Intestinal delta-6-desaturase activity determines host range for Toxoplasma sexual reproduction.

Many eukaryotic microbes have complex life cycles that include both sexual and asexual phases with strict species specificity. Whereas the asexual cycle of the protistan parasite Toxoplasma gondii can occur in any warm-blooded mammal, the sexual cycle is restricted to the feline intestine. The molecular determinants that identify cats as the definitive host for T. gondii are unknown. Here, we defined the mechanism of species specificity for T. gondii sexual development and break the species barrier to allow the sexual cycle to occur in mice. We determined that T. gondii sexual development occurs when cultured feline intestinal epithelial cells are supplemented with linoleic acid. Felines are the only mammals that lack delta-6-desaturase activity in their intestines, which is required for linoleic acid metabolism, resulting in systemic excess of linoleic acid. We found that inhibition of murine delta-6-desaturase and supplementation of their diet with linoleic acid allowed T. gondii sexual development in mice. This mechanism of species specificity is the first defined for a parasite sexual cycle. This work highlights how host diet and metabolism shape coevolution with microbes. The key to unlocking the species boundaries for other eukaryotic microbes may also rely on the lipid composition of their environments as we see increasing evidence for the importance of host lipid metabolism during parasitic lifecycles. Pregnant women are advised against handling cat litter, as maternal infection with T. gondii can be transmitted to the fetus with potentially lethal outcomes. Knowing the molecular components that create a conducive environment for T. gondii sexual reproduction will allow for development of therapeutics that prevent shedding of T. gondii parasites. Finally, given the current reliance on companion animals to study T. gondii sexual development, this work will allow the T. gondii field to use of alternative models in future studies.

Introduction

The apicomplexan parasite Toxoplasma gondii causes a chronic infection in nearly one-third of the human population and is well known for causing congenital infections leading to blindness, mental retardation, and hydrocephaly of the developing fetus. T. gondii has a complex life cycle containing both sexual and asexual phases. The T. gondii asexual cycle can occur in any warm-blooded animal when contaminated food or water is consumed and T. gondii disseminates throughout the host, converting to an encysted form in muscle and brain tissue. In contrast, the T. gondii sexual cycle is restricted to the feline intestinal epithelium, culminating in the excretion of environmentally resistant oocysts [1]. The molecular basis for this species specificity is unknown.

During feline infection, the ingested bradyzoites are released by pepsin and acid digestion in the stomach. Bradyzoites then invade the feline intestinal epithelium and differentiate into five morphologically distinct types of schizonts [2]. Within 2 days in the feline intestine, parasites progress through all five stages of schizonts and then develop into merozoites. The merozoites undergo a limited proliferation of two to four doublings before they differentiate into macrogametes and microgametes. The macro- and microgametes fuse to produce diploid oocysts, which develop thick impermeable walls and are shed in the feces. Cats usually excrete 2–20 million oocysts per day in their feces and usually shed oocysts 5–10 days post infection [3,4]. In ambient air and temperature, oocysts undergo a sporulation process to mature and become infectious. Both mitosis and meiosis occur during sporulation to produce eight haploid sporozoites encased within the oocyst wall. T. gondii oocysts are stable for 18 months in unfavorable environmental conditions and resistant to many chemical disinfectants [5].

Results and discussion

Linoleic acid is critical for sexual development in cultured cat cells

To determine the molecular mechanisms that define the species specificity of T. gondii sexual development, we generated cat intestinal organoids (Fig 1a) and then seeded these epithelial cells onto glass coverslips. These monolayers displayed intestinal epithelial properties, including polarization and tight junction formation (Fig 1b). To simulate natural infection, T. gondii was harvested from mouse brains 28–40 days after primary infection, and the parasites were released from the brain cysts by pepsin and acid digestion. After neutralization with sodium carbonate, parasites were seeded onto the cat intestinal monolayers, incubated for 5 days, and stained for markers of the parasite presexual stage called a merozoite [6,7]. Although we observed occasional dense granule protein 11B (GRA11B) and bradyzoite rhoptry protein-1 (BRP1) staining, the vast majority of the culture was negative for these merozoite markers (Fig 1c), suggesting that a required nutrient was limiting under these culture conditions. Because recent studies showed that the T. gondii asexual stages scavenge fatty acids, particularly oleic acid, from the host [8] and that sexual development of many fungi is dependent on linoleic acid [9], we surmised that supplementation with these fatty acids could facilitate T. gondii sexual development. We added 200 μM oleic or linoleic acid to cat intestinal monolayer culture medium 24 hours prior to infection with T. gondii. After 5 days of infection, we found that the addition of linoleic acid but not oleic acid caused approximately 35% of the T. gondii to express both merozoite stage markers (Figs 1d–1g and 2a, S1 Data). Similarly, GRA11B mRNA was significantly more abundant in cat intestinal cells supplemented with linoleic acid compared to any other condition (Fig 2b, S2 Data). As seen in vivo cat intestine, GRA11B changes localization from within the parasite dense granule organelles in the early stages of development to the parasitophorous vacuole and parasitophorous vacuole membrane in later stages of development [6]. We see similar localization of GRA11B depending on vacuole size, likely representing early, middle, and late stages (Fig 1e–1g). Likewise, BRP1 has a localization similar to that previously seen in the rhoptry organelles in the apical end of the merozoite [7] (Fig 1e–1g).

Fig 1

Linoleic acid enhances progression through the sexual stages.

(a) Cat intestinal organoids were generated from small-intestine sections and were grown in basement membrane matrix. Example of a growing organoid, 100-μm size bar. (b) Intestinal organoids were dissociated using trypsin and single cells seeded onto glass coverslips to grow as monolayers. The cells in the monolayer expressed the tight junction protein ZO-1 (green), 20-μm size bar. Cat intestinal monolayers were incubated with either (c) no fatty acid supplementation, (d) 200 μM oleic acid, or (e, f, g) 200 μM linoleic acid for 24 hours and then infected with ME49 bradyzoites for 5 days. Parasites undergoing presexual development were commonly seen only with linoleic acid supplementation as marked by staining with GRA11B (red) or BRP1 (green). Parasites in (e) early, (f) middle, or (g) late stages of sexual development were noted by differential localization of GRA11B. All panels are 20 μm2 with a 5-μm white size bar in the lower right corner. BRP1, bradyzoite rhoptry protein-1; DIC, differential interference contrast; GRA11B, dense granule protein 11B; ZO-1, zona occludens 1.

Fig 2

Quantification of merozoites in cat tissue culture.

(a) Cat intestinal organoids were disassociated by trypsin and then grown as monolayers on glass slides. Slides were divided into three different groups: not supplemented with FA, supplemented with 200 μM OA, or supplemented with 200 μM LA. Monolayers were infected with T. gondii ME49 bradyzoites purified from brains of chronic infected mice at a 1:10 MOI. Five days after infection, staining for GRA11B and BRP1 along with DAPI allowed the percentage of vacuoles positive for GRA11B and BRP1 out of the total vacuoles to be determined. Total number of parasitophorous vacuoles were counted by positive DAPI staining and confirmed by morphology with DIC. Three biological replicates were counted, and on average, 35% of the total vacuoles were positive for both GRA11B and BRP1 in the LA-supplemented monolayers. *p-value = 0.0126 with N = 3 by two-tailed unpaired t test. Straining for both BRP1 and GRA11B was used to ensure that merozoite stages were counted. RNAseq and immunofluorescent imaging of the cat intestinal epithelium show that GRA11B is exclusively expressed in merozoites [6]. BRP1 is a rhoptry protein that was initially found in bradyzoites; however, it is also expressed in merozoites [7]. (b) Cat intestinal monolayers were grown as described in (a), except monolayers were quenched by TRIzol 5 days post infection, RNA was extracted, and cDNA was synthesized using an oligo (dT) primer to amplify mRNA. Expression of SAG1 and GRA11B were quantified by qPCR and the fold change calculated in comparison with uninfected cells. TUB1A was used to normalize gene expression across samples. GRA11B expression was significantly more abundant in the LA-supplemented monolayers with two biological replicates. *p-value = 0.0155 with N = 2 by two-tailed unpaired t test. BRP1, bradyzoite rhoptry protein-1; DIC, differential interference contrast; FA, fatty acid; GRA11B, dense granule protein 11B; LA, linoleic acid; MOI, multiplicity of infection; OA, oleic acid; qPCR, quantitative PCR; RNAseq, RNA sequencing; TUB1A, tubulin 1A; SAG1, surface antigen 1.

Within the feline intestine, merozoites are known to differentiate into micro- and macrogametes that fuse to become diploid oocysts. After 7 days of infection, we saw round structures with reactivity to the macrogamete protein amine oxidase, copper-containing protein 2 (AO2) [10] in cat intestinal monolayers cultured with 200 μM linoleic acid but not in unsupplemented or oleic acid–supplemented cultures (Fig 3a–3c). PCR of these day 7 linoleic acid–supplemented cultures amplified message for AO2 as well as the predicted microgamete flagellar dynein motor protein TGME49_306338 with 44% identity to the homologue from the motile green alga Chlamydomonas reinhardtii (Fig 3d). In parallel, we assessed for the presence of intracellular oocyst wall biogenesis in these linoleic acid–supplemented cat cells by using the 3G4 antibody [11] that recognizes the T. gondii oocyst wall. There were approximately nine oocyst walls per cm2 of cultured cat cells supplemented with 200 μM linoleic acid but none in not-supplemented or oleic acid–supplemented cultures (Fig 3e–3h, S3 Data). Addition of 20 μM linoleic acid did not enhance oocyst wall production, indicating that the concentration of linoleic acid was critical for proper development.

Fig 3

Identification of gametes and intracellular oocysts in cat tissue culture.

Cat intestinal organoids were disassociated by trypsin and then grown as monolayers on glass slides. Monolayers were grown to confluency and then were incubated with either no fatty acid supplementation (a and e), 200 μM oleic acid (b and f), or 200 μM linoleic acid (c and g) for 24 hours and infected with ME49 bradyzoites purified from brains of chronic infected mice. After 7 days, monolayers were incubated with mouse anti-AO2 (a–c) or mouse monoclonal IgM 3G4 (e–g). The amiloride-sensitive AO2 is an enzyme exclusively expressed in macrogametes and early oocysts and has a possible role in oocyst wall biogenesis [10]. AO2 expression was only detected by immunofluorescence in the monolayers supplemented with linoleic acid (c). 3G4 is a mouse monoclonal antibody produced by immunizing mice with purified oocyst walls [11]; thus, it is a marker of oocyst wall biogenesis. Only monolayers supplemented with linoleic acid (g) had positive 3G4 vacuoles. All panels are 20 μm2 with a 5-μm white size bar in the lower right corner. (d) Markers for macrogamete and microgamete expression were also evaluated by PCR. Cat intestinal monolayers were grown in 24-well plates until confluency and then infected with T. gondii bradyzoites in duplicate using the same conditions as above. Seven days post infection, RNA was extracted with TRIzol, and cDNA was synthesized using an oligo (dT) primer to only amplify mRNA. AO2 was again used as a marker for macrogametes, and the expected PCR product is 218 bp. To assess microgamete presence, we selected the gene TgME49_306338, which is overexpressed in the gametes stage, corresponded to day 7 post infection in cats [12], and has 44% identity to a protein expressed in the flagella of the motile green algae C. reinhardtii. The expected PCR product for TgME49_306338 is 160 bp. TUB1A was used as an input control and results in a 172-bp product. “No RT” corresponds to a cDNA synthesis reaction without the addition of RT as a control for genomic DNA contamination. Equivalent amounts of cDNA per sample were used as a template for each PCR reaction, and the products were separated on an acrylamide gel. Bands with the correct size showing AO2 and TgME49_306338 expression were only observed in linoleic acid–supplemented monolayers. (h) The number of positive oocyst walls stained with 3G4 were quantified. Cat intestinal monolayers were infected with T. gondii bradyzoites and after 7 days, fixed with 3.7% formaldehyde in PBS, and incubated with 3G4 as showed in (e, f, and g). The number of positive oocyst walls were counted in each slide and divided by the area of slide in cm2. The number of positive oocysts walls in monolayers supplemented with linoleic acid was significantly higher than those supplemented with oleic acid in three biological replicates. *p-value = 0.0272 with N = 3 by two-tailed unpaired t test. AO2, amine oxidase, copper-containing protein 2; DIC, differential interference contrast; IgM, immunoglobulin M; RT, reverse transcriptase; TUB1A, tubulin 1A.

Inhibition of delta-6-desaturase causes sexual development in cell culture mouse cells

The dependence of T. gondii sexual development on high levels of linoleic acid was intriguing because cats are the only mammal known to lack delta-6-desaturase activity in their small intestines [13,14]. Delta-6-desaturase is the first and rate-limiting step for the conversion of linoleic acid to arachidonic acid. Linoleic acid is the dominant fatty acid in cat serum, comprising 25%–46% of the total fatty acid [15-18], whereas rodents serum contains only 3%–10% linoleic acid [19-22]. We hypothesized that the lack of delta-6-desaturase activity in the cat small intestine allows for a buildup of linoleic acid from the diet, which then acts as a positive signal for T. gondii sexual development. To test this hypothesis, we infected mouse intestinal monolayers with T. gondii and supplemented them with linoleic acid and the chemical SC-26196, a specific inhibitor of the delta-6-desaturase enzyme, to establish high steady-state levels of linoleic acid [23]. Five days after infection of the mouse culture with T. gondii, we assessed merozoite markers BRP1 [7] and GRA11B [6]. We detected expression of GRA11B and BRP1 in mouse intestinal cells only when supplemented with both linoleic acid and SC-26196 (Fig 4). These data suggest that the delta-6-desaturase enzyme must be inhibited in order for high enough levels of exogenous linoleic acid to increase and induce T. gondii sexual development in nonfeline intestinal cells. Similar to cat cells, mouse intestinal monolayers supplemented with both linoleic acid and SC-26196 had approximately 26% of the T. gondii vacuoles expressing both BRP1 and GRA11B (S1 Fig, S4 Data).

Fig 4

Inhibition of delta-6-desaturase permits sexual development in mouse culture.

Mouse intestinal monolayers were incubated with either (a) no fatty acid supplementation, (b) 200 μM linoleic acid, or (c, d, e) 200 μM linoleic acid plus the delta-6-desaturase inhibitor (“D6D inh.”) SC-26196 for 24 hours and then infected with ME49 bradyzoites for 5 days. Only in cultures supplemented with linoleic acid and SC-26196 were parasites undergoing presexual development detected by staining with GRA11B (red) or BRP1 (green). Parasites in (c) early, (d) middle, or (e) late stages of development were noted by differential localization of GRA11B. All panels are 20 μm2 with a 5-μm white size bar in the lower right corner. BRP1, bradyzoite rhoptry protein-1; DIC, differential interference contrast; GRA11B, dense granule protein 11B.

Inhibition of delta-6-desaturase causes sexual development in live mice

Oocysts excreted in cat feces must undergo a sporulation process to become infectious to the next host. We attempted to sporulate the round structures containing oocyst wall antigen that were derived from either cat or inhibited mouse cultured intestinal cells at room temperature with aerosolization for 7–14 days. Unfortunately, few structures were obtained from the monolayers, they did not appear to sporulate, and they were not infectious to mice. We hypothesized that T. gondii oocyst development and infectivity would require physiological conditions in a whole animal that could not be recapitulated in tissue culture. To test this hypothesis, we inhibited delta-6-desaturase activity in the intestines of live mice. The delta-6-desaturase inhibitor SC-26196 is effective as an anti-inflammatory agent in whole-animal experiments [24]. Because it was previously seen that sporozoites shifted to the rapidly replicating asexual stage called a tachyzoite, within 8 hours after the oral inoculation into rats [25] we fed the mice a linoleic acid–rich diet and pretreated them with the delta-6-desaturase inhibitor SC-26196 (or a no-inhibitor control) 12 hours prior to oral infection with T. gondii and every 12 hours thereafter. In mice fed both the linoleic acid–rich diet and the SC-26196 inhibitor, 7 days after infection, quantitative PCR (qPCR) of ileum cDNA showed high expression of the T. gondii merozoite marker GRA11B and low expression of the asexual tachyzoite surface antigen 1 (SAG1) [26] (Fig 5a, S5 Data). Ileum sections on day 7 post infection were paraffin-embedded and stained with hematoxylin and eosin or reticulin stain. Presexual and early oocysts stages were present only in the tissue of mice fed linoleic acid and the delta-6-desaturase inhibitor (Fig 5b and 5c).

Fig 5

Mice shed oocysts after inhibition of D6D.

Mice were gavage fed LA and the D6D inhibitor (“Inh.”) SC-26196 12 hours prior to infection with ME49 bradyzoites and then every 12 hours for the 7 days of infection. (a) qPCR of cDNA from the ileum for tachyzoite marker SAG1 (black) and GRA11B (red) shows that GRA11B is significantly up-regulated only in the presence of SC-26196 (p-value = 0.0057 with N = 2 by two-tailed unpaired t test). (b) Ileum sections on day 7 post infection were paraffin-embedded and stained with hematoxylin and eosin to visualize presexual stages. (c) Early intracellular oocysts were observed in ileums of D6D inhibited mice impregnated with silver (reticulin stain) and photographed using differential contrast imaging to delineate the oocyst wall in dark brown [27]; 10-μm black size bar in the lower right corner. (d) Fresh oocysts were fixed in 3.7% formaldehyde in suspension, incubated with mouse monoclonal antibody 3G4 overnight, and then incubated with goat anti-mouse Alexa Fluor 488 secondary antibody. Panels are 20 μm2 with a 5-μm white size bar in the lower right corner. D6D, delta-6-desaturase; DIC, differential interference contrast; FA, fatty acid; GRA11B, dense granule protein 11B; LA, linoleic acid; qPCR, quantitative PCR; SAG1, surface antigen 1.

As early as day 6 post infection, oocyst-like structures showing 3G4 antibody-positive staining were present in the mouse feces (Fig 5d) and increased in number until day 7, when the mice were euthanized. qPCR on genomic DNA from mouse fecal samples showed that T. gondii genomic DNA was detectable only in mice treated with SC-26196 (Fig 6a, S6 Data), indicating that delta-6-desaturase must be inactivated in mice for T. gondii sexual stages to develop in the mouse gut. Mice produced 1,000–10,000 oocysts/gram dry feces. To increase the number and duration of oocysts shedding, mice were fed the SC-26196 inhibitor every 12 hours only until day 5 post infection. Oocysts were monitored in the feces, with the peak of shedding being days 8–9 with between 100,000–150,000 oocysts/gram dry feces (Fig 6b, S7 Data), which is within the range seen for cats (2,000–1,500,000 oocysts/gram of feces [3,4]).

Fig 6

Mouse oocysts are infectious.

(a) qPCR on genomic DNA from mouse fecal samples shows that T. gondii genomic DNA is detected only in mice treated with SC-26196 (p-value = 0.0002 with N = 3 by two-tailed unpaired t test). (b) Counts of the number of oocysts/gram of feces over time. ***p-value = 0.0003 day 5 versus 8 and **p-value = 0.0017 day 9 versus 14. (c) After 7 days in sporulation conditions, sporocysts were visible by DIC, and blue autofluorescence of the oocyst walls was enhanced. All panels are 20 μm2 with a 5-μm white size bar in the lower right corner. (d) To expose the sporocyst wall to the 4B6 antibody [11], the sporulated oocysts were dried to the slides, fixed and permeabilized with cold acetone for 30 minutes, incubated with mouse monoclonal antibody 4B6 overnight, and then incubated with goat anti-mouse Alexa Fluor 488 secondary antibody. (e) At 28 days PI with oocysts, T. gondii cysts were purified from the brains of mice and detected by DBA [28] (red). All panels are 20 μm2 with a 5-μm white size bar in the lower right corner. D6D Inh., delta-6-desaturase inhibitor; DBA, Dolichos biflorus agglutinin; DIC, differential interference contrast; FA, fatty acid; LA, linoleic acid; PI, post infection; qPCR, quantitative PCR.

Mouse-derived oocysts sporulate and are infectious

T. gondii oocysts are susceptible to desiccation, making them unable to sporulate [29]. Therefore, the mouse feces or the intestinal contents were immediately placed in saline and sporulated at room temperature with aerosolization. Cat-derived oocysts are usually stable after a 30-minute incubation in undiluted bleach (5% sodium hypochlorite) and long-term incubation in 2% sulfuric acid [5]. Because mouse-derived oocysts were not as resistant to bleach and 2% sulfuric acid as cat-derived oocysts, they were sporulated in saline with antibiotics. After 7 days, sporulation was evident in approximately 50% of the oocysts by visualization of sporozoites, a deep blue autofluorescent wall [30] (Fig 6c), and reactivity with the 4B6 antibody that recognizes the two individual sporocysts within the oocysts [11] (Fig 6d). The sporulated oocysts were infectious to mice, as seen by serum conversion (S2 Fig) and cysts in the brains 28 days later (Fig 6e, S3 Fig). Similar to oocysts derived from a cat, these mouse-derived sporulated oocysts were stable and infectious for at least 3 months when stored at 4 °C.

Concluding remarks

All together, these results define the mechanism of species specificity for T. gondii sexual development and show that the species barrier can be broken for T. gondii sexual development by inhibiting delta-6-desaturase activity in the intestines of a nonfeline host. The lack of delta-6-desaturase activity and the buildup of linoleic acid likely enhance T. gondii sexual development in multiple ways. First, prior work suggests linoleic acid is cytotoxic for the asexual tachyzoite stage [31]; thus, tachyzoite development would be halted in a linoleic-rich environment. Second, inhibition of delta-6-desaturase likely lowers arachidonic acid levels, which would alter the production of immune lipid mediators known as eicosanoids. Finally, the dramatic difference between oleic acid with one double bond and linoleic acid with two highlights that linoleic acid is probably used as a signaling molecule and not to meet basic nutritional needs. Quorum-sensing for sexual reproduction in fungi is dependent on oxygenation of linoleic acid but not oleic acid [9]. The multiple host and T. gondii cyclooxygenases and lipoxygenases might oxygenate linoleic acid to an oxylipin signaling molecule for T. gondii sexual development to proceed. Other protozoan parasites also rely on host derived lipids, which may be used as signaling molecules as well as lipid sources for parasite growth during their life cycles [32,33].

Materials and methods

Ethics statement

Mice were treated in compliance with the guidelines set by the Institutional Animal Care and Use Committee (IACUC) of the University of Wisconsin School of Medicine and Public Health (protocol #M005217). Cats were treated in compliance with the guidelines set by the IACUC of the United States Department of Agriculture, Beltsville Area (protocol #15–017). Both institutions adhere to the regulations and guidelines set by the National Research Council.

Intestinal organoids

Cat intestinal organoids were established from jejunum sections obtained from fetal small-intestinal sections. Mouse intestinal organoids were established from jejunum sections from 8-week-old C57BL/6J male mice. Organoids were generated as described previously [34]. Briefly, intestinal sections were washed in ice-cold PBS containing 0.1 mg/mL streptomycin and 100 U/mL penicillin for 20 minutes. Sequentially, EDTA (Sigma) was added to a final concentration of 2 mM and the tissue incubated for 40 minutes at 4 °C. The tissue was then rinsed in cold PBS without EDTA and vigorously shaken until crypts were seen in the supernatant. The crypt suspension was filtered using a 70-μm cell strainer, and the crypts were centrifuged at 80g for 5 minutes. The cells were resuspended in Matrigel (BD Biosciences), pipetted into a 24-well plate, allowed to polymerize, and then covered with organoid medium. The organoid medium contains Advanced DMEM/F12 with 2 mM Glutamax, 20 mM HEPES, 1 × B27, 1 × N2, 10% v/v fetal bovine serum, 10 mg/L insulin, 5.5 mg/L transferrin, 0.67 mg/L selenite, penicillin and streptomycin (all from Invitrogen), 50 ng/ml human EGF (R&D systems), 10 mM nicotinamide (Sigma), 3 μM CHIR99021 and 10 μM Y-27632 (both Selleckchem), and 50% v/v conditioned medium obtained from L-WRN cell line (ATCC CRL 3276). The medium was changed every other day, and the organoids were expanded by passing the cells through a 25-gauge needle every week. All experiments were done with cells at passage 2 to 5, and cells were regularly checked for mycoplasma contamination (MicoAlert Lonza).

Intestinal monolayers and fatty acid supplementation

Monolayers were generated from intestinal organoids as described previously [35]. Briefly, established cat or mouse intestinal organoids were washed with cold PBS, digested by 0.05% m/v trypsin for 5 minutes at 37 °C, centrifuged at 250g for 3 minutes, and resuspended in fresh prewarmed organoid medium. Cell suspension was added into a chamber slide (Thermo) precoated with Entactin-Collagen IV-Laminin (Corning) for cat cells or 2% m/v Gelatin in PBS (Sigma) for mouse cells. The slides were coated by air-drying the basement membrane matrix or gelatin to air-dry overnight. The monolayers were grown for 10–15 days prior to infection with T. gondii bradyzoites, with media change every other day until cells reached 90% or more confluency. Linoleic acid or oleic acid conjugated to BSA (Sigma) was added to the organoid monolayers to 0.2 mM 24 hours prior to infection.

Bradyzoite preparation and infection

C57BL/6J mice were oral gavage infected with 500–1,000 ME49 oocysts from cat feces. At 28 days post infection, brains were removed, washed in cold PBS, and homogenized with a glass tissue grinder. The suspension was centrifuged at 400g for 10 minutes and the pellet suspended in 20% m/v Dextran (Average MW 150,000, Sigma). Bradyzoite cysts were pelleted and separated from brain material by centrifugation at 2,200g for 10 minutes. The pellet was washed in PBS, digested by 0.1 mg/mL pepsin in HCl for 5 minutes at 37 °C, and then neutralized with an equal volume 1% Sodium Carbonate (Sigma). Bradyzoites were spun at 250g for 10 minutes, resuspended in prewarmed organoid medium, and added onto the organoid monolayers with a multiplicity of infection of 1 bradyzoite:10 intestinal epithelial cells (MOI 1:10).

Delta-6-desaturase inhibition

SC-26196 (Cayman) was solubilized in DMSO and used at 20 μM in mouse organoid monolayers. For in vivo treatment, the inhibitor was solubilized in 0.5% m/v methylcellulose, and the mice were given 50 mg/kg every 12 hours by oral gavage [24]. C57BL/6J female mice (4 weeks old) deleted in Z-DNA-binding protein [36] were divided into four different groups: uninfected control, T. gondii–infected without fatty acid supplementation, T. gondii–infected with linoleic acid supplementation, and T. gondii–infected with linoleic acid and SC-26196 inhibitor. Each mouse supplemented with linoleic acid received 10 μL of 99% linoleic acid oil (MilliporeSigma Cat#843483) suspended in 0.5% Methylcellulose per day by oral gavage. Mice were infected with 1,000 brain cysts purified as described above by oral gavage and euthanized 7 days post infection. Sample size was at least two mice per group, and the experiment was repeated five times. Alternatively, each mouse was infected with one mouse brain at least 2 months post infection with at least 1,000 cysts. Mice were treated with SC-26196 until day 5 post infection. Feces were collected from days 5–14 and oocysts enumerated by microscopy.

Immunofluorescence

Intestinal organoid monolayers or mouse fecal samples were fixed in 3.7% formaldehyde in PBS for 20 minutes, permeabilized with 0.2% triton X-100 (Sigma) in PBS at room temperature for 1 hour, and then blocked with 3% BSA in PBS at room temperature for 1 hour. Primary antibody was incubated at 4 °C overnight in 0.2% v/v Triton x-100 and 3% BSA in PBS (1:100 mouse anti-GRA11B, 1:100 rabbit anti-BRP1, 1:100 mouse anti-AO2, 1:50 monoclonal mouse anti-ZO-1 [Santa Cruz], or 1:25 mouse IgM anti-oocyst wall 3G4). Sporulated oocysts from mouse feces were dried onto slides, fixed and permeabilized with ice-cold acetone for 30 minutes, and incubated with 1:20 mouse 4B6 to the visualize the sporocyst. Slides were incubated with the specific secondary antibody (1:500 goat anti-rabbit Alexa Fluor 488 and 1:500 goat anti-mouse Alexa Fluor 594) at room temperature for 1 hour and then washed three times with PBS. Cells nuclei were stained with 10 μM DAPI (Sigma). Slides were mounted in Vectashield antifade mounting medium (VectorLabs). Samples were imaged on Zeiss Axioplan III equipped with a triple-pass (DAPI/fluorescein isothiocyanate [FITC]/Texas Red) emission cube, differential interference contrast optics, and a monochromatic Axiocam camera operated by Zen software (Zeiss) and processed using ImageJ (Fiji packet).

Tissue sectioning and histology

Ileums were fixed in 3.7% formaldehyde in PBS overnight, embedded in paraffin, and sectioned by the Translational Research Initiatives in Pathology laboratory at the University of Wisconsin–Madison. The sections were stained with hematoxylin and eosin or reticulin (silver) stain.

Real-time PCR on ileum cDNA

Mice with and without delta-6-desaturase inhibitor treatment were euthanized 7 days post infection. The ileum of each mouse was removed and homogenized in 1 mL of TRIzol. Total RNA was isolated according to manufacturer’s protocol (Invitrogen) and treated with amplification-grade DNase I. cDNA was generated using the Invitrogen SuperScript III First-Strand Synthesis kit with random hexamer primers. GRA11B and SAG1 were used as markers of sexual and asexual stages, respectively. The T. gondii housekeeping gene TUB1A was used to normalize target gene expression. Real-time qPCR was performed using Bio-Rad iTaq Universal SYBR Green Supermix on an Applied Biosystems StepOnePlus Real-Time PCR system. The efficiency of each primer set was calculated from the slope of a 1:10 dilution standard curve of tachyzoite gDNA, where E = 10^(−1/slope). The Pfaffl method [37], which accounts for differences in efficiencies, was then used to calculate the relative gene expression of GRA11B and SAG1 per sample, in triplicate. Only wells with one melt curve temperature were used, indicating a single product. Primer sequences were as follows:

TUB1A forward: 5′ –GACGACGCCTTCAACACCTTCTTT– 3′

Reverse: 5′ –AGTTGTTCGCAGCATCCTCTTTCC– 3′

SAG1 forward: 5′ –TGCCCAGCGGGTACTACAAG– 3′

Reverse: 5′ –TGCCGTGTCGAGACTAGCAG– 3′

GRA11B forward: 5′ –ATCAAGTCGCACGAGACGCC– 3′

Reverse: 5′ –AGCGAATTGCGTTCCCTGCT– 3′

Real-time PCR for T. gondii genomic DNA in fecal samples

Fecal samples from the mice with and without delta-6-desaturase inhibitor treatment were collected. Genomic DNA was generated from 0.1 g of feces from each mouse using the power soil DNA kit (QIAGEN) according to the manufacturer’s instructions except that cells were broken by a bead beater instead of a vortex. A standard curve was generated using a dilution series of 101–105 parasites per well amplified using the SAG1 primer set described above, based on a genomic DNA sample with known parasite quantity. The Ct values were plotted against the log of the parasite numbers. The number of target gene copies in each sample can be interpolated from the linear regression of the standard curve.

Real-time PCR was performed on each sample, in triplicate, using Bio-Rad iTaq Universal SYBR Green Supermix on an Applied Biosystems StepOnePlus Real-Time PCR system. The calculated copy numbers of each sample were normalized based on the ng of nucleic acid used as PCR template. Only wells with one melt curve temperature were used, indicating a single product.

PCR of cat intestinal monolayers

Cat intestinal monolayers were grown in 24-well plates until confluency and then were incubated with either no fatty acid supplementation, 200 μM oleic acid, or 200 μM linoleic acid for 24 hours. The monolayers were infected with ME49 bradyzoites purified from brains of chronic infected mice in duplicate with uninfected monolayers as a negative control. Seven days post infection, RNA was extracted with TRIzol, and cDNA was synthesized as described above. TgAO2 was used as a marker for macrogametes, and TgME49_306338 was used as a marker for microgametes. TUB1A was used as an input control using the same primers as above. A cDNA synthesis reaction without the addition of reverse transcriptase was used as a control for genomic DNA contamination. Equivalent amounts of cDNA per sample were used as a template for each PCR reaction, and the products were separated on an acrylamide gel and imaged. Primer sequences were as follows:

TgAO2 forward: 5′ –GTCTTGGTTCGTTGAAGGGGCTG– 3′

Reverse: 5′ –CGTCCTCGATGCCCATGAAATCTG– 3′

TgME49_306338 forward: 5′ –CCACGTCCTTCGCCGATG– 3′

Reverse: 5′ –CATCAGAGGTCCCAGGTTGTCG– 3′

Statistical methods

All real-time PCR fecal samples were run in triplicate technical replicates. The difference between the mean target gene copy numbers was analyzed by two-tailed unpaired t tests. The real-time PCR intestinal samples were run in triplicate from two biological replicates per group. The difference between the mean relative expression of each target gene was analyzed by two-tailed unpaired t tests.

Oocyst sporulation and mouse infections

Fresh fecal samples were obtained from each mouse, homogenized in PBS, and then centrifuged at 1,500g. The pellet was resuspended in PBS plus penicillin and streptomycin, and the samples were shaken for 7–14 days at room temperature in presence of oxygen. Mice oocysts were stable for at least 3 months at 4 °C. Naïve mice were infected with approximately 250 mouse oocysts through intraperitoneal injection. Mice were humanely euthanized at day 28 post infection, and their brains were removed, homogenized, and either incubated with biotinylated DBA 1:1,000 or purified with 20% m/v Dextran as described above before DBA incubation. All cysts were then incubated with streptavidin-conjugated Alexa Fluor-594 1:1,000 and imaged on Zeiss Axioplan III equipped with a triple-pass (DAPI/FITC/Texas Red) emission cube, differential interference contrast optics, and a monochromatic Axiocam camera operated by Zen software (Zeiss) and processed using ImageJ (Fiji packet).

Western immunoblot

ME49 tachyzoite lysates were run on a 15% SDS-PAGE protein gel, transferred to a nitrocellulose membrane, and strips blocked with 5% w/v low fat milk in TBS 1.0% v/v Tween-20. Collected serum was diluted 1:250 TBS 1.0% v/v Tween-20, and 1:2,000 anti-mouse HRP was used as the secondary antibody. Serum from C57BL/6 mice infected with cat oocysts for 26 days was used as positive control, and serum from uninfected C57BL/6 mice was used as negative control. Stripes were imaged by LI-COR (LI-COR Biosciences) at 700 nm or chemiluminescence for a 5-minute exposure.

Quantification of merozoites in mouse tissue culture.

Mouse intestinal organoids were disassociated by trypsin, and the individual cells were grown on glass slides. Slides were divided into three different groups: not supplemented with fatty acids or SC-26196 inhibitor, supplemented with 200 μM linoleic acid, or supplemented with 200 μM linoleic acid plus 20 μM SC-26196 (“D6D +LA”). Monolayers were infected with T. gondii ME49 bradyzoites purified from brains of chronic infected mice. At 5 days post infection, monolayers were stained for GRA11B, BRP1, and DAPI. Total number of parasitophorous vacuoles were counted by positive DAPI staining and confirmed by morphology with DIC. The percentage of vacuoles positive for GRA11B and BRP1 out of the total vacuoles was determined. Three biological replicates were counted, and on average, 26% of the total vacuoles were positive for GRA11B and BRP1 in the linoleic acid–supplemented monolayers with the addition of SC-26196. **p-value = 0.0039 with N = 3 by two-tailed unpaired t test. BRP1, bradyzoite rhoptry protein-1; DIC, differential interference contrast; GRA11B, dense granule protein 11B.

(TIF)

Click here for additional data file.

Mice oocyst infectivity evaluation by serum conversion.

Oocysts collected from SC-26196-treated mice were sporulated and injected intraperitonially into C57BL/6 mice. Serum was collected by terminal bleed at either 22 days (1 and 2), 28 days (3 and 4), or 3 months (5–10) post infection. Serum from uninfected mouse was used as a negative control (−). The positive control (+) was serum from a mouse infected for 26 days with cat oocysts. Serum was incubated with nitrocellulose blotted with ME49 tachyzoite lysate. Panel (a) is chemiluminescence, and (b) is a 700-nm image showing the individual lanes and the protein ladder.

(TIF)

Click here for additional data file.

Twenty-eight days post infection with oocysts, mouse brains were removed, homogenized, and stained for T. gondii cysts by DBA (red). All panels are 20 μm2 with a 5-μm white size bar in the lower right corner. DBA, D. biflorus agglutinin.

(TIF)

Click here for additional data file.

Raw data for Fig 2a.

Quantification of GRA11B and BRP1 double-positive vacuoles in cat tissue culture. Cat intestinal monolayers were divided into three different groups: not supplemented with fatty acid, supplemented with 200 μM oleic acid, or supplemented with 200 μM linoleic acid (left column). Monolayers were infected with T. gondii ME49 bradyzoites purified from brains of chronic infected mice at a 1:10 MOI. Five days after infection, staining was performed for GRA11B and BRP1 along with DAPI. For each random field, the number of host cell nuclei was counted along with GRA11B/BRP1 double-positive and negative vacuoles. For each biological replicate, five different technical replicates were counted, and the average value is presented. Each line of the table is an independent experiment, three biological replicates. BRP1, bradyzoite rhoptry protein-1; GRA11B, dense granule protein 11B; MOI, multiplicity of infection.

(TIF)

Click here for additional data file.

Raw data for Fig 2b.

Raw Ct values of TUB1A, SAG1, and GRA11B from the cDNA of cat intestinal monolayers samples using TUB1A as the normalizer for target gene expression. Wells with multiple melt curve temperatures, indicating off-target products, were excluded (“NA”). Samples below the detection limit of 40 cycles are labeled BDL. BRP1, bradyzoite rhoptry protein-1; GRA11B, dense granule protein 11B; SAG1, surface antigen 1; TUB1A, tubulin 1A.

(TIF)

Click here for additional data file.

Raw data for Fig 3h.

Quantification of vacuoles positive with the oocyst wall antibody 3G4 in cat tissue culture. Cat intestinal monolayers were divided into three different groups: not supplemented with fatty acid, supplemented with 200 μM oleic acid, or supplemented with 200 μM linoleic acid (left column). Monolayers were infected with T. gondii ME49 bradyzoites purified from brains of chronic infected mice at a 1:10 MOI. Seven days after infection, staining for oocyst wall antigen was performed with 3G4 antibody. For each 1-cm2 well, the total number of 3G4 positive vacuoles was counted. Each column of the table is an independent experiment, three biological replicates. MOI, multiplicity of infection.

(TIF)

Click here for additional data file.

Raw data for S1 Fig.

Quantification of GRA11B and BRP1 double-positive vacuoles in mouse tissue culture. Mouse intestinal monolayers were divided into three different groups: not supplemented with fatty acids or SC-26196 inhibitor (no fatty acid), supplemented with 200 μM linoleic acid, or supplemented with 200 μM linoleic acid plus the addition of 20 μM SC-26196 (“D6D inh.”). Monolayers were infected with T. gondii ME49 bradyzoites purified from brains of chronic infected mice at a 1:10 MOI. Five days after infection, staining was performed for GRA11B and BRP1 along with DAPI. For each random field, the number of host cell nuclei was counted along with GRA11B/BRP1 double-positive and negative vacuoles. For each biological replicate, three different technical replicates were counted, and the average value is presented. Each line of the table is an independent experiment, three biological replicates. BRP1, bradyzoite rhoptry protein-1; GRA11B, dense granule protein 11B; MOI, multiplicity of infection.

(TIF)

Click here for additional data file.

Raw data for Fig 5a.

Raw Ct values of the TUB1A, SAG1, and GRA11B standard curves on a dilution series of genomic DNA from tachyzoites and raw Ct values of TUB1A, SAG1, and GRA11B from the cDNA of homogenized mouse ileum samples using TUB1A as the normalizer for target gene expression. Wells with multiple melt curve temperatures, indicating off-target products, were excluded (“NA”). Samples below the detection limit of 40 cycles are labeled BDL. BRP1, bradyzoite rhoptry protein-1; GRA11B, dense granule protein 11B; SAG1, surface antigen 1; TUB1A, tubulin 1A.

(TIF)

Click here for additional data file.

Raw data for Fig 6a.

Raw Ct values of the SAG1 standard curve on a dilution series of genomic DNA with known parasite quantity and raw Ct values of SAG1 amplification from genomic DNA of unknown fecal samples using ng quantity input as the normalizer. Wells with multiple melt curve temperatures, indicating off-target products, were excluded (“NA”). SAG1, surface antigen 1.

(TIF)

Click here for additional data file.

Raw data for Fig 6b.

Feces (0.5 g) was solubilized in 500 μL of saline, and then 10 μL of this suspension was counted in a hemocytometer. The values in the table are number of oocysts per sample. Each column of the table is an independent experiment, three biological replicates. The average counts per d.p.i. were used to calculate the number of oocysts/gram of feces. d.p.i., day post infection.

(TIF)

Click here for additional data file.

20 Jun 2019

Dear Laura,

Thank you for submitting your manuscript entitled "Intestinal delta-6-desaturase activity determines host range for Toxoplasma sexual reproduction" for consideration as a Research Article by PLOS Biology following our chat yesterday.

I've evaluated your manuscript and consulted with an academic editor with relevant expertise and I am writing to let you know that we would like to send your submission out for external peer review.

However, before we can send your manuscript to reviewers, we need you to complete your submission by providing the metadata that is required for full assessment. To this end, please login to Editorial Manager where you will find the paper in the 'Submissions Needing Revisions' folder on your homepage. Please click 'Revise Submission' from the Action Links and complete all additional questions in the submission questionnaire.

**Important**: Please also see below for further information regarding completing the MDAR reporting checklist. The checklist can be accessed here: https://plos.io/MDARChecklist

Please re-submit your manuscript and the checklist, within two working days, i.e. by Jun 22 2019 11:59PM.

Login to Editorial Manager here: https://www.editorialmanager.com/pbiology

During resubmission, you will be invited to opt-in to posting your pre-review manuscript as a bioRxiv preprint. Visit http://journals.plos.org/plosbiology/s/preprints for full details. If you consent to posting your current manuscript as a preprint, please upload a single Preprint PDF when you re-submit.

Once your full submission is complete, your paper will undergo a series of checks in preparation for peer review. Once your manuscript has passed all checks it will be sent out for review.

Feel free to email us at plosbiology@plos.org if you have any queries relating to your submission.

Kind regards,

Lauren

Lauren A Richardson, Ph.D

Senior Editor

PLOS Biology

==================

INFORMATION REGARDING THE REPORTING CHECKLIST:

PLOS Biology is pleased to support the "minimum reporting standards in the life sciences" initiative (https://osf.io/preprints/metaarxiv/9sm4x/). This effort brings together a number of leading journals and reproducibility experts to develop minimum expectations for reporting information about Materials (including data and code), Design, Analysis and Reporting (MDAR) in published papers. We believe broad alignment on these standards will be to the benefit of authors, reviewers, journals and the wider research community and will help drive better practise in publishing reproducible research.

We are therefore participating in a community pilot involving a small number of life science journals to test the MDAR checklist. The checklist is intended to help authors, reviewers and editors adopt and implement the minimum reporting framework.

IMPORTANT: We have chosen your manuscript to participate in this trial. The relevant documents can be located here:

MDAR reporting checklist (to be filled in by you): https://plos.io/MDARChecklist

**We strongly encourage you to complete the MDAR reporting checklist and return it to us with your full submission, as described above. We would also be very grateful if you could complete this author survey:

https://forms.gle/seEgCrDtM6GLKFGQA

Additional background information:

Interpreting the MDAR Framework: https://plos.io/MDARFramework

Please note that your completed checklist and survey will be shared with the minimum reporting standards working group. However, the working group will not be provided with access to the manuscript or any other confidential information including author identities, manuscript titles or abstracts. Feedback from this process will be used to consider next steps, which might include revisions to the content of the checklist. Data and materials from this initial trial will be publicly shared in September 2019. Data will only be provided in aggregate form and will not be parsed by individual article or by journal, so as to respect the confidentiality of responses.

Please treat the checklist and elaboration as confidential as public release is planned for September 2019.

We would be grateful for any feedback you may have.

8 Jul 2019

Dear Dr Knoll,

Thank you very much for submitting your manuscript "Intestinal delta-6-desaturase activity determines host range for Toxoplasma sexual reproduction" for consideration as a Research Article by PLOS Biology. Your paper was evaluated by the PLOS Biology editors as well as by an Academic Editor with relevant expertise and by three independent reviewers. The reviewers appreciated the attention to an important topic. Based on the reviews, we will probably accept this manuscript for publication, providing that you will modify the manuscript according to the review recommendations.

We expect to receive your revised manuscript within two weeks. Your revisions should address the specific points made by each reviewer. In addition to the remaining revisions and before we will be able to formally accept your manuscript and consider it "in press", we also need to ensure that your article conforms to our guidelines, one of which is described below under DATA POLICY. A member of our team will be in touch shortly with a set of requests. As we can't proceed until these requirements are met, your swift response will help prevent delays to publication.

Upon acceptance of your article, your final files will be copyedited and typeset into the final PDF. While you will have an opportunity to review these files as proofs, PLOS will only permit corrections to spelling or significant scientific errors. Therefore, please take this final revision time to assess and make any remaining major changes to your manuscript.

Please note that you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

Please note that an uncorrected proof of your manuscript will be published online ahead of the final version, unless you opted out when submitting your manuscript. If, for any reason, you do not want an earlier version of your manuscript published online, uncheck the box. Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us as soon as possible if you or your institution is planning to press release the article.

To submit your revision, please go to https://www.editorialmanager.com/pbiology/ and log in as an Author. Click the link labelled 'Submissions Needing Revision' to find your submission record. Your revised submission must include a cover letter, a Response to Reviewers file that provides a detailed response to the reviewers' comments (if applicable), and a track-changes file indicating any changes that you have made to the manuscript.

Please do not hesitate to contact me should you have any questions.

Sincerely,

Di Jiang, PhD

Associate Editor

on behalf of

Lauren A Richardson, Ph.D,

Senior Editor

PLOS Biology

------------------------------------------------------------------------

DATA POLICY:

You may be aware of the PLOS Data Policy, which requires that all data be made available without restriction: http://journals.plos.org/plosbiology/s/data-availability. For more information, please also see this editorial: http://dx.doi.org/10.1371/journal.pbio.1001797

Note that we do not require all raw data. Rather, we ask that all individual quantitative observations that underlie the data summarized in the figures and results of your paper be made available in one of the following forms:

1) Supplementary files (e.g., excel). Please ensure that all data files are uploaded as 'Supporting Information' and are invariably referred to (in the manuscript, figure legends, and the Description field when uploading your files) using the following format verbatim: S1 Data, S2 Data, etc. Multiple panels of a single or even several figures can be included as multiple sheets in one excel file that is saved using exactly the following convention: S1_Data.xlsx (using an underscore).

2) Deposition in a publicly available repository. Please also provide the accession code or a reviewer link so that we may view your data before publication.

Regardless of the method selected, please ensure that you provide the individual numerical values that underlie the summary data displayed in the following figure panels: Figures 2ab, 3h, 5a, 6ab, S1, as they are essential for readers to assess your analysis and to reproduce it. Please also ensure that figure legends in your manuscript include information on where the underlying data can be found.

Please ensure that your Data Statement in the submission system accurately describes where your data can be found.

------------------------------------------------------------------------

Reviewer remarks:

Reviewer #1: Summary

The work described in this manuscript is truly transformative as it not only identifies the trigger of the Toxoplasma sexual cycle and why this only occurs in cats, it continues to fulfil Koch’s postulates by overcoming this species barrier by demonstrating the completion of the cycle in mice (and largely in vitro as well) by mimicking the cat environment. The work is also transformative in its approach as this is the first application of cat intestinal organoids to Toxoplasma. Besides the major biological breakthrough, these insights are relevant toward developing sexual recombination experiments in Toxoplasma (a tool that has been cumbersome due to its poor efficiency and the need of cats) as well as toward developing control strategies of cats shedding oocysts, which is a responsible for a large portion of human infections with Toxoplasma. In addition, the work is timely in light of the recent sudden and politically motivated suspension of the use of cats at the USDA, which supplied the majority of the Toxoplasma field with Toxoplasma oocysts. This work is therefore relevant for a very wide audience of microbiologists, infectious disease specialists, clinicians, epidemiologists and basic parasitology researchers. By fulfilling Koch’s postulates the paper per definition is very rigorous. In summary, a through breakthrough manuscript well described and executed. Only one minor comment as described below.

Specific comments.

Supplementary information; No Fig S2, but a fig 6. This is likely a mix up. Legend says “strained” instead of “stained” for DBA staining.

P7 line 13: in the sentence is referred to sero conversion, however, no data supporting this statement are shown in neither Fig 6e nor S2.

Reviewer #2 (Felix Yarovinsky, signed review): In this groundbreaking work the authors succeeded in answering a major biological question in the field of parasite biology. It was a mystery why the sexual cycle of Toxoplasma gondii is limited to felines, while the asexual life cycle can happen in any warm-blooded mammal. Using an elegant in vitro system based on the intestinal organoids, the authors identified that linoleic acid is essential for the expression of markers associated with the sexual cycle of the parasite. The authors provide the detailed biochemical explanation for this requirement. It appears that cats are deficient in delta-6-desaturase, the rate‐limiting step for the conversion of linoleic acid to arachidonic acid. As a result, linoleic acid is the dominant fatty acid in cat serum. This explains why the felines have an increased level of linoleic acid.

The authors next validated in vitro observation with mice that were fed with linoleic acid and delta-6-desaturase inhibitor. This treatment results in the full sexual cycle of the parasite in the murine intestine. This is a truly remarkable discovery in biology, and while there might be minor technical gaps in the work, I believe an immediate publication would benefit the scientific community. This is a highly significant work that not only teach us new biology, but also has a major clinical significance since it provides a novel biochemical tool to deal with toxoplasmosis in cats that may eventually lead to the elimination of this parasite in cats.

I only have two minor comments

1. In the following statement ‘After 5 days of infection, we found that the addition of linoleic acid but not oleic acid caused approximately 35% of the T. gondii to express both merozoite stage markers (Fig. 2a)’ the authors forgot to acknowledge the data shown in Fig 1d-1g as an additional experimental support in the above-mentioned statement.

Figure 2, Y- axis: the labeling needs to be more specific, as ‘%GRA11B and BRP1 positive’ is confusing.

Reviewer #3: Although it has been known for decades that felids are the definitive host for sexual replication of the intracellular protozoan parasite Toxoplasma gondii, the molecular underpinnings of this remarkable host specificity for parasite mating has remained an important unresolved mystery. The current work compellingly establishes that an excess linoleic acid drives sexual differentiation in culture and in mice, thus establishing for the first time in vitro and alternative in vivo models for T. gondii sexual development. The work represents a key breakthrough that will permit further dissection of sexual development, accelerate classical genetic linkage mapping of important traits, and reduce the dependence on using cats as an experimental model, among other avenues. The authors provide thorough qualitative and quantitative data that is appropriately interpreted and supportive of the conclusions. The following minor considerations should be addressed.

Line 21. Delete on of the “withs”

Page 8, line 5-7. This statement should be softened from “likely” given that no data is presented to support it. It is suggested that the authors rephrase it to e.g., It is possible that the multiple…

14 Jul 2019

Submitted filename: PLoS BioReferee.docx

Click here for additional data file.

17 Jul 2019

Dear Dr Knoll,

On behalf of my colleagues and the Academic Editor, Boris Striepen, I am pleased to inform you that we will be delighted to publish your Research Article in PLOS Biology.

The files will now enter our production system. You will receive a copyedited version of the manuscript, along with your figures for a final review. You will be given two business days to review and approve the copyedit. Then, within a week, you will receive a PDF proof of your typeset article. You will have two days to review the PDF and make any final corrections. If there is a chance that you'll be unavailable during the copy editing/proof review period, please provide us with contact details of one of the other authors whom you nominate to handle these stages on your behalf. This will ensure that any requested corrections reach the production department in time for publication.

Early Version

The version of your manuscript submitted at the copyedit stage will be posted online ahead of the final proof version, unless you have already opted out of the process. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.

PRESS

We frequently collaborate with press offices. If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximise its impact. If the press office is planning to promote your findings, we would be grateful if they could coordinate with biologypress@plos.org. If you have not yet opted out of the early version process, we ask that you notify us immediately of any press plans so that we may do so on your behalf.

We also ask that you take this opportunity to read our Embargo Policy regarding the discussion, promotion and media coverage of work that is yet to be published by PLOS. As your manuscript is not yet published, it is bound by the conditions of our Embargo Policy. Please be aware that this policy is in place both to ensure that any press coverage of your article is fully substantiated and to provide a direct link between such coverage and the published work. For full details of our Embargo Policy, please visit http://www.plos.org/about/media-inquiries/embargo-policy/.

Thank you again for submitting your manuscript to PLOS Biology and for your support of Open Access publishing. Please do not hesitate to contact me if I can provide any assistance during the production process.

Kind regards,

Harry Porter

Publication Assistant,

PLOS Biology

on behalf of

Lauren Richardson,

Senior Editor

PLOS Biology