Literature DB >> 31423079

Further study of two Chinese cave spiders (Araneae, Mysmenidae), with description of a new genus.

Chengcheng Feng1, Jeremy A Miller2, Yucheng Lin1, Yunfei Shu1.   

Abstract

The current paper expands knowledge of two Chinese cave spider species originally described in the genus Maymena Gertsch, 1960: M. paquini Miller, Griswold & Yin, 2009 and M. kehen Miller, Griswold & Yin, 2009. With the exception of these two species, the genus Maymena is endemic to the western hemisphere, and new evidence presented here supports the creation of a new genus for the Chinese species, which we name Yamaneta gen. nov. The male of Y. kehen is described for the first time. Detailed illustrations of the habitus, male palps and epigyne are provided for these two species, as well as descriptions of their webs. DNA sequences are provided for both Yamaneta species. We build on a previously published phylogenetic analysis of Mysmenidae to assess the phylogenetic position of Yamaneta and its relationship to true Maymena.

Entities:  

Keywords:  Maymena ; China; Gaoligong Mountains; new genus; phylogeny; symphytognathoids; troglobite

Year:  2019        PMID: 31423079      PMCID: PMC6694075          DOI: 10.3897/zookeys.870.35971

Source DB:  PubMed          Journal:  Zookeys        ISSN: 1313-2970            Impact factor:   1.546


Introduction

The genus Gertsch, 1960 was established in the context of a taxonomic paper describing several American spiders of the family Hickman, 1931. At that time, the concept of was broader than it is today; the taxa described therein are currently distributed among four families (, Petrunkevitch, 1928, Simon, 1895 and Simon, 1881). The world’s were reviewed and redefined by Forster and Platnick (1977), and several symphytognathid genera were transferred to other families, including to the . Gertsch’s (1960) original description included observations of several characteristics of but did not provide diagnostic characters for separating the genus from its close relatives. It was not until the recent publication of Lopardo and Hormiga (2015) that a rigorous and convincing diagnosis of was finally published. Miller et al. (2009) described several symphytognathoid spiders from the Gaoligong Mountains, Southwest China. Two species from caves were placed in the genus : Miller, Griswold & Yin, 2009 and Miller, Griswold & Yin, 2009, the latter species being known only from females. The genus currently contains 13 described species (World Spider Catalog 2019). Except for the two Chinese species, all are known from the western hemisphere, from the USA south through Mexico, Central America, the Caribbean, and Peru. In addition, two undescribed taxa in Lopardo et al. (2011) considered to belong to (Lopardo and Hormiga 2015) were from Argentina. Most species are clearly associated with caves, although a few species are occasionally or typically found in surface habitats (Gertsch 1960, 1971, Brignoli 1974, Baert 1990, Eberhard et al. 1993). In August 2008, students and professors of Sichuan University carried out a collecting survey in the Gaoligong Mountains. Both males and females of Miller et al.’s Chinese species were collected from their type localities and their web structures were discovered and photographed. In addition to new detailed morphological data and the description of the previously unknown male of , multiple individuals of both species were sequenced for five loci. To test the relationships of Chinese to western and other , we added this DNA sequence data to the molecular phylogenetic dataset of Lopardo et al. (2011).

Material and methods

Specimens were acquired by hand from the dark zone of caves and preserved in 95% ethanol. They were examined using a Leica M205 C stereomicroscope. Further details were studied under an Olympus BX43 compound microscope. Male palps and epigynes were examined and photographed after dissection. Epigynes were treated in lactic acid before being embedded in Arabic gum to take the photos of the vulva. To reveal the course of the spermatic ducts, male palps were also clarified using lactic acid and subsequently mounted in Hoyer’s Solution. The left palp was photographed and described. Photos were taken with a Canon EOS 60D wide zoom digital camera (8.5 megapixels) mounted on an Olympus BX 43 compound microscope. The images were montaged using Helicon Focus 3.10 (Khmelik et al. 2006) image stacking software. All measurements are in millimeters. Leg measurements are given as follows: total length (femur, patella, tibia, metatarsus and tarsus). Tissue samples were taken from eight individual specimens of Chinese representing both known species. Whole genomic DNA was extracted from tissue samples with TIANamp Micro DNA Kit (TIANGEN) following the manufacturer’s protocol for animal tissues. Five gene fragments were amplified in 25μL reactions: mitochondrial large-subunit ribosomal RNA (16S), nuclear small-subunit ribosomal RNA (18S), nuclear large-subunit ribosomal RNA (28S), cytochrome c oxidase subunit I (COI), and histone H3 (H3). Primer pairs and PCR protocols are given in Table 1. Raw sequences were edited and assembled using BioEdit v.7.2.5 (Hall 1999). New sequences generated for this study were deposited in GenBank; accession numbers are reported in Table 2. All molecular vouchers and examined materials are deposited in the Natural History Museum of Sichuan University in Chengdu (), China.
Table 1.

The loci, primer pairs, and PCR protocols used in this study.

Locus Annealing temperature/time Direction Primer Sequence 5’→3 Reference
16S48.5°/30sFLR-J-12864CTCCGGTTTGAACTCAGATCA Hormiga et al. 2003
RLR-J-13360GTAAGGCCTGCTCAATGAThis study
45°/30sFLR-J-12964AACTCAGATCATGTAATAATTThis study
RLR-J-13360GTAAGGCCTGCTCAATGAThis study
18S54.9°/30sF18S-1FTACCTGGTTGATCCTGCCAGTAG Giribet et al. 1996
RSSU rRNA reverseGTGGTGCCCTTCCGTCAATT Balczun et al. 2005
28S53.1°/30sF28SaGACCCGTCTTGAAACACGGA Rix et al. 2008
RLSURGCTACTACCACCAAGATCTGCA Rix et al. 2008
COI46°/30sFLCO1490GGTCAACAAATCATAAAGATATTGG Folmer et al. 1994
RHCO2198TAAACTTCAGGGTGACCAAAAAATCA Folmer et al. 1994
45°/30sFLCO1490GGTCAACAAATCATAAAGATATTGG Folmer et al. 1994
RC1-N-2191 (Nancy)CCCGGTAAAATTAAAATATAAACTTC Simon et al. 1994
H346°/30sFH3aFATGGCTCGTACCAAGCAGACVGC Colgan et al. 1998
RH3aRATATCCTTRGGCATRATRGTGAC Colgan et al. 1998
49.4°/30sFH3nFATGGCTCGTACCAAGCAGAC Colgan et al. 1998
RH3nRATRTCCTTGGGCATGATTGTTAC Colgan et al. 1998
Table 2.

GenBank accession numbers for new DNA sequence data provided here.

Species Identifier Sex/Stage 16S 18S 28S COI H3
Yamaneta kehen GlgMY14Male MK908789 MK908805 MK908797 MK895530 MK895538
GlgMY14Female MK908790 MK908806 MK908798 MK895531 MK895539
GlgMY14Juvenile MK908791 MK908807 MK908799 MK895532 MK895540
GlgMY15Male MK908792 MK908808 MK908800 MK895533 MK895541
GlgMY15Female MK908793 MK908809 MK908801 MK895534 MK895542
Yamaneta paquini GlgMY16Male MK908794 MK908810 MK908802 MK895535 MK895543
GlgMY16Female MK908795 MK908811 MK908803 MK895536 MK895544
GlgMY16Juvenile MK908796 MK908812 MK908804 MK895537 MK895545
The loci, primer pairs, and PCR protocols used in this study. GenBank accession numbers for new DNA sequence data provided here. The most recent molecular phylogeny of was Lopardo et al. (2011). Lopardo supplied alignments of the six genes used in their analysis (the five above plus the mitochondrial small-subunit ribosomal RNA 12S). Taxonomic determinations were updated according to notes in Lopardo and Hormiga (2015). The COI sequence “Mysmena-MYSM-018-MAD” (GU456888) was omitted because it was flagged on GenBank as removed at the submitter’s request because of possible contamination. We used the MAFFT version 7 online service (https://mafft.cbrc.jp/alignment/server/add_sequences.html) with the following settings to add the Chinese sequences to the existing alignments of the five shared loci (Strategy: Auto, scoring matrix for nucleotide sequences: 200PAM/k=2, Gap opening penalty: 1.53, offset value: 0.0; Katoh et al. 2017). Alignments of all six loci were concatenated in Geneious version 8.1.8 (https://www.geneious.com). The final alignment consisted of 6038 positions (Suppl. material 1). Uncorrected pairwise distances between terminals in the expanded alignment were calculated using MEGA X (Kumar et al. 2018) and are included as Suppl. material 2. We did not build on the morphological data matrix of Lopardo et al. (2011) or the expansion of this dataset in Lopardo and Hormiga (2015), and these data were not used in our analysis. This is because DNA sequence datasets are relatively simple to expand with additional data; it would be difficult for us to do the same for the large and complex morphological dataset without risking the introduction of errors and artifacts. The most parsimonious tree was found using 1000 replicates of random taxon addition and TBR (Tree-Bisection-Reconnection) branch swapping using MEGA X (Kumar et al. 2018). To assess support, bootstrap values were calculated using MEGA X (Kumar et al. 2018) with 1000 bootstrap replicates, each consisting of 1000 replicates of random taxon addition and TBR branch swapping. Departing from the approach of Lopardo et al. (2011), gaps/missing data were treated as ambiguities, not as a 5th character state. The Bayesian phylogenetic inference was performed using MrBayes version 3.2.6 (Ronquist and Huelsenbeck 2003) through the Cipres Science Gateway (Miller et al. 2010). Partitions and models followed Lopardo et al. (2011; table 4). A total of 10 partitions were defined (three independently modeled regions each for the nuclear ribosomal genes 18S and 28S, single model for each of the remaining four loci). The Bayesian search consisted of 50,000,000 generations using four chains, with the chain sampled every 1000 generations (see Suppl. material 1). Tracer version 1.7.1 (Rambaut et al. 2018) was used to establish the appropriate level of burn-in, which was set at 5000. Abbreviations appearing in text and figures are as follows: anterior lateral eyes anterior median eyes base of cymbium basal haematodocha cymbial apophysis copulatory ducts clasping spine on leg I cymbium cymbial conductor setae on cymbial fold E embolus fertilization ducts paracymbium posterior lateral eyes posterior median eyes S spermathecae spermatic duct scape T tegulum tibia setae on palpal tibia tibial spine on leg I trichobothria on tibia Institutional acronyms: Natural History Museum of Sichuan University, Chengdu, China

Results

Parsimony analysis of the expanded sequence alignment recovered a single most parsimonious tree (Fig. 1). This tree features a monophyletic, but weakly supported, . Western hemisphere and Chinese are reciprocally monophyletic, with moderate bootstrap support. The two Chinese species are coherent. Few clades, especially along the backbone of the phylogeny, have high bootstrap support, and relationships among outgroup taxa are complicated. The low support values seem in part to be attributable to a number of unstable taxa. (western and Chinese) and Simon, 1922 together form a paraphyletic complex, with one branch of sister to (western and Chinese) and the other branch sister to the remaining .
Figure 1.

Single most parsimonious tree (15922 steps) resulting from the analysis of Lopardo et al.’s (2011) “Molecular A” alignment plus 8 new sequences from gen. nov. specimens. Numbers at nodes indicate bootstrap support ≥ 50%. Family indicated with a gray box; clade , and also families , , and (except for TSMD 001 THAI) indicated with light gray shading, anapid subfamily indicated with dark gray shading. Note non-monophyly of , , , and .

Single most parsimonious tree (15922 steps) resulting from the analysis of Lopardo et al.’s (2011) “Molecular A” alignment plus 8 new sequences from gen. nov. specimens. Numbers at nodes indicate bootstrap support ≥ 50%. Family indicated with a gray box; clade , and also families , , and (except for TSMD 001 THAI) indicated with light gray shading, anapid subfamily indicated with dark gray shading. Note non-monophyly of , , , and . After 50,000,000 generations of Bayesian analysis, the average deviation of split frequencies fell below 0.05. The combined effective sample sizes of the two MCMC chains were 7425.9 and 7654.5 (12,520.9 combined), comfortably above the recommended minimum of 200 (Lanfear et al. 2016). The Bayesian topology (Fig. 2) features a monophyletic , which in contrast to the parsimony analysis enjoys high support from posterior probability. As in the parsimony analysis, western and Chinese are reciprocally monophyletic with high support, and the two Chinese species are coherent. However, branch lengths suggest a long separation between the Chinese and western lineages. The Bayesian analysis also indicates complicated relationships among the outgroup taxa. (western and Chinese) and together form a paraphyletic complex similar to that found in the parsimony analysis; one branch of is sister to all other , and the other branch of is sister to the remaining , except for (western and Chinese).
Figure 2.

Topology from Bayesian mixed model analysis based on Lopardo et al.’s (2011) “Molecular A” alignment plus 8 new sequences from gen. nov. specimens. Numbers at nodes indicate percent posterior probabilities; other conventions as in Fig. 1. Note diphyly of , nesting of most within “ 1”, and placement of outside other micropholcommatines.

Topology from Bayesian mixed model analysis based on Lopardo et al.’s (2011) “Molecular A” alignment plus 8 new sequences from gen. nov. specimens. Numbers at nodes indicate percent posterior probabilities; other conventions as in Fig. 1. Note diphyly of , nesting of most within “ 1”, and placement of outside other micropholcommatines.

Discussion

Monophyly of and relationships between the so-called symphytognathoid families (including , , and ) are complicated and inconsistent across various analyses. Early attempts based on morphological data (e.g., Griswold et al. 1998) proposed a “symphytognathoid” clade composed of monophyletic families, but Schütt (2003) warned that some of this could be based on a syndrome of parallel reductions and simplifications related to the evolution of small size. DNA sequences initially seemed promising as a source of phylogenetic data independent of morphology, where homology assessment could be confused with parallel evolution. The analysis of Rix et al. (2008) tested the relationships of and (currently considered part of ; Schütt 2003, Lopardo et al. 2011, World Spider Catalog 2019), with representatives of several other relevant families, based on DNA sequence data from two nuclear ribosomal loci. Results concerning the primary focal group of the study, the , were fairly robust and consistent. However, results regarding the and key outgroup taxa were generally of poor resolution and inconsistent across tree-building methods. This despite being built upon what was, for the time at least, a rigorous and sophisticated analytical approach. The results of the analyses reported in Lopardo et al. (2011) were similarly sensitive to changes in analytical parameters. This analysis was based on an expanded set of loci compared to Rix et al. (2008), plus a set of morphological characters, and many permutations of data partitions and phylogenetic optimization methods were employed. The monophyly of was relatively robust to permutations of the analysis, but the inclusion of morphological data had a tendency to support the monophyly of outgroup families, which sometimes collapsed in analyses based on molecular sequences alone. A series of studies by Dimitrov et al. (2012, 2016) used roughly the same set of loci with a progressively expanded sample of taxa to explore deep questions of spider relationships. These consistently recovered two clades of anapids and never found support for the monophyly of symphytognathoid families. The phylogenetic analysis of Wheeler et al. (2017) further expanded the taxon sample, but not the selection of loci. (including a monophyletic ), , and were each monophyletic and moderately well supported; was monophyletic only after the pruning of one problematic taxon, and still presented with low support. The four symphytognathoid families together were found to be closely related but not monophyletic. The parsimony and Bayesian phylogenies presented here disagree about outgroup relationships in several important ways, including the monophyly of , its relationship to , and the sister clade to . Such results are not surprising, because previous studies relying on the same limited set of reliable loci have seen similar results for nearly a decade, and also because taxon sampling outside in this study and its predecessors (Lopardo et al. 2011, Lopardo and Hormiga 2015) is very limited. Recent phylogenomic approaches have finally expanded the volume of DNA sequence data used to investigate spider phylogeny (Bond et al. 2014, Fernández et al. 2014, 2018, Garrison et al. 2016), but only Fernández et al. (2018) has achieved the taxon sampling necessary to address some of the longstanding symphytognathoid questions. Their study, based on ca 2500 genes, found monophyletic (4 terminals), (3 terminals) and (2 terminals; was not represented); none of the symphytognathoid families present were found to be sister taxa. We look forward to further studies with greatly expanded DNA sequence coverage and the taxon sample necessary to address longstanding symphytognathoid questions. Lopardo and Hormiga (2015) noted that the placement of the several mysmenid species and genera described by Miller et al. (2009) had yet to be tested phylogenetically; here we have begun to rectify this. Both parsimony and Bayesian analyses found the Chinese species formed a clade sister to the remaining . This suggests that placing the Chinese species in was defensible. However, multiple lines of available evidence seem sufficient to justify the creation of a new genus to accommodate the Chinese species. The two Chinese are the only members of the genus known from beyond the western hemisphere. Although the Chinese resemble and share several characters with those from the west (e.g., aspects of the genital morphology, trichobothria on the male palpal tibia, troglophily, web architecture), they also express distinguishing features (e.g., elongate male palpal tibia and patella, relatively long and setose epigynal scape). Bayesian branch lengths (Fig. 2) and uncorrected pairwise distances based on our alignment (Fig. 3) both indicate a degree of distinctness between the Chinese and western .
Figure 3.

Box plot of uncorrected pairwise distances between terminals representing (M-M), gen. nov. (Y-Y), and between and (M-Y). See Suppl. material 2 for complete distance matrix.

Box plot of uncorrected pairwise distances between terminals representing (M-M), gen. nov. (Y-Y), and between and (M-Y). See Suppl. material 2 for complete distance matrix.

Taxonomy

Petrunkevitch, 1928

Miller & Lin gen. nov. 1DE18130FDDA50BFBC427EE47C0D9D0A http://zoobank.org/5383A9BC-F125-4D4B-8603-BDA44B06163D

Type species.

Miller, Griswold & Yin, 2009.

Etymology.

Formed from Yama, the figure in Chinese mythology who oversees the realm of the dead, and -neta (-νήτης), an element in several spider names conventionally taken to mean ‘spinner’ (Cameron 2005). The gender is masculine.

Diagnosis.

Distinguished from other mysmenid genera except by the presence of a modified spatulate seta on the PLS (Miller et al. 2009: fig. 57D, F; Lopardo and Hormiga 2015: fig. 11G, H), the proximal position of the male metatarsus I clasping spur (more proximal in than ; Miller et al. 2009: fig. 53A; Lopardo and Hormiga 2015: fig. 16G), the shape of the apical part of the cymbium, which appears to form a functional conductor (Miller et al. 2009: fig. 55A; Lopardo and Hormiga 2015: fig. 10D, G) that interacts with the embolus. The presence of trichobothria on the male palpal tibia is a rare character in , occurring in such genera as , , , Simon 1898 and Griswold, 1985. Distinguished from by the elongate male palpal tibia and patella, long and setose epigynal scape, by the absence of a modified seta with a long row of branches near the major ampullate gland spigot on the anterior lateral spinnerets (Miller et al. 2009: fig. 57B), and by the clustered arrangement of male epiandrous fusules (Miller et al. 2009: fig. 56D; dispersed in : Lopardo and Hormiga 2015: figs 12B, 16A). The type species (Chamberlin & Ivie, 1938) has been described as having a small rounded scape (Gertsch 1960), although this is a glabrous structure (setose in ), and is coded as absent for a scape in phylogenetic data matrices (Lopardo et al. 2011, Lopardo and Hormiga 2015: character 60). There are also similarities in the female reproductive path shared between and , such as the fertilization ducts arising from the copulatory ducts rather than the spermathecae (Lopardo and Hormiga 2015: fig. 128B); internal female reproductive structures and spinneret spigot morphology have been documented for only a few species.

Description.

Relatively large mysmenids (>2 mm). Femoral spots on legs I and II in female, leg I only in male. Legs with macrosetae on the femora, tibiae, and metatarsi, especially in the anterior legs. Male clasping spurs arise from distal part of tibia I and basal third of metatarsus I. Leg formula IV-I-II-III. Carapace subovate, ocular area slightly raised. Eight eyes in two rows. AME black and with dark base, others reflective. ALE and PLE contiguous. ARE procurved, PRE straight (Fig. 4). Clypeus moderately high, inclined from anterior lip to eye region. Cervical groove and thoracic fovea indistinct. Thoracic region flat, smooth, nearly hairless except for the eye region and midline. Chelicerae strong, deeper color than carapace. Endites nearly rectangular. Labium rectangular, fused to sternum. Sternum heart-shaped, flat, hirsute, posterior corner sharp (Figs 4B, E, 7B, E). Abdomen globular dorsally, ovate laterally, mottled light to medium gray or tan, sparsely covered with black setae. Spinnerets distinctly sclerotized, the anteriors larger than the posteriors; colulus small, with two tiny setae; anal tubercle pale yellow (Figs 4, 7). Male palpal patella and tibia elongate, palpal tibia with at least one trichobothrium. Hook-like apophysis on prolateral face of cymbium (Miller et al. 2009: fig. 55C). Cymbium folded distally, forming functional conductor. Tegular conductor absent. Embolus long and filiform arising from proximal part of palpal bulb. Epigyne with setose scape extending nearly to the tracheal spiracle (Figs 4E, F, 7E, F). Scape with notched lateral margins (Figs 6D, 9D), profile distinctly curved at dorsum (Figs 6B, 9B). Spermathecae globular, copulatory ducts arise from mesal part of spermathecae, loop near base of scape, terminate in paired openings near middle of scape (Figs 6C, D, 9C, D). Fertilization ducts arise from copulatory ducts rather than spermathecae (Figs 6D, 9D). Male epiandrous fusules with clustered arrangement (Miller et al. 2009: fig. 56D). PLS with modified spatulate seta (Miller et al. 2009: fig. 57D, F; Lopardo and Hormiga 2015: fig. 11G, H).
Figure 4.

(Miller, Griswold & Yin, 2009) comb. nov. from Fugong Co., Lishadi, “a nameless cave” A–C Male habitus D–F female habitus A, D dorsal B, E ventral C, F lateral. Scale bars: 0.50 mm.

Figure 7.

(Miller, Griswold & Yin, 2009) comb. nov. from Lushui Co., Daxingdi, Walayaku [cave], male and female A–C Male habitus D–F female habitus A, D dorsal B, E ventral C, F lateral. Scale bars: 0.50 mm.

Figure 6.

(Miller, Griswold & Yin, 2009) comb. nov. from Fugong Co., Lishadi, “a nameless cave”, female genitalia A, B Epigyne C–D vulva (lactic acid treated) A, C ventral B lateral D dorsal. Unlabeled arrow in B indicates curved profile of dorsal surface of scape, in D indicates notched lateral margin of scape. Abbreviations: copulatory ducts; fertilization ducts; S spermathecae; scape. Scale bars: 0.10 mm.

Figure 9.

(Miller, Griswold & Yin, 2009) comb. nov. from Lushui Co., Daxingdi, Walayaku [cave], female genitalia A, B Epigyne C–D vulva (lactic acid treated) A, C ventral B lateral D dorsal. Unlabeled arrow in B indicates curved profile of dorsal surface of scape, in D indicates notched lateral margin of scape. Abbreviations: copulatory ducts; fertilization ducts; S spermathecae; scape. Scale bars: 0.10 mm.

(Miller, Griswold & Yin, 2009) comb. nov. from Fugong Co., Lishadi, “a nameless cave” A–C Male habitus D–F female habitus A, D dorsal B, E ventral C, F lateral. Scale bars: 0.50 mm.

Composition.

(Miller, Griswold & Yin, 2009) comb. nov., (Miller, Griswold & Yin, 2009) comb. nov.

Distribution.

Gaoligong Mountains, Yunnan, China.

Affinity with .

Lopardo and Hormiga (2015) highlighted several key morphological characteristics of and discussed their status as putative synapomorphies and utility as diagnostic characters. These observations were based on a selection of western species, but many of the characteristics discussed are consistent with . The modified spatulate seta on the PLS (Lopardo and Hormiga 2015: fig. 11G, H) is present in (Miller et al. 2009: fig. 57D, F [indicated by arrow]). The variable shape of the aciniform gland spigots on both pairs of posterior spinnerets and in both sexes (Lopardo and Hormiga 2015: fig. 11F-H, 13F, G) is visible in (Miller et al. 2009: fig. 57C–F). However, the modified seta with a long row of branches near the major ampullate gland spigot on the anterior lateral spinnerets (Lopardo and Hormiga 2015: fig. 11E, 13C, 16B) is not visible in (Miller et al. 2009: fig. 57B). The presence of macrosetae on the femora, tibiae, and metatarsi, especially on the anterior legs (Lopardo and Hormiga 2015: figs 140M, 141C), is shared by , (Miller et al. 2009: fig. 53A, B, see also text), and the kleptoparasitic clade . A roughly cylindrical palpal tibia (i.e., distal width less than two times proximal width; Lopardo and Hormiga 2015: fig. 10A) is difficult to discern in , which have the palpal tibia elongated and modified in shape compared to species (Figs 5, 8). Like , males of and have a femoral spot on femur I, a clasping spur in a proximal position on male metatarsus I (Miller et al. 2009: fig. 53A; Lopardo and Hormiga 2015: fig. 16G), and lack a tegular conductor. Also consistent across and is the presence of macrosetae on the female palpal tarsus (Miller et al. 2009: fig. 53B; Lopardo and Hormiga 2015: figs 13A, 15A). Unlike the species studied by Lopardo and Hormiga (2015: fig. 10H), species do not appear to have a deeply grooved embolic rim. As in the species studied by Lopardo and Hormiga (2015), described as having the primary cymbial conductor apically bent over the ventral side (Lopardo and Hormiga 2015: figs 10D, G, 14D), the cymbium of species has a complex, almost helical shape, with the embolus and cymbium interacting distally (Figs 5, 8; Miller et al. 2009: figs 54, 55A, B). Unlike (Lopardo and Hormiga 2015: figs 12B, 16A), where the epiandrous fusules are arranged in a dispersed row, those of are arranged in a few rough clusters (Miller et al. 2009: fig. 56D). Lopardo and Hormiga (2015: 778) report that the respiratory system of distinguishes it from other mysmenids, but this has not been investigated for .
Figure 5.

(Miller, Griswold & Yin, 2009) comb. nov. from Fugong Co., Lishadi, “a nameless cave”, male A, B, E, F Left palp C cymbium D palpal bulb G partial leg I A, E, G prolateral B, F retrolateral C prolateral D retrolateral. Abbreviations: base of cymbium; basal haematodocha; cymbial apophysis; clasping spine on leg I; cymbium; cymbial conductor; setae on cymbial fold; E embolus; paracymbium; spermatic duct; T tegulum; tibia; tibial spine on leg I; trichobothrium on tibia; setae on palpal tibia. Scale bars: 0.50 mm.

Figure 8.

(Miller, Griswold & Yin, 2009) comb. nov. from Lushui Co., Daxingdi, Walayaku [cave], male A, B, E, F Left palp C cymbium D palpal bulb G partial leg I A, E, G prolateral; B, F retrolateral; C prolateral; D retrolateral. Abbreviations: base of cymbium; basal haematodocha; cymbial apophysis; clasping spine on leh I; cymbium; cymbial conductor; setae on cymbial fold; E embolus; paracymbium; spermatic duct; T tegulum; tibia; tibial spine on leg I; trichobothria on tibia; seta on palpal tibia. Scale bars: 0.50 mm.

(Miller, Griswold & Yin, 2009) comb. nov. from Fugong Co., Lishadi, “a nameless cave”, male A, B, E, F Left palp C cymbium D palpal bulb G partial leg I A, E, G prolateral B, F retrolateral C prolateral D retrolateral. Abbreviations: base of cymbium; basal haematodocha; cymbial apophysis; clasping spine on leg I; cymbium; cymbial conductor; setae on cymbial fold; E embolus; paracymbium; spermatic duct; T tegulum; tibia; tibial spine on leg I; trichobothrium on tibia; setae on palpal tibia. Scale bars: 0.50 mm. (Miller, Griswold & Yin, 2009) comb. nov. from Fugong Co., Lishadi, “a nameless cave”, female genitalia A, B Epigyne C–D vulva (lactic acid treated) A, C ventral B lateral D dorsal. Unlabeled arrow in B indicates curved profile of dorsal surface of scape, in D indicates notched lateral margin of scape. Abbreviations: copulatory ducts; fertilization ducts; S spermathecae; scape. Scale bars: 0.10 mm. (Miller, Griswold & Yin, 2009) comb. nov. from Lushui Co., Daxingdi, Walayaku [cave], male and female A–C Male habitus D–F female habitus A, D dorsal B, E ventral C, F lateral. Scale bars: 0.50 mm. (Miller, Griswold & Yin, 2009) comb. nov. from Lushui Co., Daxingdi, Walayaku [cave], male A, B, E, F Left palp C cymbium D palpal bulb G partial leg I A, E, G prolateral; B, F retrolateral; C prolateral; D retrolateral. Abbreviations: base of cymbium; basal haematodocha; cymbial apophysis; clasping spine on leh I; cymbium; cymbial conductor; setae on cymbial fold; E embolus; paracymbium; spermatic duct; T tegulum; tibia; tibial spine on leg I; trichobothria on tibia; seta on palpal tibia. Scale bars: 0.50 mm. (Miller, Griswold & Yin, 2009) comb. nov. E8616152783D5FAB957D12C72B43096A Figs 4 , 5 , 6 , 10A
Figure 10.

Webs of spiders in the Gaoligong Mountains A (Miller, Griswold & Yin, 2009) comb. nov. from Fugong Co., Lishadi, “a nameless cave”, female B (Miller, Griswold & Yin, 2009) comb. nov. from Lushui Co., Daxingdi, Walayaku [cave], female. Red arrows indicate location of spider. Scale bars: 20.0 mm.

Material examined.

CHINA • 2♂♂, 25♀♀ multiple juveniles; Yunnan Province, Nujiang Lisu Autonomous Prefecture, Fugong County, Shiyueliang Town, Lishadi Village, 3.9 km E of Yamu River Fork, “a nameless cave”; ; 1500 m a.s.l.; 18 Aug. 2018; Y.C. Li, Y. Li, Y.F. Shu & Y.C. Lin leg.; NHMSU • 1♂; same data as for preceding; GenBank: MK908789, MK908805, MK908797, MK895530, MK895538; GlgMY14 male • 1♀; same data as for preceding; GenBank: MK908790, MK908806, MK908798, MK895531, MK895539; GlgMY14 female • 1 juvenile; same data as for preceding; GenBank: MK908791, MK908807, MK908799, MK895532, MK895540; GlgMY14 juv. • 1♂; same data as for preceding; GenBank: MK908792, MK908808, MK908800, MK895533, MK895541; GlgMY15 male • 1♀; same data as for preceding; GenBank: MK908793, MK908809, MK908801, MK895534, MK895542; GlgMY15 female. can be distinguished from its congener by having only a single proximal-dorsal trichobothrium (TTr) and a single long distal-ventral setae (TiS) on the male palpal tibia, but 2 of each in (Fig. 5A, B vs. Fig. 8A, B); and by the form of the epigyne in the female, which features a basally wider and shorter scape (Fig. 6C vs. Fig. 9C), a distinctly notched lateral margin of the scape (Fig. 6D vs. Fig. 9D), and a more strongly curved profile of the dorsal surface of the scape (Fig. 6B vs. Fig. 9B). Lateral margins of scape proximal to notches are nearly parallel in (Fig. 9C, D), converging in (Fig. 6C, D). (Miller, Griswold & Yin, 2009) comb. nov. from Lushui Co., Daxingdi, Walayaku [cave], female genitalia A, B Epigyne C–D vulva (lactic acid treated) A, C ventral B lateral D dorsal. Unlabeled arrow in B indicates curved profile of dorsal surface of scape, in D indicates notched lateral margin of scape. Abbreviations: copulatory ducts; fertilization ducts; S spermathecae; scape. Scale bars: 0.10 mm. Webs of spiders in the Gaoligong Mountains A (Miller, Griswold & Yin, 2009) comb. nov. from Fugong Co., Lishadi, “a nameless cave”, female B (Miller, Griswold & Yin, 2009) comb. nov. from Lushui Co., Daxingdi, Walayaku [cave], female. Red arrows indicate location of spider. Scale bars: 20.0 mm. Male. Somatic coloration and characters see Fig. 4A–C. Measurements: Total length 2.19. Carapace 1.13 long, 1.12 wide. Clypeus 0.26 high. Sternum 0.57 long, 0.58 wide. Abdomen 1.09 long, 1.10 wide. Length of legs: I 6.98 (2.13, 0.66, 1.77, 1.27, 1.15); II 5.92 (1.83, 0.57, 1.46, 1.12, 0.94); III 3.93 (1.28, 0.39, 0.86, 0.74, 0.66); IV 4.25 (1.42, 0.40, 0.97, 0.83, 0.63). Male palp (Fig. 5A–F): Femur long, curved mesially (Fig. 5E, F); patella elongate, with a distal-dorsal spine (Fig. 5E, F); tibia swollen, longer than patella, bears cluster of stiff dorsal setae and a dorsal trichobothrium proximally, with a long ventral setae distally (Fig. 5B: TiS). Cymbium broad, covers ventral part of bulb, dorsal part exposed (Fig. 5A–C). Paracymbium with long thick setae (Fig. 5C). Cymbial apophysis small hooked, sclerotized, on prolateral surface of cymbium (Fig. 5A–C). Cymbial conductor translucent, falcate, bearing dense cluster of long setae on prolateral face (Fig. 5C). Tegulum smooth, without process; spermatic duct long, twisted on base of embolus (Fig. 5D). Embolus long, wire-like, with proximal origin (Fig. 5B, D).

Female.

See Fig. 4D–F. Somatic characters as in male, but larger in size. Measurements: Total length 2.48. Carapace 1.12 long, 1.10 wide. Clypeus 0.25 high. Sternum 0.64 long, 0.63 wide. Abdomen 1.43 long, 1.30 wide. Length of legs: I 6.46 (1.95, 0.63, 1.65, 1.21, 1.02); II 5.55 (1.66, 0.61, 1.38, 1.05, 0.85); III 3.82 (1.22, 0.42, 0.84, 0.73, 0.61); IV 4.09 (1.44, 0.40, 0.93, 0.75, 0.57). Vulva (Fig. 6A–D): Scape relatively wide basally (Fig. 6A, C), with distinctly notched lateral margins (Fig. 6D) and strongly curved dorsal profile (Fig. 6B). Lateral margins of scape proximal to notches are converging (Fig. 6C, D). Known from a single cave in Yunnan, China.

Natural history and web architecture.

This species lives in the dark zone of the cave. They build a web typical of (e.g., Eberhard 1986, Lopardo and Hormiga 2015: fig. 147D, E). Aerial lines extend upwards from web radii and hub and are attached to frame lines or the substrate above. The web is under tension and the hub is lifted. The catching spiral is dense and nearly horizontal. Above the catching spiral is an irregular network of horizontal and angled lines under tension (Fig. 10A). The spider usually hangs in the irregular area above the catching spiral. (Miller, Griswold & Yin, 2009) comb. nov. F8BBB30A47075FA1A569B666D3BA84A9 Figs 7 , 8 , 9 , 10B CHINA • 2♂♂ 3♀♀ 2 juveniles; Yunnan Province, Nujiang Lisu Autonomous Prefecture, Lushui County, Daxingdi Town, Walayaku [cave]; ; 940 m a.s.l.; 24 June 2016; Y.C. Li leg.; NHMSU • 2♂♂ 20♀♀ multiple juveniles; same data as for preceding; 18 Aug. 2018; Y.C. Li, Y. Li, Y.F. Shu & Y.C. Lin leg.; NHMSU • 1♂; same data as for preceding; GenBank: MK908794, MK908810, MK908802, MK895535, MK895543; GlgMY16 male • 1♀; same data as for preceding; GenBank: MK908795, MK908811, MK908803, MK895536, MK895544; GlgMY16 female • 1 juvenile; same data as for preceding; GenBank: MK908796, MK908812, MK908804, MK895537, MK895545; GlgMY16 juv. See . Male. Somatic characters see Fig. 7A–C, and Miller et al. 2009: 56. Measurements: Total length 2.22. Carapace 1.10 long, 1.00 wide. Clypeus 0.25 high. Sternum 0.58 long, 0.60 wide. Abdomen 1.13 long, 0.99 wide. Length of legs: I 6.95 (2.10, 0.66, 1.79, 1.25, 1.15); II 5.88 (1.82, 0.57, 1.45, 1.12, 0.92); III 3.96 (1.31, 0.39, 0.86, 0.74, 0.66); IV 4.24 (1.42, 0.40, 0.96, 0.83, 0.63). Male palp (Fig. 8A–F): Femur long, curved mesially (Fig. 8E, F); patella elongate, with a distal-dorsal spine (Fig. 8E, F); tibia swollen, longer than patella, bearing dense stiff dorsal setae and 2 dorsal trichobothrium proximally, 2 long ventral setae distally (Fig. 8A: TiS). Cymbium broad, covers ventral part of bulb, dorsal part exposed (Fig. 8A–C). Paracymbium with long thick setae (Fig. 8C). Cymbial apophysis small hooked, sclerotized, on prolateral surface of cymbium (Fig. 8A–C). Cymbial conductor translucent, falcate, bearing dense cluster of long setae on prolateral face (Fig. 8C). Tegulum smooth, without process; spermatic duct long, twisted on base of embolus (Fig. 8D). Embolus long, wire-like, with proximal origin (Fig. 8B, D). Somatic characters see Fig. 7D–F, and Miller et al. 2009: 56. Measurements: Total length 2.48. Carapace 1.16 long, 1.12 wide. Clypeus 0.25 high. Sternum 0.64 long, 0.63 wide. Abdomen 1.43 long, 1.30 wide. Length of legs: I 6.66 (1.96, 0.64, 1.64, 1.31, 1.11); II 5.81 (1.73, 0.62, 1.36, 1.13, 0.97); III 3.98 (1.27, 0.40, 0.85, 0.78, 0.68); IV 4.69 (1.50, 0.66, 1.03, 0.85, 0.65). Vulva (Fig. 9A–D): Scape relatively narrow basally (Fig. 9A, C), with gently notched lateral margins (Fig. 9D) and moderately curved dorsal profile (Fig. 9B). Lateral margins of scape proximal to notches are nearly parallel (Fig. 9C, D). Known from a single cave in Yunnan, China. This species lives in the dark zone of the cave. The web documented in Fig. 10B resembles that of , except that it is under less tension, causing lines in the superstructure to bow. The occupant of this web was observed below the catching spiral.
  15 in total

1.  Speciation on a conveyor belt: sequential colonization of the hawaiian islands by Orsonwelles spiders (Araneae, Linyphiidae).

Authors:  Gustavo Hormiga; Miquel Arnedo; Rosemary G Gillespie
Journal:  Syst Biol       Date:  2003-02       Impact factor: 15.683

2.  MrBayes 3: Bayesian phylogenetic inference under mixed models.

Authors:  Fredrik Ronquist; John P Huelsenbeck
Journal:  Bioinformatics       Date:  2003-08-12       Impact factor: 6.937

3.  Tangled in a sparse spider web: single origin of orb weavers and their spinning work unravelled by denser taxonomic sampling.

Authors:  Dimitar Dimitrov; Lara Lopardo; Gonzalo Giribet; Miquel A Arnedo; Fernando Alvarez-Padilla; Gustavo Hormiga
Journal:  Proc Biol Sci       Date:  2011-11-02       Impact factor: 5.349

4.  Two adjacent nuclear genes are required for functional complementation of a chloroplast trans-splicing mutant from Chlamydomonas reinhardtii.

Authors:  Carsten Balczun; Astrid Bunse; Daniela Hahn; Pierre Bennoun; Jörg Nickelsen; Ulrich Kück
Journal:  Plant J       Date:  2005-09       Impact factor: 6.417

5.  Phylogenomic analysis of spiders reveals nonmonophyly of orb weavers.

Authors:  Rosa Fernández; Gustavo Hormiga; Gonzalo Giribet
Journal:  Curr Biol       Date:  2014-07-17       Impact factor: 10.834

6.  Phylogenomics resolves a spider backbone phylogeny and rejects a prevailing paradigm for orb web evolution.

Authors:  Jason E Bond; Nicole L Garrison; Chris A Hamilton; Rebecca L Godwin; Marshal Hedin; Ingi Agnarsson
Journal:  Curr Biol       Date:  2014-07-17       Impact factor: 10.834

7.  Molecular phylogenetics of the spider family Micropholcommatidae (Arachnida: Araneae) using nuclear rRNA genes (18S and 28S).

Authors:  Michael G Rix; Mark S Harvey; J Dale Roberts
Journal:  Mol Phylogenet Evol       Date:  2007-11-21       Impact factor: 4.286

8.  Estimating the Effective Sample Size of Tree Topologies from Bayesian Phylogenetic Analyses.

Authors:  Robert Lanfear; Xia Hua; Dan L Warren
Journal:  Genome Biol Evol       Date:  2016-08-16       Impact factor: 3.416

9.  Spider phylogenomics: untangling the Spider Tree of Life.

Authors:  Nicole L Garrison; Juanita Rodriguez; Ingi Agnarsson; Jonathan A Coddington; Charles E Griswold; Christopher A Hamilton; Marshal Hedin; Kevin M Kocot; Joel M Ledford; Jason E Bond
Journal:  PeerJ       Date:  2016-02-23       Impact factor: 2.984

10.  MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization.

Authors:  Kazutaka Katoh; John Rozewicki; Kazunori D Yamada
Journal:  Brief Bioinform       Date:  2019-07-19       Impact factor: 11.622

View more
  1 in total

1.  First records and three new species of the family Symphytognathidae (Arachnida, Araneae) from Thailand, and the circumscription of the genus Crassignatha Wunderlich, 1995.

Authors:  Francisco Andres Rivera-Quiroz; Booppa Petcharad; Jeremy A Miller
Journal:  Zookeys       Date:  2021-01-26       Impact factor: 1.546

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.