropriate. To determine growth rates, the strains were grown at 37 °C with agitation (180 rpm) in LB broth, and the optical density at 600 nm (OD600) was measured every hour. Human colorectal adenocarcinoma epithelial cells (Caco-2) were cultured as described previously [23].

Table 1

Bacterial strains and plasmids used in this study

Strains/plasmids	Characteristics	References
Strains
CMCC(B)50336	Salmonella enterica serovar Enteritidis wild-type	NICPBP, China
50336△stnc640	stnc640 deficient mutant	This study
50336△ stnc640/pstnc640	50336△stnc640 carrying pBR-stnc640 (Ampr)	This study
50336△hfq	hfq deficient mutant	[23]
50336△hfq/phfq	50336△hfq carrying pBR-hfq (Ampr)	[23]
Plasmids
pKD3	Cmr; Cm cassette teplate	[24]
pKD46	Ampr, λRed recombinase expression	[24]
pCP20	Ampr, Cmr; Flp recombinase expression	[24]
pBR-stnc640	pBR322 carrying the full stnc640 gene (Ampr)	This study
pGEM-T Easy	cloning vector, Ampr	Takara
pMD19 T-simple	cloning vector, Ampr	Takara

Stability detection of STnc640 in hfq mutants

S. Enteritidis WT strain 50336, the mutant 50336△hfq, and the complemented mutant 50336△hfq/phfq were grown to an OD600 of 2.5 and collected by centrifugation. Total RNA was extracted and reverse transcribed to cDNA. The mRNA transcripts of stnc640 in WT 50336, 50336△hfq, and 50336△hfq/phfq were detected by real-time quantitative PCR (RT-qPCR) using primers stnc640-F and stnc640-R.

Prediction of candidate mRNA targets of STnc640

Candidate mRNA targets of STnc640 were predicted using TargetRNA2 [20] (http://old-tempest.wellesley.edu/~btjaden/TargetRNA2/index.html.oldtempest). Using this website, we selected the Salmonella Enteritidis strain P125109 genome, input the STnc640 sequence, and then specified 90 nucleotides upstream and 30 nucleotides downstream of the translation start sites of candidate targets. Candidate targets were identified by specifying at least nine consecutive hybridization seeds corresponding to an initial interaction between the sRNA and mRNA with a p-value below 0.01.

Construction of the stnc640 deletion mutant and the complemented strain

The primers used are listed in Table 2. The stnc640 gene was cloned using PCR primers that flank the stnc640 gene in Salmonella Typhimurium. The construction of stnc640-negative mutants of S. Enteritidis 50336 was generated by the phage λ-Red-mediated recombination system as described previously [24, 25]. Primers P3 and P4 were used to amplify chloramphenicol resistance-encoding genes to construct the first recombinant strain 50336△stnc640::cat. The stnc640 complete deletion mutant 50336△stnc640 was confirmed by PCR using primers (P1, P2) and sequencing the PCR product that contained the primers P3 and P4 sequences and lacked of stnc640 sequences using fluorescence-based chain-termination method with a DNA sequencer ABI 3730XL. The complemented strain was generated by cloning the full-length stnc640 gene into plasmid pBR322, which was transferred to the stnc640 mutant. The mutant 50336△hfq and complemented mutant 50336△hfq/phfq were described previously [23].

Table 2

Primers for the PCR and the size of PCR products

Primer	Sequence (5′-3′)	Size (bp)
P1	TGGAAATGGCGGAACATCT	809/416
P2	TAAAGTCAACCCAGGCTCC
P3	GAAATGTAGTGAGTTTGGTGACGCGATTATCGCAAATATGTAATAACGATGTGTAGGCTGGAGCTGCTTCG	1114
P4	AACCTTTATACTTCCACTATGGCAGATAGGTTTGAGCATATGTCTCCTGACATATGAATATCCTCCTTAG
P5	CCCAAGCTTCGATTATCGCAAATATGCGA	1591
P6	GCGTCGACTCAGCAGTCTCTATTAAAGCA
bcfA-F	TGACGCTGCCTGTTCTGTTT	136
bcfA-R	GCAGTCTTCCAGTTTGATGGTG
fimA-F	GACTGCGATCCGAAAGTGG	91
fimA-R	CAGAGGAGACAGCCAGCAAA
gyrA-F	GCATGACTTCGTCAGAACCA	278
gyrA-R	GGTCTATCAGTTGCCGGAAG

RNA extraction and real-time quantitative PCR

Bacteria were grown to an OD600 of 2.5 in LB medium and collected by centrifugation. Total RNA was extracted using TRIzol reagent (Invitrogen, NY, USA). cDNA was synthesized using the PrimeScript RRT reagent kit with gDNA Eraser (Takara Bio, Shiga, Japan). Transcript abundance was quantified using RT-qPCR with SYBR Premix Ex Taq II (Takara) and the primers listed in Table 2 using an ABI7500 instrument (Applied Biosystems, USA). Assays were performed in triplicate, and all data were normalized to the endogenous reference gene gyrA using the. 2-△△CT method [26].

Bacterial adherence and invasion assays

Bacterial adherence and invasion assays were performed as described previously [27]. Bacteria were incubated with a monolayer of 1 × 105 Caco-2 cells at a multiplicity of infection (MOI) of 100 at 37 °C in 96-well tissue culture plates (Corning) for 2 h. Infections were carried out in triplicate. Infected cell monolayers were gently washed three times with PBS to remove loosely adherent bacteria. Cells were lysed with 0.5% Triton X-100 for 30 min. The lysates were serially diluted and plated onto LB agar plates for the enumeration of adherent and invaded bacteria.

Animal infections

One-day-old chickens (National Chickens Genetic Resources, Yangzhou, China) were randomly divided into one control group and three infection groups (n = 20, 10 females and 10 males). Salmonella Enteritidis strains 50336, 50336△stnc640 and 50336△stnc640 /pstnc640 were grown to early stationary phase with an OD600 of 2.5 in LB medium, harvested by centrifugation, washed, and resuspended to 5 × 107 CFU/mL, 5 × 108 CFU/mL and 5 × 109 CFU/mL gradient suspensions in sterile PBS prior to inoculation into infection group chickens. Three infection groups were separately inoculated with 200 μL 5 × 107 CFU/mL, 5 × 108 CFU/mL or 5 × 109 CFU/mL bacterial suspensions, while the control group received 200 μL PBS by subcutaneous injection. Signs of chickens illness and death were monitored daily. The 50% lethal dose (LD50) was calculated 14 days post-infection using the method described previously [23]. Briefly, the numbers of dead and surviving chickens were recorded daily. The summation of cumulative dead and surviving chickens of each dose was taken. The LD50 was calculated using the data on percent mortality using the arithmetical method of Reed and Muench [28]. All live chickens were euthanized by pentobarbital after the assays. All procedures complied with institutional animal care guidelines and were approved by the Animal Care and Ethics Committee of the Yangzhou University (Approval ID: YZUDWSY2017–0026).

Statistical analysis

Data were analyzed using Student’s t test for independent samples. Differences were considered significant if P ≤ 0.05.