Literature DB >> 31370846

Epidemiological investigation of fowl adenovirus infections in poultry in China during 2015-2018.

Li Chen1, Lijuan Yin1, Qingfeng Zhou2, Peng Peng1, Yunping Du1, Linlin Liu2, Yun Zhang1, Chunyi Xue1, Yongchang Cao3.   

Abstract

BACKGROUND: Fowl adenoviruses (FAdVs) are associated with many diseases, resulting in huge economic losses to the poultry industry worldwide. Since 2015, outbreaks of FAdV infections with high mortality rates have been reported in China. A continued surveillance of FAdVs contributes to understand the epidemiology of the viruses.
RESULTS: We isolated 155 FAdV strains from diseased chickens from poultry in China between 2015 and 2018. PCR analysis determined that 123 samples were FAdV species C, 27 were FAdV species E, and five contained two different FAdV strains. The phylogenetic analysis demonstrates that these sequences of hexon regions were clustered into three distinct serotypes: FAdV-4 (79.4%, 123/155), FAdV-8a (13.5%, 21/155) and FAdV-8b (3.9%, 6/155), of which FAdV-4 was the dominant serotype in China.
CONCLUSIONS: The characterization of newly prevalent FAdV strains provides valuable information for the development of an effective control strategy for FAdV infections in chickens.

Entities:  

Keywords:  China; Epidemiology; Fowl adenovirus; Phylogenetic analysis

Mesh:

Year:  2019        PMID: 31370846      PMCID: PMC6676587          DOI: 10.1186/s12917-019-1969-7

Source DB:  PubMed          Journal:  BMC Vet Res        ISSN: 1746-6148            Impact factor:   2.741


Background

Fowl adenoviruses (FAdVs) are non-enveloped double-stranded DNA viruses with a genome of 43–45 kb in size and a diameter of 70–100 nm, belonging to the genus Aviadenovirus in the family of Adenoviridae [1]. The viruses are clustered into 5 species (FAdV-A to FAdV-E) based on restriction enzyme digest patterns, and they are further classified into 12 serotypes (FAdV-1 to 8a and 8b to 11) by cross-neutralization tests [2]. The hexon protein, as a major surface-exposed capsid structure, harbors group, type and subtype-specific antigenic determinants [3, 4]. Therefore, hexon gene is important for understanding of the genetic relations of FAdV field strains and the epidemiological status of the virus [5, 6]. FAdVs are disseminated both vertically and horizontally, and widely distributed in poultry industry throughout the world [7-9]. Most of these viruses are opportunistic pathogens and their infections are subclinical [10]. However, some FAdVs are associated with a wide range of avian diseases, including inclusion body hepatitis (IBH), hepatitis-hydropericardium syndrome (HHS) and gizzard erosion ulceration (GEU), causing substantial economic losses to poultry industry [11-13]. Each of the 12 FAdV serotypes has been related to outbreaks of IBH in chickens with 10–30% mortality [5-14]. HHS is primarily caused by the FAdV-4 serotype and causes a high mortality of 30–80% [15]. In addition, FAdV-1 and FAdV-8 strains are responsible for GEU [16, 17]. In recent years, the outbreaks of IBH and HHS showed an increasing trend in poultry industry [18, 19]. In this study, a total of 280 diagnostic samples from chicken flocks were collected from 15 provinces or cities in China from 2015 to 2018. We identified the FAdV strains using sequencing and phylogenetic analysis of the hexon genes to establish the genetic relationships of FAdV strains. These results would provide us the information on the epidemiology of FAdV infection, and provide an efficacious control strategy for FAdV infections.

Methods

Sample collection and virus isolation

From 2015 to 2018, 280 diagnostic cases were collected from commercial chicken flocks potentially affected by FAdV at ninety-six different chicken farms distributed in 15 provinces or cities in China, including Guangdong, Guangxi, Hunan, Hubei, Jiangxi, Sichuan, Chongqing, Yunnan, Zhejiang, Jiangsu, Henan, Shandong, Hebei, Tianjin and Liaoning. The epidemiological details of the positive isolates are described in Additional file 1: Table S1. Tissue samples (liver, kidney and spleen) were homogenized in phosphate buffered saline (PBS) to obtain a 10% tissue suspension. The suspensions were centrifuged at 5000×g for 10 min after three freeze-thaw cycles. The supernatants were collected, filtered through a 0.22-μm-pore-size syringe filter (Millipore, USA) and inoculated into 7-day-old specific pathogen-free (SPF) chicken embryos which were collected from the SPF Experimental Animal Center (Wens Dahuanong Biotechnology Co., Ltd., Guangdong, China) as previously described [18]. All animals used in this study were unconscious and anaesthesia was maintained with isoflurane in oxygen, and then euthanized by parenteral pentobarbitone at the end of experiment as previously described [20]. Animal experiments were approved by local institutional ethical committee to conduct experiments in chicken embryo and poultry birds as per ethical requirement.

PCR and sequencing

The presence of FAdV in each sample was confirmed by polymerase chain reaction (PCR), according to procedures described previously [21]. Viral DNAs were extracted from the harvested cultures using the MiniBEST Universal Genomic DNA Extraction Kit (TaKaRa, China), in accordance with the manufacturer’s instructions. Different serotypes of FAdVs were tested by a PCR assay, and typing primers were described in Table 1. The published primers 1–2 were used to amplify the complete hexon gene sequences of FAdV-C [19], and the primers 3–4 were used to amplify the complete hexon gene sequences of FAdV-E [22]. Samples of the expected length were sent for sequencing directly by Huada Company (Beijing, China).
Table 1

Primers used to amplify the complete hexon sequence of FAdV strain

PrimersSequence (5′-3′)Products sizeReference
1F: CGTCTAGGTTCGCACCGCCATGGC1501 bp[19]
R: CATCTGGTCGATGGACCAACGCGCACC
2F: CATCGACCAGATGGACAACGTCAACCCCTTCAAC1345 bp
R: TTACACGGCGTTGCCTGTGGCG
3F: CGAAGAGGAGACGAAAGC1942 bp[22]
R: TCCCGAGACTGGACTG
4F: TACTGCCGTTTCCACATT1431 bp
R: CGGTGTTCACGATAGCC
Primers used to amplify the complete hexon sequence of FAdV strain

Phylogenetic analysis

The nucleotide sequences of the FAdV isolates were assembled and aligned with homologous sequences via the Clustal W method using the Lasergene software (DNAStar, Madison, WI, USA). A phylogenetic tree for the hexon gene was constructed using MEGA 7.0 software by the neighbor-joining method with 1000 bootstrap replicates. 25 reference strains used in this study are summarized in Table 2.
Table 2

Fowl adenoviruse (FAdV) reference strains used in the present study

SpeciesSerotypesStrains (accession numbers)
AFAdV-1CELO(U46933), Phelps (NC001720)
BFAdV-5340 (KC493646)
CFAdV-4ON1(GU188428), KR5(HE608152), JSJ13(KM096544), HB1510(KU587519), KC (EU177545), SDXT3–15(KU877429), PB-05(EU931691), CG-D (KU647683), MX-SHP95(KP295475), Kr-Yeoju (HQ709228)
FAdV-10C-2B(KT717889)
DFAdV-2SR48(KT862806), 685(KT862805)
FAdV-3SR49(KT862807)
FAdV-9A-2A(AF083975)
FAdV-11380(KT862812)
EFAdV-6CR119(KT862808)
FAdV-7YR36(KT862809)
FAdV-8aTR59(KT862810)
FAdV-8bUPM04217(KU517714), 764(KT862811), HG (GU734104)
Fowl adenoviruse (FAdV) reference strains used in the present study

Results

Epidemiological analysis

More than 280 suspected clinical cases of IBH or HHS were examined between 2015 and 2018, and these samples were distributed in 15 provinces or cities in China, including Guangdong, Guangxi, Hunan, Hubei, Jiangxi, Sichuan, Chongqing, Yunnan, Zhejiang, Jiangsu, Henan, Shandong, Hebei, Tianjin and Liaoning (Fig. 1). The epidemiological map constructed as a result of current study depicts 280 suspected clinical cases. Among them, 155 samples (55.4%) were positive for FAdV after PCR detection. Temporal analysis showed that the number of positive samples collected from 2015 to 2018 was 10, 73, 38 and 34, respectively, and most of the positive samples were isolated in 2016 (Fig. 2a). Spatial analysis showed that FAdV strains were collected from 15 provinces or cities: 10 provinces were in southern China, and the others were in northern China. In total, 70 strains were isolated in Guangdong Province (Fig. 2b).
Fig. 1

Geographic distribution of collected FAdV samples. The samples were collected from 15 provinces or cities in China. The colours correspond to the number of collected samples

Fig. 2

Summary of isolated FAdV strains. (a) the distribution of FAdV positive samples from 2015 to 2018, (b) the distribution of FAdV positive samples in different regions, (c) FAdV serotypes and (d) the age of the affected birds and complications

Geographic distribution of collected FAdV samples. The samples were collected from 15 provinces or cities in China. The colours correspond to the number of collected samples Summary of isolated FAdV strains. (a) the distribution of FAdV positive samples from 2015 to 2018, (b) the distribution of FAdV positive samples in different regions, (c) FAdV serotypes and (d) the age of the affected birds and complications

Serotyping of FAdV isolates

Hexon gene was sequenced for all 155 positive samples with Sanger method. In 155 cases, 123 (79.4%, 123/155) of the isolates were related to FAdV-C, and 27 (17.4%, 27/155) were identified as FAdV-E, whereas 5 (3.2%, 5/155) of the cases were proven to include two different FAdV strains (FAdV-C with FAdV-E) (Fig. 2c). Phylogenetic analysis based on the hexon gene showed that these isolates were clustered into three distinct serotypes: FAdV-4 (79.4%, 123/155), FAdV-8a (13.5%, 21/155) and FAdV-8b (3.9%, 6/155), of which FAdV-4 was the dominant serotype in China. Clinical cases of FAdV-4, FAdV-8a and FAdV-8b infections happened in chickens that were 1–73 days old (average 39.1 days), 1–7 days old (average 1.7 days) and 35–45 days old (average 39.8 days) respectively, and mix infections occurred in 1-day-old chicken (Fig. 2d).

Phylogenetic analysis of FAdV isolates

The results of the phylogenetic analysis of FAdV isolated strains and reference strains are shown in Fig. 3. The FAdV strains clustered into two major groups. By computing the pairwise distance of full-length hexon coding sequence, 123 strains from species FAdV-C had 98.7–100% similarities with FAdV-4 reference strains, 21 FAdV-E strains were found to share 99.3–100% similarities with the FAdV-8a reference strains, and six FAdV-E strains possessed 98.3–99.5% identities with FAdV-8b reference strains at the nucleotide level.
Fig. 3

Phylogenetic tree based on hexon gene sequences of 155 field strains and other representative FAdV strains. The tree was constructed using MEGA 7.0 software by the neighbor-joining method (1000 replicates for bootstrap).‘’ indicate FAdV-C hexon gene sequences and‘‘indicate FAdV-E hexon gene sequences

Phylogenetic tree based on hexon gene sequences of 155 field strains and other representative FAdV strains. The tree was constructed using MEGA 7.0 software by the neighbor-joining method (1000 replicates for bootstrap).‘’ indicate FAdV-C hexon gene sequences and‘‘indicate FAdV-E hexon gene sequences

Discussion

Recently, more and more clinical cases of FAdV infection have been reported worldwide, and multiple FAdV strains have been isolated from dead or sick animals [7-23]. In addition, epidemics with mixed serotypes have been observed in different regions, for instance, FAdV-4 and -8 in Asia [10, 18, 23, 24], FAdV-2 and -8b in South Africa [25, 26], FAdV-2, -11, -7 and -8 in Europe and North America [6, 27, 28]. FAdV infections are associated with some avian diseases, such as IBH, HHS and GEU. In China, the prevalence of IBH is sporadic in chickens without resulting in a high mortality rate. However, starting from 2015, outbreaks of HHS have been reported with high mortality rates in several broiler-producing provinces in China due to new FAdV variants. Subsequently, the disease spread throughout the country and lead to tremendous economic losses to the fast-developing poultry industry [18]. FAdV hexon gene plays an important part in the molecular epidemiology and in the genetic variation of field strains. In order to prevent and control FAdV infection, it is necessary for us to further investigate the prevalence of FAdV and the molecular characteristics of the hexon genes of Chinese FAdV field strains from 2015 to 2018. In this study, the genetic epidemiology of 155 FAdV samples collected between 2015 and 2018 in China was investigated. It was previously reported that IBH and HHS mainly affected 3–5-week-old chickens, although outbreaks have occasionally occurred among layers [29, 30]. The present epidemiological survey showed that some clinical cases of FAdV infections have affected various ages of chickens and it might be caused by both horizontal and vertical transmission, although we were unable to know whether the route of transmission was horizontal or vertical in each case [18]. It also showed that FAdV infections were associated with different FAdV species in China, and at least two species of FAdVs (species C and E) were detected. In our surveillance of FAdV, IBH outbreaks have been related to FAdV-8a and FAdV-8b, and HHS cases have been related to FAdV-4. In addition, 79.4% FAdV strains were genetically related to serotype 4, proving that this serotype was dominant in China between 2015 and 2018. In a previous epidemiological survey, FAdV-11 was the predominant serotype in some regions of China from 2007 to 2014 [31]. Thus, it is necessary for us to further investigate the prevalence of FAdV, and understand the genetic epidemiology of viruses associated with IBH and HHS. In our survey, five cases were detected with mixed infections of FAdV strains (FAdV-C with FAdV-E), which confirmed that mixed infections with different FAdV serotypes could happen in the same bird as previously reported [18, 27]. The possible reason for this was that commercial chickens often transmitted vertically and horizontally by fecal route. In this case, multiple infections might occur in a chicken flock due to the reactivation of latent infection virus. So far, it is ambiguous whether mixed infections of adenovirus could aggravate the severity of the clinical diseases [18]. In fact, the control and prevention of disease often centered on the primary epidemic viral serotypes and ignored previous mixed infection of FAdV, this may result in outbreaks of other serotypes in China. Thus, mixed infection of FAdV with multiple serotypes will be a big challenge to prevent and control the disease.

Conclusions

Fowl adenoviruses (FAdVs) have a worldwide distribution and are associated with a variety of diseases, causing huge economic losses to the poultry industry. In this study, we isolated 155 FAdV strains from diseased chickens from poultry in China between 2015 and 2018, and investigated the molecular characteristics by performing phylogenetic analyses based on the hexon genes. It showed that these isolates were clustered into three distinct serotypes: FAdV-4 (79.4%, 123/155), FAdV-8a (13.5%, 21/155) and FAdV-8b (3.9%, 6/155), of which FAdV-4 was the dominant serotype in China. Taken together, these results provided us a clear landscape of genetic epidemiology of FAdV circulating in China during 2015–2018 and would help us for the FAdV prevention. Table S1. Epidemiological findings of flocks that were positive for FAdV. (DOC 404 kb)
  13 in total

1.  Molecular detection of fowl adenovirus 7 from slaughtered broiler chickens in Iran: the first report.

Authors:  H Hosseini; H Najafi; M H Fallah Mehrabadi; B Gholamian; S Noroozi; M Ahmadi; Z Ziafati Kafi; N Sadri; A Hojabr Rajeoni; A Ghalyanchilangeroudi
Journal:  Iran J Vet Res       Date:  2021       Impact factor: 1.376

2.  Probiotics Surface-Delivering Fiber2 Protein of Fowl Adenovirus 4 Stimulate Protective Immunity Against Hepatitis-Hydropericardium Syndrome in Chickens.

Authors:  Zhipeng Jia; Xinghui Pan; Wenjing Zhi; Hang Chen; Bingrong Bai; Chunli Ma; Dexing Ma
Journal:  Front Immunol       Date:  2022-06-28       Impact factor: 8.786

3.  No Genus-Specific Gene Is Essential for the Replication of Fowl Adenovirus 4 in Chicken LMH Cells.

Authors:  Xinglong Liu; Xiaohui Zou; Wenfeng Zhang; Xiaojuan Guo; Min Wang; Yingtao Lv; Tao Hung; Zhuozhuang Lu
Journal:  Microbiol Spectr       Date:  2022-05-31

4.  An efficient peptide-based ELISA for differentiating fowl adenovirus 4-infected chickens from vaccinated chickens.

Authors:  Songhua Xie; Qiuping Shen; Wei Zhang; Weikang Wang; Quan Xie; Tuofan Li; Zhimin Wan; Hongxia Shao; Aijian Qin; Jianqiang Ye
Journal:  J Vet Diagn Invest       Date:  2021-04-15       Impact factor: 1.279

5.  First Detection and Identification of FAdV-8b as the Causative Agent of an Outbreak of Inclusion Body Hepatitis in a Commercial Broiler Farm in Greece.

Authors:  Vasileios Tsiouris; Tilemachos Mantzios; Konstantinos Kiskinis; Jean-Luc Guérin; Guillaume Croville; Georgia D Brellou; Emmanouela P Apostolopoulou; Evanthia J Petridou; Ioanna Georgopoulou
Journal:  Vet Sci       Date:  2022-03-25

6.  User-Friendly Reverse Genetics System for Modification of the Right End of Fowl Adenovirus 4 Genome.

Authors:  Bingyu Yan; Xiaohui Zou; Xinglong Liu; Jiaming Zhao; Wenfeng Zhang; Xiaojuan Guo; Min Wang; Yingtao Lv; Zhuozhuang Lu
Journal:  Viruses       Date:  2020-03-11       Impact factor: 5.048

7.  Characterisation of adenovirus strains represented species B and E isolated from broiler chicken flocks in eastern Poland.

Authors:  Jowita Samanta Niczyporuk; Wojciech Kozdrun; Hanna Czekaj; Karolina Piekarska; Natalia Stys-Fijol
Journal:  Heliyon       Date:  2021-02-17

Review 8.  Historical Investigation of Fowl Adenovirus Outbreaks in South Korea from 2007 to 2021: A Comprehensive Review.

Authors:  Jongseo Mo
Journal:  Viruses       Date:  2021-11-10       Impact factor: 5.048

9.  A 10-Year Retrospective Study of Inclusion Body Hepatitis in Meat-Type Chickens in Spain (2011-2021).

Authors:  Kateri Bertran; Angela Blanco; Noelia Antilles; Miquel Nofrarías; Rosa M Valle; Àlex Cobos; Antonio Ramis; Mar Biarnés; Natàlia Majó
Journal:  Viruses       Date:  2021-10-28       Impact factor: 5.048

10.  Research Note: Molecular relationship of the fowl adenovirus serotype 4 isolated from the contaminated live vaccine and wild strains isolated in China, 2013-2018.

Authors:  Qi Su; Lidan Hou; Yuan Gao; Xiaofeng Liu; Zhizhong Cui; Shuang Chang; Peng Zhao
Journal:  Poult Sci       Date:  2020-09-12       Impact factor: 3.352

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.