Literature DB >> 33248579

Research Note: Molecular relationship of the fowl adenovirus serotype 4 isolated from the contaminated live vaccine and wild strains isolated in China, 2013-2018.

Qi Su1, Lidan Hou2, Yuan Gao1, Xiaofeng Liu1, Zhizhong Cui1, Shuang Chang1, Peng Zhao3.   

Abstract

Since June 2013, hydropericardium-hepatitis syndrome caused by putative novel fowl adenovirus 4 (FAdV-4) infection has spread all over China, leading to great economic losses. Previous study found that the use of attenuated vaccines contaminated with FAdV-4 is likely to be an important cause of such large-scale transmission. Here, we sequenced the whole genome of this strain through the next-generation sequencing and carried out a retrospective analysis of the FAdV-4 strains that have been determined in China recently. Results show the vaccine strain was almost 100% identical with wild virus strains, especially with 4 strains considering the difference of the GA repeat region, further linking the relationship between vaccine contamination and FAdV-4 prevalence in China. Meanwhile, there is no time and regional preference for the emergence of FAdV-4 strains with different molecular characteristics in China, which indicates that there may be multiple routes of transmission of this virus, suggesting that we still need to pay more attention to and formulate correct prevention and control in the future.
Copyright © 2020. Published by Elsevier Inc.

Entities:  

Keywords:  FAdV-4; inclusion body hepatitis-hydropericardium syndrome; vaccine contamination; whole genome

Mesh:

Substances:

Year:  2020        PMID: 33248579      PMCID: PMC7704713          DOI: 10.1016/j.psj.2020.08.063

Source DB:  PubMed          Journal:  Poult Sci        ISSN: 0032-5791            Impact factor:   3.352


Introduction

Since June 2013, hydropericardium-hepatitis syndrome (HHS) caused by fowl adenovirus 4 (FAdV-4) has appeared in many provinces of China, posing a huge threat to poultry industry (Zhang et al., 2016; Pan et al., 2017; Chen et al., 2019). Fowl adenovirus 4 mainly infects 20- to 30-day-old broilers and causes a mortality rate ranging from 20 to 80% (Meng et al., 2019). Analysis showed that the pathogenicity of this epidemic strain was significantly higher than that of previous isolates, and there were distinct mutations in its genome, especially in the genes of fiber-2 and hexon, which were subsequently identified as closely related to the increased virulence (Liu et al., 2016; Ye et al., 2016; Li et al., 2018; Zhang et al., 2018). However, it is still not clear how the strain spread in China at an incredible fast speed. Previous studies have shown that the use of attenuated vaccines contaminated with FAdV-4 may be an important reason for the outbreak of HHS in some flocks (Su et al., 2018a,b). However, the complete genome of the vaccine-contaminated strain is not provided, which hinders the further determination of its relationship with other identified strains. Therefore, this study sequenced the above-mentioned FAdV-4 isolate and compared it with other strains isolated from 2013 to 2018, which showed almost 100% consistency among them, verifying our previous reasoning again.

Materials and methods

Virus Background

The FAdV-4 strain (F-Vac) used in this study was isolated from a Newcastle disease virus attenuated vaccine and stored in our laboratory at −80°C, and it can induce obvious HHS in specific-pathogen-free chicken (Su et al., 2018a,b). Detailed isolation and identification procedures can be found in the previous report (Su et al., 2018a). Phylogenetic analysis based on the partial hexon gene has demonstrated that this isolate belongs to FAdV-4 (Su et al., 2018a).

DNA Extraction and Sequencing

DNA was extracted from 1 mL of virus sample using a commercial kit (Bio-Tek, Norcross, GA). Total DNA was resuspended in 50 μL DNase-, RNase-, and proteinase-free water and then sequenced by next-generation sequencing (NGS) with the Illumina MiSeq. Then, all reads were processed through the quality trimming using FastQC to remove nontarget reads with similarities to chicken genome. First, the adapter-jointed reads were removed by the Trimmomatic with parameters of “forward-AGATCGGAAGAGCACACGTCTGAAC” and “reverse- AGATCGGAAGAGCGTCGTGTAGGGA”. Then, all reads were searched for the similar sequences in the NCBI via BLASTN, and those sharing great similarity with chicken were considered as the nontarget and removed, while the rest of the clean reads were de novo assembled using CLC genomic workbench, V7.5, software (QIAGEN, Boston, MA). Gapfiller was used to make up gap for the contig, and PrinSeS-G was used to correct the clip errors and the insertion of small fragments. Sequencing and analysis are performed twice independently to avoid any possible errors.

Genome Analysis

The genome of F-Vac isolated in China from 2013 was downloaded from GenBank, and the detailed information about these strains was recorded for analysis. Multiple alignments were carried out using ClustalX (BioEdit, version 7.0) and BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi). The sequences obtained in this study were deposited to the GenBank, and the NGS raw data was deposited to the NCBI.

Results

NGS and Raw Data Analysis

This study yielded 3,369 Mb of fastq format sequence data, which contain 47,355,126 reads. The Q30 bases ratio was 93.11%, demonstrating that the sequencing was effective and the data were reliable. After deleting nontarget reads, a total of 45,699,670 clean reads were finally generated and then used for de novo assembling. Meanwhile, contamination assessment showed that the data obtained do not contain any fragments of other virus, which shows that the method we established before to isolate exogenous virus from contaminated vaccine is reliable (Su et al., 2018a).

Whole-Genome Sequence Analysis

After de novo assembly, the whole genome of F-Vac was successfully obtained, which is 43,723 in length and has been deposited in GenBank with the accession number MT119964. The C + G content for that is 54.87%, similar to other F-Vac (Liu et al., 2016). Meanwhile, in this study, 34 full-genome sequences of FAdV-4 isolated in China from 2013 to 2018 were retrieved from the NCBI database and used for the following analysis, and details about those strains can be found in Table 1.
Table 1

Background information and characteristics of FAdV-4 strains in China.

Strain nameGenBank No.TimeLocationIdentity1 (%)GA repeatTC repeat
F-VacMT1199642015HebeiGAGAGAGAGAGAGAGAACCTCTCTCTCTCTCTTG
JSJ13KM0965442013Jiangsu99.89GAGAGAGAGAGAGAGAACCTCTCTCTCTCTCTTG
HLJFAd15KU9917972015Heilongjiang99.99GAGAGAGAGAGAGAGAACCTCTCTCTCTCTCTTG
ZJ2015MF5216112015Zhejiang99.99GAGAGAGAGAGAGAGAACCTCTCTCTCTCTTG
NIVD2MG547384201799.99GAGAGAGAGAGAGAGAACCTCTCTCTCTCTCTTG
HLJDAD15KX5389802015Heilongjiang99.99GAGAGAGAGAGAGAGAGAACCTCTCTCTCTCTCTTG
CHSXCZ2015KU5587622015Sichuan99.99GAGAGAGAGAGAGAGAGAACCTCTCTCTCTCTCTTG
CHAHMC2015MG1483352015Anhui99.99GAGAGAGAGAGAGAGAGAACCTCTCTCTCTCTCTTG
SD1511MF4960372015Shandong99.99GAGAGAGAGAGAGAGAGAACCTCTCTCTCTCTCTTG
CHAHBZ2015KU5692952015Anhui99.98GAGAGAGAGAGAGAGAGAACCTCTCTCTCTCTCTTG
HN1501KX4214032015Henan99.99GAGAGAGAGAGAGAGAGAACCTCTCTCTCTCTCTTG
SD1501KX4214042015Shandong99.99GAGAGAGAGAGAGAGAGAACCTCTCTCTCTCTCTTG
HB1502KX4214012015Hebei99.99GAGAGAGAGAGAGAGAGAACCTCTCTCTCTCTCTTG
HB1510KU5875192016Hubei99.99GAGAGAGAGAGAGAGAGAACCTCTCTCTCTCTCTTG
HLJ160826KY5694222016Heilongjiang99.97GAGAGAGAGAGAGAGAGAACCTCTCTCTCTCTCTCTTG
SCnj1601KY9279382016Sichuan99.96GAGAGAGAGAGAGAGAGAACCTCTCTCTCTCTCTTG
GX-1MH4545982018Guangxi99.99GAGAGAGAGAGAGAGAGAACCTCTCTCTCTCTCTTG
CHJSTCZHP2015MG8247452015Jiangsu99.98GAGAGAGAGAGAGAGAGAGAACCTCTCTCTCTCTTG
CHJSXZ2015KU5692962015Jiangsu99.98GAGAGAGAGAGAGAGAGAGAACCTCTCTCTCTCTCTTG
SDSX1KY6364002015Shandong99.98GAGAGAGAGAGAGAGAGAGAACCTCTCTCTCTCTCTTG
HLJ151118KX0617502015Heilongjiang99.96GAGAGAGAGAGAGAGAGAGAACCTCTCTCTCTCTCTTG
HN151025KU2455402015Henan99.96GAGAGAGAGAGAGAGAGAGAACCTCTCTCTCTCTCTTG
GDMZMG8569542016Guangdong99.99GAGAGAGAGAGAGAGAGAGAACCTCTCTCTCTCTCTTG
SD1601/FADV-4MH0066022016Shandong99.99GAGAGAGAGAGAGAGAGAGAACCTCTCTCTCTCTCTTG
AQKY436520201699.98GAGAGAGAGAGAGAGAGAGAACCTCTCTCTCTCTCTTG
JS7KY4365192016Jiangsu99.97GAGAGAGAGAGAGAGAGAGAACCTCTCTCTCTCTCTTG
HNKY3790352016Henan99.97GAGAGAGAGAGAGAGAGAGAACCTCTCTCTCTCTCTTG
CHGDYF201706MK3870622017Guangdong99.99GAGAGAGAGAGAGAGAGAGAACCTCTCTCTCTCTCTTG
SCDYMK6295232018Sichuan99.57GAGAGAGAGAGAGAGAGAGAACCTCTCTCTCTCTCTTG
CHSDDZ2015KU5587612015Shandong99.97GAGAGAGAGAGAGAGAGAGAGAACCTCTCTCTCTCTCTTG
CHHNJZ2015KU5587602015Henan99.97GAGAGAGAGAGAGAGAGAGAGAACCTCTCTCTCTCTCTTG
HN151029KX0904242015Henan99.98GAGAGAGAGAGAGAGAGAGAGAACCTCTCTCTCTCTCTTG
ZZMN3373222016Henan99.98GAGAGAGAGAGAGAGAGAGAGAACCTCTCTCTCTCTCTTG
AH712KY4365222016Anhui99.97GAGAGAGAGAGAGAGAGAGAGAACCTCTCTCTCTCTCTTG
AH726KY4365232016Anhui99.97GAGAGAGAGAGAGAGAGAGAGAACCTCTCTCTCTCTCTTG

Abbreviation: FAdV-4, fowl adenovirus 4.

Indicates the identity between F-Vac and reference.

Background information and characteristics of FAdV-4 strains in China. Abbreviation: FAdV-4, fowl adenovirus 4. Indicates the identity between F-Vac and reference. Homology analysis showed that the F-Vac shares 99.57 to 99.99% identities with 34 references (Table 1), and the fiber-2 and Hexon genes of all these strains are 100% identical (data not shown), indicating this strain isolated from the contaminated vaccine was highly consistent with that from the wild. However, alignment analysis of these whole genomes revealed the differences between these strains, which can be used for the classification of epidemic strains. Briefly, 4 different types (8–11 GAs) of GA repeats were found in these 35 strains, while F-vac and 4 reference strains [JSJ13/KM096544 (Zhao et al., 2015), HLJFAd15/KU991797 (Pan et al., 2017), ZJ2015/MF521611, and NIVD2/MG547384] belong to the same type (8 GAs), but these different types of strains have no clear regularity with the time and place of isolation (Table 1). Besides, 3 different types (5–7 TCs) of TC repeats were also found, but only 3 strains were different from the others that contain 6 TCs, including F-Vac (Table 1).

Discussion

Fowl adenovirus 4 has been epidemic in China for a long time since June 2015, causing severe HHS in poultry and leading to great economic losses (Li et al., 2017). A lot of research works show that a novel type of FAdV-4 is the cause of this long-term infection, which contains various genomic deletions and multiple distinct amino-acid mutations in their major structural genes, such as fiber-2 and hexon (Liu et al., 2016; Jiang et al., 2019). Furthermore, mutations in these 2 genes were identified as closely related with the increased pathogenicity (Zhang et al., 2018), leading to a 20 to 80% mortality rate (Ren et al., 2019; Wang and Zhao, 2019). Meanwhile, previous studies identified that the using of live vaccines contaminated with FAdV-4 and chicken infectious anemia virus may be the cause of infection in certain flocks, and the copathogenicity of them should be responsible for up to 80% mortality (Su et al., 2018a). However, it has not provided the whole genome of the FAdV-4 contaminated in the vaccine, which makes it difficult to further identify the relationship between it and wild strains. Therefore, in this study, the whole genome of the strain was determined and analyzed with other strains isolated in China. Analysis showed that the whole genome of all 35 F-Vac isolated from China is highly consistent, especially the fiber-2 and hexon genes related to increased pathogenicity (Zhang et al., 2018), with 100% identity. However, it is worth noting that these strains are not exactly the same, and they can be divided into 4 types according to the differences of GA repeat fragments. Among them, 4 reference strains are consistent with the contaminated strains in the vaccine, indicating that they are more closely related. Above results suggested that we can preliminarily screen the possibility that whether the FAdV-4 comes from above vaccine contamination or related wild strains by sequencing such molecular marker when chickens are infected. On the other hand, different types of FAdV-4 have been isolated in any year from 2013 to 2018, and these viruses have no regional preference, showing that the differences in the GA regions are not gradually emerging with evolution, but multiple types are spreading together (Table 1). Therefore, there may be multiple infectious sources and transmission routes in the prevalence of FAdV-4 in China, which deserves our attention and further study. Meanwhile, as the genome of FAdV-4 circulating in China is highly consistent, except for the GA repeat region, it is necessary to determine the effect of different lengths of the GA repeat on its biological characteristics, which is very important to understand the pathogenesis of FAdV-4. In conclusion, this study provided the whole-genome sequence of an F-Vac isolated from contaminated attenuated vaccine and further linked it with 4 wild strains, showing a close relationship between them. Meanwhile, this study also reviewed all the F-Vac isolated in China from 2013 to 2018, which clarified the similarities and differences between them, laying a foundation for the formulation of reasonable prevention and control measures against it in the future.

Disclosures

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
  15 in total

1.  Pathogenicity of a fowl adenovirus serotype 4 isolated from chickens associated with hydropericardium-hepatitis syndrome in China.

Authors:  Guangcai Ren; Han Wang; Yuanyuan Yan; Fan Liu; Miaorong Huang; Ruiai Chen
Journal:  Poult Sci       Date:  2019-07-01       Impact factor: 3.352

2.  Newcastle disease virus-attenuated vaccine co-contaminated with fowl adenovirus and chicken infectious anemia virus results in inclusion body hepatitis-hydropericardium syndrome in poultry.

Authors:  Qi Su; Yang Li; Fanfeng Meng; Zhizhong Cui; Shuang Chang; Peng Zhao
Journal:  Vet Microbiol       Date:  2018-03-17       Impact factor: 3.293

3.  Pathogenicity and Complete Genome Characterization of Fowl Adenoviruses Isolated from Chickens Associated with Inclusion Body Hepatitis and Hydropericardium Syndrome in China.

Authors:  Jing Zhao; Qi Zhong; Ye Zhao; Yan-xin Hu; Guo-zhong Zhang
Journal:  PLoS One       Date:  2015-07-13       Impact factor: 3.240

4.  Genetic characterization of novel fowl aviadenovirus 4 isolates from outbreaks of hepatitis-hydropericardium syndrome in broiler chickens in China.

Authors:  Yanke Liu; Wenyan Wan; Dongsheng Gao; Yongtao Li; Xia Yang; Hongying Liu; Huixia Yao; Lu Chen; Chuanqing Wang; Jun Zhao
Journal:  Emerg Microbes Infect       Date:  2016-11-23       Impact factor: 7.163

5.  Different Dynamic Distribution in Chickens and Ducks of the Hypervirulent, Novel Genotype Fowl Adenovirus Serotype 4 Recently Emerged in China.

Authors:  Qing Pan; Yanchao Yang; Zhibin Shi; Linlin Liu; Yulong Gao; Xiaole Qi; Changjun Liu; Yanping Zhang; Hongyu Cui; Xiaomei Wang
Journal:  Front Microbiol       Date:  2017-06-06       Impact factor: 5.640

6.  Pathogenicity and molecular characterization of a fowl adenovirus 4 isolated from chicken associated with IBH and HPS in China.

Authors:  Limin Li; Jianchang Wang; Ping Chen; Shan Zhang; Jiguo Sun; Wanzhe Yuan
Journal:  BMC Vet Res       Date:  2018-12-14       Impact factor: 2.741

7.  Identification, Pathogenicity of Novel Fowl Adenovirus Serotype 4 SDJN0105 in Shandong, China and Immunoprotective Evaluation of the Newly Developed Inactivated Oil-emulsion FAdV-4 Vaccine.

Authors:  Kai Meng; Xiaoyuan Yuan; Jiang Yu; Yuxia Zhang; Wu Ai; Youling Wang
Journal:  Viruses       Date:  2019-07-08       Impact factor: 5.048

Review 8.  Pathogenesis of Hypervirulent Fowl Adenovirus Serotype 4: The Contributions of Viral and Host Factors.

Authors:  Zeng Wang; Jun Zhao
Journal:  Viruses       Date:  2019-08-12       Impact factor: 5.048

9.  Outbreaks of serotype 4 fowl adenovirus with novel genotype, China.

Authors:  Jianqiang Ye; Guangchen Liang; Jianjun Zhang; Weikang Wang; Na Song; Ping Wang; Wenlv Zheng; Quan Xie; Hongxia Shao; Zhimin Wan; Chengming Wang; Hongjun Chen; Wei Gao; Aijian Qin
Journal:  Emerg Microbes Infect       Date:  2016-05-25       Impact factor: 7.163

10.  Newcastle disease virus-attenuated vaccine LaSota played a key role in the pathogenicity of contaminated exogenous virus.

Authors:  Qi Su; Yang Li; Yawen Zhang; Zhihui Zhang; Fanfeng Meng; Zhizhong Cui; Shuang Chang; Peng Zhao
Journal:  Vet Res       Date:  2018-08-06       Impact factor: 3.683

View more
  4 in total

1.  Genomic Characterization of CIAV Detected in Contaminated Attenuated NDV Vaccine: Epidemiological Evidence of Source and Vertical Transmission From SPF Chicken Embryos in China.

Authors:  Yan Li; Jinjin Wang; Longfei Chen; Qun Wang; Meng Zhou; Hui Zhao; Zengna Chi; Yixin Wang; Shuang Chang; Peng Zhao
Journal:  Front Vet Sci       Date:  2022-07-06

2.  Emergence of fowl aviadenovirus C-4 in a backyard chicken flock in California.

Authors:  Aslı Mete; Anibal G Armien; Daniel Rejmanek; Meghan Mott; Beate M Crossley
Journal:  J Vet Diagn Invest       Date:  2021-06-04       Impact factor: 1.569

3.  Genomic Characteristics of a Chicken Infectious Anemia Virus in Contaminated Attenuated Vaccine.

Authors:  Longfei Chen; Qi Su; Yan Li; Jinjin Wang; Yawen Zhang; Shuang Chang; Yixin Wang; Peng Zhao
Journal:  Front Vet Sci       Date:  2022-06-16

4.  A Single Amino Acid at Residue 188 of the Hexon Protein Is Responsible for the Pathogenicity of the Emerging Novel Virus Fowl Adenovirus 4.

Authors:  Yu Zhang; Aijing Liu; Yanan Wang; Hongyu Cui; Yulong Gao; Xiaole Qi; Changjun Liu; Yanping Zhang; Kai Li; Li Gao; Qing Pan; Xiaomei Wang
Journal:  J Virol       Date:  2021-08-10       Impact factor: 5.103

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.