Alleviation of Inflammatory Response of Pulmonary Fibrosis in Acute Respiratory Distress Syndrome by Puerarin via Transforming Growth Factor (TGF-β1).

BACKGROUND Acute respiratory distress syndrome (ARDS) in infants is acute and progressive hypoxic respiratory failure caused by various extrapulmonary pathogenic factors besides cardiogenic factors. Diffuse alveolar injury and progression to pulmonary fibrosis are pathological features of ARDS. The present study sought to determine how puerarin influences the inflammatory response caused by pulmonary fibrosis in ARDS in infants. MATERIAL AND METHODS The human lung fibroblasts cell line HLF1 was treated with different concentrations of puerarin in different groups for various times. TGF-ß1 was overexpressed by TGF-ß1 (2 ng/mL) in routine experiments, and the treated cells and culture supernatant were collected for analysis in each step. Cell apoptosis was measured by flow cytometry, TUNEL assay, and detection of caspase 3 and Bcl-2. Cell proliferation was assessed by CCK-8 assay. Real-time PCR and Western blot assay were used to assess mRNA and protein levels of TGF-ß1 and Smad3, respectively. The related cytokines were assessed by ELISA. RESULTS Results showed that puerarin promoted the apoptosis and inhibited the proliferation of HLF1 cells. Caspase 3 was upregulated, whereas Bcl-2, TGF-ß1, and Smad3 were downregulated by puerarin. IL-1, IL-2, and IL-4, secreted by HLF1 cells, were reduced, but IL-10 showed the opposite trend. When TGF-ß1 was overexpressed, Smad3 was promoted, and IL-1, IL-2, and IL-4 was increased in HLF1 cells. Finally, overexpression of TGF-ß1 reversed the effect of puerarin in HLF1 cells. CONCLUSIONS Puerarin regulated the proliferation and apoptosis of pulmonary fibrosis cells, and affected the secretion of inflammatory cytokines. Thus, puerarin alleviated the inflammatory response resulting from pulmonary fibrosis by regulating the TGF-ß1/Smad3 pathway in infants with ARDS.

Background

Acute respiratory distress syndrome (ARDS) is acute respiratory failure caused by decreased lung compliance. It is difficult to treat in clinical practice and has high mortality rates in adults, children, and infants [1]. Diffuse alveolar injury is the pathological feature of ARDS [2]. The clinical manifestations are progressive hypoxemia and respiratory distress. The alveolar capillary barrier is severely damaged, subsequently leading to high permeability interstitial edema and alveolar edema, and a transparent membrane is formed on the alveolar surface, which can develop into pulmonary fibrosis [3], so inhibition of pulmonary fibrosis is also the direction of ARDS treatment. Because of the high incidence of ARDS and in-hospital mortality in infants, improving the accuracy of diagnosis and seeking ideal biomarkers has been the focus of recent research.

Puerarin is an isoflavone compound extracted from Pueraria lobata, a leguminous plant. It has been noted that puerarin has anti-inflammatory, anti-oxidation, anti-osteoporosis, hypoglycemic, and anti-cancer activities [4-6]. Puerarin inhibits cancer cells by regulating inflammation-related proteins and signaling pathways. Its anti-inflammatory effect is one of the reasons why puerarin plays an anti-cancer role [7]. Puerarin reverses the drug resistance of breast cancer cells through inhibition of the activity of NF-κB and the degradation of IκB, blocking NF-κB signaling pathway activation, and ultimately inhibiting breast cancer MCF-7 growth [8]. Fibrosis in ARDS involves continuous alveolar injury and repeated destruction and repair of extracellular matrix cells caused by pulmonary inflammation. A study showed that Radix puerariae extracts ameliorate paraquat-induced pulmonary fibrosis by attenuating follistatin-like 1 and nuclear factor erythroid 2p45-related factor-2 signaling pathways [9]. However, the effect of puerarin on the inflammatory response to pulmonary fibrosis is not clear in ARDS in infants.

Pulmonary fibrosis, which is difficult to control, accounts for 40–70% of all ARDS-related deaths [10]. Cytokines play a critical role in the occurrence and development of fibrosis, especially transforming growth factor (TGF-β1), which regulates collagen expression and other related genes through intracellular signal molecule protein transduction. A study showed that TGF-β participates in the inhibitory effect of Paeoniflorin on pulmonary fibrosis by regulating the Smad signaling pathway [11]. In addition, inhibiting the expression of TGF-β1 also regulates the epithelial mesenchymal transition (EMT) pathway, and subsequently inhibits the progression of pulmonary fibrosis [12]. The present study explored the mechanism of puerarin in alleviating the progression of pulmonary fibrosis in ARDS by studying the relationship between TGF-β1 and inflammatory response.

Material and Methods

Cell culture and processing

The human lung fibroblasts cell line HLF1 was obtained from the Cell Resource Center, Shanghai Science Research Center, Chinese Academy of Sciences (Shanghai, China) and cells were regularly cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco, NY, USA) supplemented with 10% fetal bovine serum (FBS, Gibco, NY, USA) and 100 units/ml penicillin/streptomycin (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany). The cells were incubated at 37°C in 5% CO2. Cells were then subcultured until subconfluence. DMEM medium was used to dissolve puerarin (Shanghai Leiyunshang Pharmaceutical Co., Shanghai, China) into 0 μg/ml, 200 μg/ml, 400 μg/ml, and 600 μg/ml for the treatment of HLF1 cells. The recombinant human TGF-β1 (R&D Systems, Minneapolis, USA, 2 ng/ml) was used to increase the level of TGF-β1 in HLF1 cells.

Flow cytometry assay and TUNEL analysis

Treated HLF1 cells were gathered and washed 3 times with pre-cold phosphate-buffered saline solution (PBS) to wipe off floating cells before detection using the Annexin V-APC Apoptosis Detection Kit (Beyotime Biotechnology, Nanjing, China). Apoptosis was assessed with a flow cytometer (BD Biosciences, NJ, USA). Cell apoptosis was assessed by use of a terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate in situ nick-end labeling (TUNEL) detection kit (Roche, Shanghai, China) following the manufacturer’s instructions. Treated HLF1 cells were then counterstained with DAPI and observed under a fluorescence microscope.

Cell proliferation assay

The effect of different treatments on HLF1 cell proliferation was detected by DNA incorporation of the thymidine analog 5-bromo-2′-deoxyuridine (BrdU), as previously described [13]. HLF1 cells were incubated with BrdU (20 μL of 1: 500 dilution) for 4 h, followed by immunostaining with an antibody directed against BrdU using a BrdU Cell Proliferation Assay kit (Millipore, MA, USA). The incorporation of BrdU into newly synthesized DNA of proliferating cells was measured by the magnitude of absorbance (optical density, OD) at 450 nm.

RNA extraction and real-time PCR

Total RNA was extracted from HLF1 cells in different groups by TRIZOL reagent (Invitrogen, USA) following the manufacturer’s instructions. Then, real-time PCR was performed using SYBR Green PCR mix (Takara, Shiga, Japan) on an ABI Prism 7500 device (Applied Biosystems, CA, USA). The expression of mRNA was calculated from the relevant signals by normalization with the signal of GAPDH expression. All primers and sequences are shown in Table 1.

Table 1

Primers sequences used for PCR.

Gene	Sense primer (5′→3′)	Antisense primer (5′→3′)
TGF-β1	CCAAGCTTATGCCGCCCTCCGGGC	GCGTCGACCAGCTGCACTTGCAGGAG
Smad3	AAACCAGGCTGGCTAAACAAGTG	ATGGTGGTGAAGACGCCAGT
GAPDH	CGGAGTCAACGGATTTGGTCGTAT	AGCCTTCTCCATGGTGGTGAAGAC

Western blot assay

The HLF1 cells were washed twice with pre-cold PBS for 5 min and lysed with 150 μL/well radio immunoprecipitation assay (RIPA, Beyotime Biotechnology, Shanghai, China) on ice to collect the protein. The Bradford Easy Protein Quantitative Kit (TransGene) was used to detect protein concentrations. Depending on the protein, samples were separated by 5%, 10%, or 12% SDS-PAGE and then transferred onto polyvinylidene fluoride membranes (Millipore, Bedford, MA). Next, the transferred blots were incubated with antibody: TGF-β1 (sc-130348, Santa Cruz, CA), Smad1/2/3 (sc-7960, Santa Cruz, CA), pro-Caspase 3 (sc-271759, Santa Cruz, CA), Bcl-2 (sc-509, Santa Cruz, CA), and β-actin (Beyotime Biotechnology, Shanghai, China) at 4°C overnight. Subsequently, the membranes were incubated with secondary antibody (Beyotime Biotechnology, Shanghai, China). Proteins were visualized on X-ray film using Kodak film developer (Fujifilm, Japan) with the BeyoECL Plus kit (Beyotime Biotechnology, Shanghai, China).

Cytokine analysis

The changes in IL-1, IL-2, IL-4, and IL-10 levels caused by puerarin treatment were assessed in the culture medium of HLF1 cells. ELISA (R&D Systems, USA) or MILLIPLEX MAP Human Cytokine/Chemokine Magnetic Bead multiplex assay (Millipore, MA, USA) was used to detected cytokines, according to manufacturer’s instructions.

Statistical analysis

Data are presented as means± standard deviation (SD). Each assay was independently performed 3 times. A one-way ANOVA followed by the Student-Newman-Keuls test was performed to compare the differences. One-way ANOVA followed by a post hoc test was used for the analysis of multiple group comparisons of data. P<0.05 was regarded as statistically significant. SPSS 17.0 software (SPSS, Inc., Chicago, IL, USA) was used for statistical analyses.

Results

Puerarin promoted apoptosis of lung fibroblast HLF1 cells

After treatment with different concentrations of puerarin, apoptosis of HLF1 cells in different groups was assessed by flow cytometry and TUNEL assay. Flow cytometry showed apoptosis rates of HLF1 at 0 μg/ml, 200 μg/ml, 400 μg/ml, and 600 μg/ml concentrations of puerarin were 8.3%, 23.5%, 45.3%, and 51.2%, respectively (Figure 1A, 1B). Apoptosis in the 200 μg/ml and 400 μg/ml groups was markedly higher than that of the 0 μg/ml group (P<0.05), but cell apoptosis in the 400 μg/ml and 600 μg/ml groups showed no significant difference. TUNEL assay also demonstrated that HLF1 cells cultured with puerarin at 200 μg/ml and 400 μg/ml had increased apoptosis rates compared to the 0 μg/ml group (Figure 1C). Western blot assay demonstrated that with the increase of puerarin concentration, the pre-Caspase 3 and Bcl-2 expression decreased gradually (Figure 1D).

Figure 1

Puerarin promotes apoptosis of HLF1 human embryonic lung fibroblasts. (A, B) Flow cytometry showed apoptosis rates were increased in HLF1 lung fibroblasts. (** P<0.01 vs. 0 μg/ml group; ## P<0.01 vs. 400 μg/ml group). (C) TUNEL assay confirmed the apoptosis rates of HLF1 cells after treatment with different concentrations of puerarin. (D) Caspase 3 and Bcl-2 expression was also changed by different concentrations of puerarin in HLF1 cells. Data are presented as means ±SD.

Puerarin inhibited the proliferation of HLF1 and expression of TGF-β1

CCK-8 assay was used to reveal the effect of puerarin treatment on proliferation of HLF1 cells. The results revealed significant differences in proliferation of HLF1 cells in groups treated with different concentrations of puerarin (P<0.05, Figure 2C). When the concentration of puerarin reached 400 μg/ml, it showed the strongest inhibitory effect among all 4 groups. In addition, HLF1 cells exposed to puerarin also had lower levels of TGF-β1 and Smad3 at both mRNA (Figure 2A, 2B) and protein levels (Figure 2D).

Figure 2

The proliferation of HLF1 lung fibroblasts was suppressed by puerarin. (A, B) The mRNA of TGF-β1 and Smad3 was downregulated by puerarin. (C) The BrdU assay demonstrated that proliferation of HLF1 was inhibited. (D) The protein level of TGF-β1 and Smad3 was decreased by puerarin. (* P<0.05 vs. 0 μg/ml group; # P<0.05/## P<0.01 vs. 400 μg/ml groups). Data are presented as means ±SD.

Puerarin regulated levels of IL-1, IL-2, IL-4, and IL-10 secreted by pulmonary fibrosis cells

Pulmonary fibrosis in ARDS is closely related to cell apoptosis, proliferation, and interleukin secretion. We found lower levels of IL-1, IL-2, and IL-4 after the culture supernatant of HLF1 cells with increasing concentration of puerarin, and significant differences were observed in the 0 μg/ml, 200 μg/ml, and 400 μg/ml groups (P<0.05) (Figure 3A–3C). However, IL-10 was increased with increased concentrations of puerarin (P<0.05) (Figure 3D).

Figure 3

Puerarin treatment changed the levels of IL-1, IL-2, IL-4, and IL-10 secreted by HLF1 cells. (A) IL-1 levels were decreased by puerarin treatment. (B) Downregulation of IL-2 was due to puerarin. (C) IL-4 was decreased by puerarin treatment. (D) Upregulation of IL-10 by M. pneumoniae treatment. Data are presented as means ±SD. (A–D * P<0.05/** P<0.01 vs. 0 μg/ml group; # P<0.05/## P<0.01 vs. 400 μg/ml group).

Upregulation of TGF-β1 altered the secretion of IL-1, IL-2, IL-4, and IL-10

A study demonstrated that TGF-β1 is involved in cellular inflammatory response, and pulmonary fibrosis is also closely associated with secretion of inflammatory factors [14]. Hence, the levels of IL-1, IL-2, IL-4, and IL-10 in the culture supernatant secreted by HLF1 was detected by ELISA with the upregulation of TGF-β1 through recombinant human TGF-β1 (Figure 4A). The results showed significant increases in IL-1, IL-2, and IL-4 compared with the control group and upregulation group (P<0.05, Figure 4C–4E). However, the level of IL-10 was decreased by exposure to TGF-β1 (P<0.05, Figure 4F).

Figure 4

Changes in levels of IL-1, IL-2, IL-4, and IL-10 secreted by HLF1 cells in the presence of recombinant TGF-β1. (A) Expression of the TGF-β1 gene increased. (B) Western blot assay showed the changes in TGF-β1 and Smad3. (C) IL-1 levels were increased by TGF-β1. (D) Upregulation of IL-2 was caused by TGF-β1. (E) IL-4 was increased by TGF-β1. (F) Downregulation of IL-10 by TGF-β1. Data are presented as means ±SD. (* P<0.05/** P<0.01 vs. Control group).

Puerarin regulates the state of HLF1 cells by regulating the expression of TGF-β1

In this study, we used recombinant human TGF-β1 to increase the protein expression of TGF-β1 in HLF1 and explored the mechanisms underlying the effect of puerarin on ARDS. When we increased the level of TGF-β1 in HLF1 cells, the decreased cell proliferation caused by puerarin was reversed (Figure 5A), and the increase of cell apoptosis induced by puerarin was also inhibited, as shown by TUNEL assay (Figure 5B). In addition, the protein levels of Smad, pro-Caspase 3, and Bcl-2 affected by puerarin also returned to previous levels due to the upregulation of TGF-β1 (Figure 5C, 5D). Importantly, the puerarin-induced changes associated with inflammation involving IL-1, IL-2, IL-4, and IL-10 were reversed by increased levels of TGF-β1 (Figure 5E).

Figure 5

Overexpression of TGF-β1 alleviated the apoptotic and proliferative changes caused by puerarin. (A) TUNEL assay showed that overexpression of TGF-β1 reduced cell apoptosis induced by puerarin. (B) Cell proliferation was affected by overexpression of TGF-β1 and puerarin. (* P<0.05 vs. puerarin (0 μg/ml)+TGF-β1 (2 ng/ml), # P<0.05 vs. puerarin (400 μg/ml)+TGF-β1 (2 ng/ml)) (C, D) The levels of IL-4 and IL-10 were reversed by overexpression of TGF-β1. (* P<0.05 vs. puerarin (0 μg/ml)+TGF-β1 (2 ng/ml), ## P<0.05 vs. puerarin (400 μg/ml)+TGF-β1 (2 ng/ml)) (E) TGF-β1, Smad3, Caspase 3, and Bcl-2 levels following treatment with TGF-β1 and puerarin. Data are presented as means ±SD.

Discussion

ARDS is a critical neonatal disease caused by acute progressive hypoxic respiratory failure due to various internal and external pathogenic factors, in addition to cardiogenic factors. The mechanism is generally viewed as inflammation response and anti-inflammatory response induced by a variety of risk factors. When the reaction is out of control, it can cause injury, including diffuse alveolar capillary membrane inflammation injury, pulmonary microthrombosis, atelectasis, pulmonary hypertension, and pulmonary fibrosis [15]. Moreover, the thorax of neonates undergoing cesarean section is not compressed, and more fluid in the lungs is a high risk factor for direct neonatal swelling and injury [16,17]. Ventricular hypoxia directly damages alveolar epithelial cells, reduces the activity of pulmonary surfactant, and reduce its release. The pulmonary fibrosis and inflammatory response are the causes of direct lung injury, which are common high-risk factors for ARDS [18]. Therefore, alleviating the occurrence of pulmonary fibrosis is also important in the treatment of neonatal ARDS.

Puerarin is a monomer compound extracted and isolated from dried Pueraria lobata, which shows certain anti-inflammatory and anti-oxidative properties [19]. A study showed that puerarin exhibits anti-cancer effects in human chondrosarcoma cells by inhibiting the PI3K/Akt signaling pathway [20]. Another study confirmed that the expression of the pro-inflammatory cytokines TNF-α, IL-1β, and IL-6 and LPS-stimulated NF-κB activation were inhibited by puerarin and finally contribute to inhibition of the LPS-induced inflammatory response [21]. On the premise that puerarin has the above functions, and to explore the biological effects of puerarin, we explored the mechanism of puerarin. TGF-β 1 can promote excessive proliferation and differentiation of lung fibroblasts, and then promote the excessive accumulation of extracellular matrix such as collagen in the pulmonary interstitial and alveolar cells, leading to the occurrence and development of pulmonary fibrosis [22,23]. Studies have shown that its fibrosis is not only related to the downstream Smad protein family signaling pathway, but also is closely related to the mitogen-activated protein kinase (MAPK) family ERK1/2 signaling pathway, which together regulate the transcription of the corresponding target molecule [24]. We speculate that puerarin inhibits pulmonary fibrosis in neonates and alleviates ARDS, and its possible mechanism is by regulating TGF-β1 and then affecting its downstream pathway.

Pulmonary inflammation causes pulmonary fibrosis, and pulmonary fibrosis is a notable manifestation of ARDS. The secretion of pro-inflammatory factors IL-1, IL-2, and 1L-4 and the anti-inflammatory factor IL-10 is clearly involved in regulating human immune responses. A study showed that IL-8 had the highest combined sensitivity and specificity for the diagnosis and outcome prediction of ARDS [25]. When the injury factor acts on alveolar macrophages, macrophage activation secretes a large number of cytokines, including IL-1 and IL-2, directly stimulating the lung tissue to cause damage, and also interacts with lung fibroblasts to form a molecular cell network. It plays a major role in the occurrence and evolution of pulmonary fibrosis [26]. In this study, we found that puerarin significantly reduced the secretion of IL-1, IL-2, and IL-4 and increased the secretion of IL-10, which is enhanced with the increase of puerarin concentration. However, when TGF-β1 is present, the effect of puerarin is reversed. This also confirmed that puerarin affects TGF-β1 in relieving the inflammatory response to pulmonary fibrogenesis in ARDS.

The present study investigated the effect of puerarin on apoptosis and proliferation of HLF1 lung fibroblasts. Our results confirmed that puerarin promotes the apoptosis of HLF1 cells and also inhibit their proliferation, and the expression of TGF-β1 and Smad proteins is further decreased. When recombinant TGF-β1 was used to increase its expression, we found that the secretion of IL-1, IL-2, IL-4, and IL-10 by HLF1 cells was the opposite of cells treated with puerarin alone. In the recovery experiments, we found that cell proliferation, apoptosis, and some inflammatory factors induced by puerarin can be reversed or alleviated by TGF-β1. Here, we studied the signaling pathways or related proteins, and we believe that this mechanism will be a very complex and systematic regulatory process. In this paper, the effect of puerarin was only verified at the cellular level, and there we did not perform any in vivo experiments. Further research using animal experimental models are warranted to further assess the effect of puerarin on ARDS.

Conclusions

The present results indicate that TGF-β1 is a central mediator of puerarin-induced changes in inflammatory response in infants with ARDS, and provide a new treatment direction for curing ARDS in infants.