Inactivation of the endosomal sorting complex required for transport (ESCRT) machinery has been reported to cause autophagic defects, but the exact functions of ESCRT proteins in macroautophagy/autophagy remain incompletely understood. Using live-cell fluorescence microscopy we found that the filament-forming ESCRT-III subunit CHMP4B was recruited transiently to nascent autophagosomes during starvation-induced autophagy and mitophagy, with residence times of about 1 and 2 min, respectively. Correlative light microscopy and electron tomography revealed CHMP4B recruitment at a late step in mitophagosome formation. The autophagosomal dwell time of CHMP4B was strongly increased by depletion of the regulatory ESCRT-III subunit CHMP2A. Using a novel optogenetic closure assay we observed that depletion of CHMP2A inhibited phagophore sealing during mitophagy. Consistent with this, depletion of CHMP2A and other ESCRT-III subunits inhibited both PRKN/PARKIN-dependent and -independent mitophagy. We conclude that the ESCRT machinery mediates phagophore closure, and that this is essential for mitophagic flux.Abbreviations: BSA: bovine serum albumin; CHMP: chromatin-modifying protein; CLEM: correlative light and electron microscopy; EGFP: enhanced green fluorescent protein; ESCRT: endosomal sorting complex required for transport; HEPES: 2-[4-(2-hydroxyethyl)piperazin-1-yl]ethanesulfonic acid; HRP: horseradish peroxidase; ILV: intralumenal vesicle; MAP1LC3/LC3: microtubule-associated protein 1 light chain 3; LOV2: light oxygen voltage 2; MLS: mitochondrial localization sequence; MT-CO2: mitochondrially encoded cytochrome c oxidase II; O+A: oligomycin and antimycin A; PBS: phosphate-buffered saline; PIPES: piperazine-N,N-bis(2-ethanesulfonic acid); PRKN/PARKIN: parkin RBR E3 ubiquitin protein ligase; RAB: RAS-related in brain; SD: standard deviation; SEM: standard error of the mean; TOMM20: TOMM20: translocase of outer mitochondrial membrane 20; VCL: vinculin; VPS4: vacuolar protein sorting protein 4; Zdk1: Zdark 1; TUBG: Tubulin gamma chain.
Inactivation of the endosomal sorting complex required for transport (ESCRT) machinery has been reported to cause autophagic defects, but the exact functions of ESCRT proteins in macroautophagy/autophagy remain incompletely understood. Using live-cell fluorescence microscopy we found that the filament-forming ESCRT-III subunit CHMP4B was recruited transiently to nascent autophagosomes during starvation-induced autophagy and mitophagy, with residence times of about 1 and 2 min, respectively. Correlative light microscopy and electron tomography revealed CHMP4B recruitment at a late step in mitophagosome formation. The autophagosomal dwell time of CHMP4B was strongly increased by depletion of the regulatory ESCRT-III subunit CHMP2A. Using a novel optogenetic closure assay we observed that depletion of CHMP2A inhibited phagophore sealing during mitophagy. Consistent with this, depletion of CHMP2A and other ESCRT-III subunits inhibited both PRKN/PARKIN-dependent and -independent mitophagy. We conclude that the ESCRT machinery mediates phagophore closure, and that this is essential for mitophagic flux.Abbreviations: BSA: bovine serum albumin; CHMP: chromatin-modifying protein; CLEM: correlative light and electron microscopy; EGFP: enhanced green fluorescent protein; ESCRT: endosomal sorting complex required for transport; HEPES: 2-[4-(2-hydroxyethyl)piperazin-1-yl]ethanesulfonic acid; HRP: horseradish peroxidase; ILV: intralumenal vesicle; MAP1LC3/LC3: microtubule-associated protein 1 light chain 3; LOV2: light oxygen voltage 2; MLS: mitochondrial localization sequence; MT-CO2: mitochondrially encoded cytochrome c oxidase II; O+A: oligomycin and antimycin A; PBS: phosphate-buffered saline; PIPES: piperazine-N,N-bis(2-ethanesulfonic acid); PRKN/PARKIN: parkin RBR E3 ubiquitin protein ligase; RAB: RAS-related in brain; SD: standard deviation; SEM: standard error of the mean; TOMM20: TOMM20: translocase of outer mitochondrial membrane 20; VCL: vinculin; VPS4: vacuolar protein sorting protein 4; Zdk1: Zdark 1; TUBG: Tubulin gamma chain.
The endosomal sorting complex required for transport (ESCRT) machinery mediates various membrane scission events within cells and seems to be dedicated to scission of small cytosol-containing double-membrane openings [1-3]. Examples include formation of intraluminal vesicles (ILVs) in endosomes [4], daughter cell abscission during cytokinesis [5], sealing of the newly formed nuclear envelope [6,7], and repair of damaged plasma membrane [8], nuclear envelope [9,10], and lysosomes [11,12]. One of the less understood functions of this machinery is its involvement in macroautophagy/autophagy, although several studies in various cell lines and model organisms have shown that interference with ESCRT functions causes accumulation of autophagic structures [13-18] (see also Figure S1).The ESCRT machinery consists of 4 subcomplexes termed ESCRT-0, ESCRT-I, ESCRT-II, and ESCRT-III, the latter regulated by the ATPase VPS4 [1-3]. Whereas interference with ESCRT-0 has a rather minor effect on autophagy, depletion of either ESCRT-I, ESCRT-II or ESCRT-III components causes a profound accumulation of autophagic structures [14,15,17]. The same is the case upon depletion of VPS4 or expression of a dominant-negative VPS4 mutant [13,18]. The most prominent phenotypes have been reported upon ESCRT-III and VPS4 interference, suggesting that these are the most important ESCRTs in autophagy.Four alternative, not mutually exclusive, functions for ESCRTs in autophagy have been proposed [19]: 1) Regulation of pro-autophagic signalling, 2) fusion of autophagosomes with endosomes or lysosomes, 3) lysosome biogenesis, and 4) closure of the autophagosome. Although there are compelling arguments for implicating the ESCRT machinery in regulation of signalling and autophagosome fusion [14-16], closure of the autophagosome bears closest topological resemblance to the canonical functions of the ESCRT machinery [20], and a recent paper indicates that ESCRTs may close the nascent autophagosome during starvation-induced autophagy [21].We have therefore monitored the dynamic recruitment of an ESCRT-III subunit to the nascent autophagosome during starvation-induced autophagy and mitophagy. We find that ESCRT-III is indeed recruited during a late stage of autophagosome or mitophagosome formation, with kinetics similar to those of ILV formation, and that interference with ESCRT-III functions inhibits mitophagosome closure and mitophagic flux.
Results
The ESCRT-III subunit CHMP4B is recruited to autophagosomes during starvation
To visualize nascent autophagosomes, we used LC3B as an autophagic marker [22,23], tagged with the pH-sensitive red-fluorescent protein pHuji [24]. We chose pHuji as fluorescent tag because its fluorescence will be quenched in the acidic lumen of the autolysosome, thus minimizing signal from autolysosomes. We generated stable retinal pigment epithelial cell (RPE-1) transfectants with low-level expression of pHuji-LC3B. Live cell imaging of these cells showed that numerous pHuji-LC3B positive structures were formed upon amino acid and serum starvation (Figure 1A–C), and there was an increase in lipidated pHuji-LC3B upon starvation (Figure S2). As expected, inhibition of autolysosomal acidification with ammonium chloride led to a profound increase in pHuji-LC3B positive structures (Figure 1D), consistent with the idea that pHuji-LC3B localizes to both autophagosomes and autolysosomes and that fluorescence is quenched in the latter when acidification is allowed to proceed.
Figure 1.
pHuji-LC3B as autophagic marker. RPE-1 pHuji-LC3B stable transfectants were incubated with pre-warmed Live Cell Imaging Solution without amino acids for starvation and subjected to live cell fluorescence imaging using an OMX widefield microscope with red filter settings (excitation 568 nm, emission 609/37 nm). Images were recorded during starvation (A) and every 7 min, with images at 21 min (B) and 70 min (C) shown. After 70 min, NH4Cl was added to a final concentration of 10 mM (D). Note the large number of structures that become fluorescent after NH4Cl addition. The imaging series is representative of 37 independent recordings.
pHuji-LC3B as autophagic marker. RPE-1 pHuji-LC3B stable transfectants were incubated with pre-warmed Live Cell Imaging Solution without amino acids for starvation and subjected to live cell fluorescence imaging using an OMX widefield microscope with red filter settings (excitation 568 nm, emission 609/37 nm). Images were recorded during starvation (A) and every 7 min, with images at 21 min (B) and 70 min (C) shown. After 70 min, NH4Cl was added to a final concentration of 10 mM (D). Note the large number of structures that become fluorescent after NH4Cl addition. The imaging series is representative of 37 independent recordings.To monitor ESCRT recruitment to nascent pHuji-LC3B-containing autophagosomes, pHuji-LC3B-expressing RPE-1 cells were stably co-transfected at close to endogenous level with an EGFP-tagged version of CHMP4B (Figure S2), the main constituent of ESCRT-III oligomers, a construct that has previously been used for monitoring ESCRT recruitment to various other cellular membranes [6,8,12,25]. Because CHMP4B is recruited to endosomes during formation of intraluminal vesicles [26], and because endosomes fuse with autophagosomes to form amphisomes [27], we found it important to distinguish between CHMP4B recruitment to phagophores and amphisomes. Initial experiments using Alexa Fluor 647-tagged EGF (epidermal growth factor) or dextran failed to yield sufficiently strong labelling of the entire endocytic pathway (data not shown), and we therefore engineered RPE-1 cells with tagged early- and late-endosomal markers. For this purpose we co-expressed SNAP-tagged [28] versions of the early endosomal GTPase RAB5 and the late-endosomal GTPase RAB7 [29], expressed from the same weak promoter (Figure S2). RAB5 and RAB7 could thus be visualized by adding the fluorescent SNAP substrate SNAP-Cell 647-SiR to the cells. Thus, by studying triple-transfected RPE-1 cells we would be able to monitor CHMP4B recruitment specifically to nascent autophagosomes and not to early or late amphisomes, or autolysosomes.To monitor a possible CHMP4B recruitment to newly formed autophagosomes, RPE-1 cells expressing CHMP4B-EGFP, pHuji-LC3B and SNAP-RAB5, or -RAB7 were shifted to starvation medium and immediately studied by live fluorescence microscopy using a widefield system with 3 cameras for simultaneous detection of the 3 fluorophores (Figure 2A,C). As expected, a large number of RAB5- or RAB7-positive endosomes could be detected, some of which were positive for CHMP4B (Figure 2B, i), and a few LC3B-positive autophagic profiles were also visible, among those some were positive for RAB5 and RAB7, indicating that they represented amphisomes (as indicated in Figure 2A, iii). Interestingly, we could observe transient localization of CHMP4B to LC3B-positive vesicles, including several of which were negative for RAB5 and RAB7, thus very likely representing phagophores or nascent autophagosomes (Figure 2C, ii), although most LC3B-positive membranes were negative for CHMP4B at any given time point (Figure 2A,C, iii), This suggests that ESCRT-III is indeed recruited transiently to early autophagic structures.
Figure 2.
Transient autophagosomal recruitment of CHMP4B during starvation-induced autophagy. RPE-1 cells stably expressing pHuji-LC3B, CHMP4B-EGFP and SNAP-RAB5/7 were seeded 1 d before the experiment, washed 3 times with EBSS buffer, and imaged in live-cell imaging solution using an OMX Blaze widefield microscope. Images were recorded every 8 s. (A), single cell at time 0, (B), inset at time 0 with an endosome positive for CHMP4B (i) indicated. (C), inset at time 07:12 with a newly formed CHMP4B-positive autophagic structure (ii) and an amphisome (iii) indicated. (D) shows a detailed tracking of vesicle ii. Normalized fluorescence intensities over time of one representative track out of 19 tracks from 4 independent experiments. Tdwell indicates the calculated dwell time of CHMP4B. (E), dot plot of dwell times from all experiments. Mean value ± SD is indicated with black lines, and median value with a red line.
Transient autophagosomal recruitment of CHMP4B during starvation-induced autophagy. RPE-1 cells stably expressing pHuji-LC3B, CHMP4B-EGFP and SNAP-RAB5/7 were seeded 1 d before the experiment, washed 3 times with EBSS buffer, and imaged in live-cell imaging solution using an OMX Blaze widefield microscope. Images were recorded every 8 s. (A), single cell at time 0, (B), inset at time 0 with an endosome positive for CHMP4B (i) indicated. (C), inset at time 07:12 with a newly formed CHMP4B-positive autophagic structure (ii) and an amphisome (iii) indicated. (D) shows a detailed tracking of vesicle ii. Normalized fluorescence intensities over time of one representative track out of 19 tracks from 4 independent experiments. Tdwell indicates the calculated dwell time of CHMP4B. (E), dot plot of dwell times from all experiments. Mean value ± SD is indicated with black lines, and median value with a red line.Studies of human endosomes have shown that ESCRT-III recruitment occurs very transiently (about 80 s) and correlates with formation of single ILVs [26]. We thus asked whether ESCRT-III recruitment to nascent autophagosomes (phagophores) might follow similar kinetics. Tracking of individual LC3B-positive and RAB5/RAB7-negative vesicles upon starvation of RPE-1 cells showed a transient recruitment of CHMP4B with dwell times of 60 ± 47 (SD) s (Figure 2 D,E and Movie 1). These dynamics of CHMP4B recruitment are consistent with a function for ESCRT-III in a membrane sealing event at the nascent autophagosome.
ESCRT-III is recruited to nascent mitophagosomes
The relatively small size of starvation-induced autophagosomes in RPE-1 cells made it challenging to track ESCRT-III recruitment, especially because of movements in and out of the focal plane. We therefore also considered ESCRT recruitment to larger autophagic membranes during selective autophagy. For this purpose we chose to monitor autophagy of mitochondria, mitophagy [30], because mitochondria are relatively large organelles that are easy to image by fluorescence microscopy. In order to label mitochondria, we transfected RPE-1 cells stably expressing CHMP4B-EGFP and pHuji-LC3B with a SNAP-tag construct targeted to the mitochondrial outer membrane with the mitochondrial localization sequence (MLS) of Saccharomyces cerevisiaeTom70. By fluorescence microscopy, the Tom70-positive mitochondria labeled with SNAP-substrate could be detected throughout the cell as elongated structures (Figure 3A).
Figure 3.
Transient mitophagosomal recruitment of CHMP4B during starvation. RPE-1 cells stably expressing CHMP4B-EGFP and pHuji-LC3B were transiently transfected for 24 h with SNAP-Tom70. At the day of experiment, cells were incubated with SNAP-Cell 647-SiR for 30 min, then washed with EBSS 3 times and incubated in EBSS for 30 min, before transfer to live imaging solution for live microscopy. Images were recorded every 3 s for 15 min. (A), single cell at time 0, (B), inset at time 0 with an LC3B-surrounded mitochondrion is indicated. (C), inset at time 03:00 showing CHMP4B recruitment to mitophagosome i. (D), tracking of mitophagic profile i at 10 s intervals for 290 s. Normalized fluorescence intensities over time of one representative track out of 19 tracks from 2 independent experiments. Tdwell indicates the calculated dwell time of CHMP4B. (E), dot plot of dwell times from all experiments. Mean value ± SD is indicated with black lines, and median value with a red line.
Transient mitophagosomal recruitment of CHMP4B during starvation. RPE-1 cells stably expressing CHMP4B-EGFP and pHuji-LC3B were transiently transfected for 24 h with SNAP-Tom70. At the day of experiment, cells were incubated with SNAP-Cell 647-SiR for 30 min, then washed with EBSS 3 times and incubated in EBSS for 30 min, before transfer to live imaging solution for live microscopy. Images were recorded every 3 s for 15 min. (A), single cell at time 0, (B), inset at time 0 with an LC3B-surrounded mitochondrion is indicated. (C), inset at time 03:00 showing CHMP4B recruitment to mitophagosome i. (D), tracking of mitophagic profile i at 10 s intervals for 290 s. Normalized fluorescence intensities over time of one representative track out of 19 tracks from 2 independent experiments. Tdwell indicates the calculated dwell time of CHMP4B. (E), dot plot of dwell times from all experiments. Mean value ± SD is indicated with black lines, and median value with a red line.One way to induce mitophagy is by long-term amino acid starvation [31]. We therefore starved the transfected RPE-1 cells for up to 24 h and then monitored them by live microscopy. Even though mitophagy was observed infrequently during these conditions, we could observe Tom70-positive mitochondria that were engulfed by LC3B-containing membranes (Figure 3B,C, Movie 2). Like with starvation-induced formation of canonical autophagosomes, recruitment of CHMP4B to mitochondria-containing autophagic structures was transient. Tracking of individual CHMP4B recruitment events showed a duration of 147 ± 67 (SD) s (Figure 3D,E and Figure S3). We noted that CHMP4B recruitment consistently occurred when the mitochondria-containing LC3B vesicles had acquired a round shape (see Movie 2). This would be consistent with a function for ESCRT-III in sealing of the forming mitophagosomes.Because starvation-induced mitophagic events were relatively rare, we also studied ESCRT recruitment under conditions of more severe cellular stress, at which mitophagy is more prominent. For this purpose we incubated transfected RPE-1 cells with the iron chelator deferiprone (DFP), which is a known inducer of metabolic stress and PRKN/PARKIN-independent mitophagy [31]. After more than 7 h of DFP incubation, we started to observe multiple events of Tom70-positive mitochondria being engulfed by LC3B-containing autophagic membranes (Figure 4A-C). Tracking of individual events of CHMP4B recruitment (Figure 4D and Movie 3) showed dwell times of 122 ± 67 (SD) s (Figure 4E). Also in these cases we detected CHMP4B recruitment only around mitochondria-containing autophagosomes, consistent with a role for ESCRT-III in autophagosome sealing (Movie 3). We were able to observe formation of a mitophagosome from the very early moment when LC3B occured until the engulfed Tom70 structure gained a round shape before CHMP4B recruitment. The dwell time of CHMP4B was considerably shorter than the time of formation of a mitophagosome, which was estimated to be 465 ± 111 (SD) s, measured as the time between LC3B appearance and the beginning of CHMP4B association (Figure S4).
Figure 4.
Transient mitophagosomal recruitment of CHMP4B upon DFP treatment. RPE-1 cells stably expressing CHMP4B-EGFP and pHuji-LC3B were transiently transfected with SNAP-Tom70 the day before the experiment, then incubated with 1 mM DFP for 12 h. The DFP-treated cells were incubated with SNAP-Cell 647-SiR for 30 min, then washed with EBSS 3 times and incubated for 30 min in EBSS and transferred to live imaging buffer containing 20 mM glucose for live microscopy. Images were recorded every 2 s for 15 min. (A), single cell at time 0, (B), inset at time 0 with 2 LC3B-surrounded mitochondria (i,ii) indicated. (C), inset at time 03:22 showing CHMP4B recruitment to mitophagosome ii. Note that the CHMP4B-positive structure close to i is a separate vesicle, probably an endosome passing by. (D), tracking of mitophagic profile ii at 3 s intervals for 240 s. Normalized fluorescence intensities over time of one representative track out of 48 tracks from 5 independent experiments. Tdwell indicates the calculated dwell time of CHMP4B. (E), dot plot of dwell times from all experiments. Mean value ± SD is indicated with black lines, and median value with a red line.
Transient mitophagosomal recruitment of CHMP4B upon DFP treatment. RPE-1 cells stably expressing CHMP4B-EGFP and pHuji-LC3B were transiently transfected with SNAP-Tom70 the day before the experiment, then incubated with 1 mM DFP for 12 h. The DFP-treated cells were incubated with SNAP-Cell 647-SiR for 30 min, then washed with EBSS 3 times and incubated for 30 min in EBSS and transferred to live imaging buffer containing 20 mM glucose for live microscopy. Images were recorded every 2 s for 15 min. (A), single cell at time 0, (B), inset at time 0 with 2 LC3B-surrounded mitochondria (i,ii) indicated. (C), inset at time 03:22 showing CHMP4B recruitment to mitophagosome ii. Note that the CHMP4B-positive structure close to i is a separate vesicle, probably an endosome passing by. (D), tracking of mitophagic profile ii at 3 s intervals for 240 s. Normalized fluorescence intensities over time of one representative track out of 48 tracks from 5 independent experiments. Tdwell indicates the calculated dwell time of CHMP4B. (E), dot plot of dwell times from all experiments. Mean value ± SD is indicated with black lines, and median value with a red line.
ESCRT-III is recruited at a late stage of mitophagosome formation
In order to study recruitment of CHMP4B to nascent mitophagosomes at the ultrastructural level, we performed correlative light and electron microscopy (CLEM) in combination with electron tomography of cells expressing CHMP4B-EGFP, pHuji-LC3B and SNAP-Tom70. Mitophagosomes positive for all 3 markers were identified by confocal microscopy (Figure 5A, Imaris rendering in insets) and then overlaid with the appropriate image from serial EM sections (Figure 5C–E) for the CLEM montage (from Figure 5C). Typical examples of LC3B-surrounded mitochondria are annoted (number 1 and 4 in Figure 5B–D). Further examination of these compartments by electron tomography clearly revealed their mitochondrial content. The membrane composition, however, remained somewhat unclear although several membrane layers are clearly visible in Figure 5F (structure 4) and Figure 5G (structure 1), as well as in Figure S5. The Imaris reconstruction in combination with the CLEM allowed us to pinpoint the presumable CHMP4B-EGFP localization on structure 4 (Figure 5F and Figure S5), without indication of membrane discontinuity. These results indicate that ESCRT-III is recruited at a late stage in mitophagosome biogenesis, consistent with a function in phagophore closure.
Figure 5.
Ultrastructural analysis of CHMP4B recruitment during mitophagy. RPE-1 cells stably expressing CHMP4B-EGFP and pHuji-LC3B were transiently transfected with SNAP-Tom70 the day before the experiment, then incubated with 1 mM DFP for 12 h. Cells were fixed and Airyscan confocal images were obtained using a Zeiss LSM880 Airyscan microscope. Structures positive for CHMP4B-EGFP, pHuji-LC3B and SNAP-Tom70 were identified and studied by correlative light/electron microscopy and electron tomography in a 200 kV Talos electron microscope (Thermo Fisher). Single optical sections of Airyscan micrographs are shown in (A) (optical section no. 4) and (B) (optical section no. 3). The boxed area in (A) is shown magnified and overlaid on the electron micrograph (B). Three consecutive serial sections (200 nm each) of this area are shown in panels (C), (D) and (E), with 7 structures annotated. The lower panels, (F) and (G), show tomogram slices of the indicated structures (1 and 4) at high magnification with the correlative localization of the CHMP4B-EGFP signal (F). Structure no. 4 is a mitochondrion (blue) surrounded by LC3B-positive membranes (red), and recruited CHMP4B-EGFP (green) is visible in the Airyscan micrograph (A), left inset, and the Imaris 3D-rendering (A), right inset, and also indicated in the CLEM montage (B). Different tomogram sections of structure no. 4 at higher magnification are shown in Suppl.Fig. S5. Scale bars as indicated. Tomogram pixel size 1.5 nm.
Ultrastructural analysis of CHMP4B recruitment during mitophagy. RPE-1 cells stably expressing CHMP4B-EGFP and pHuji-LC3B were transiently transfected with SNAP-Tom70 the day before the experiment, then incubated with 1 mM DFP for 12 h. Cells were fixed and Airyscan confocal images were obtained using a Zeiss LSM880 Airyscan microscope. Structures positive for CHMP4B-EGFP, pHuji-LC3B and SNAP-Tom70 were identified and studied by correlative light/electron microscopy and electron tomography in a 200 kV Talos electron microscope (Thermo Fisher). Single optical sections of Airyscan micrographs are shown in (A) (optical section no. 4) and (B) (optical section no. 3). The boxed area in (A) is shown magnified and overlaid on the electron micrograph (B). Three consecutive serial sections (200 nm each) of this area are shown in panels (C), (D) and (E), with 7 structures annotated. The lower panels, (F) and (G), show tomogram slices of the indicated structures (1 and 4) at high magnification with the correlative localization of the CHMP4B-EGFP signal (F). Structure no. 4 is a mitochondrion (blue) surrounded by LC3B-positive membranes (red), and recruited CHMP4B-EGFP (green) is visible in the Airyscan micrograph (A), left inset, and the Imaris 3D-rendering (A), right inset, and also indicated in the CLEM montage (B). Different tomogram sections of structure no. 4 at higher magnification are shown in Suppl.Fig. S5. Scale bars as indicated. Tomogram pixel size 1.5 nm.
CHMP4B is hyper-recruited to mitophagosomes upon depletion of CHMP2A
CHMP4 or its yeast ortholog Snf7/Vps32 is the main constituent of ESCRT-III filaments, whereas other ESCRT-III subunits are thought to have accessory functions [32,33]. Specifically, Vps20/CHMP6 mediates ESCRT-III recruitment to ESCRT-II, Vps24/CHMP3 terminates or modifies Snf7/CHMP4 oligomerization, and Vps2/CHMP2 recruits VPS4 to the ESCRT-III filaments [32]. Consistent with this notion, we have previously found that depletion of CHMP2A causes hyper-accumulation of CHMP4B during nuclear envelope sealing and lysosome repair, accompanied by ESCRT dysfunctions [6,12]. We therefore asked whether depletion of CHMP2A would influence the dwell time of CHMP4B on autophagosomes. Microscopy of control siRNA-transfected RPE-1 cells treated with DFP showed that CHMP4B transiently associated with nascent mitophagosomes after they had developed and acquired a round shape (Figure S4A-D, i,ii, Movie 4), similar to what was observed in untransfected cells (Figure 3). In contrast, CHMP2A-depleted cells displayed a strong increase in CHMP4B residence on mitophagosomes (Figure 6A–C, i). Tracking of individual vesicles showed that the dwell time of CHMP4B on these autophagic structures exceeded 500 s and lasted beyond the end of tracking, a more than 2-fold increase from control cells (Figure 6D,E, Movie 5). We conclude that CHMP4B dynamics on nascent autophagosomes are regulated by CHMP2A. As expected, we also observed increased recruitment of CHMP4B-EGFP to LC3B-negative endosomes in CHMP2A-depleted cells (Movie 5).
Figure 6.
Sustained mitophagosomal recruitment of CHMP4B upon CHMP2A depletion. RPE-1 cells stably expressing CHMP4B-EGFP and pHuji-LC3B were transfected with siRNA against CHMP2A for 48 h and then transiently transfected with SNAP-Tom70 before incubation with 1 mM DFP for 12 h. The DFP-treated cells were incubated with SNAP-Cell 647-SiR for 30 min, then washed with EBSS 3 times and incubated for 30 min in EBSS and transferred to live-cell imaging buffer containing 20 mM glucose. Images were recorded every 3 s for 15 min. (A), single cell at time 0, with example of CHMP4B-containing mitophagosome (i) indicated. The increase in CHMP4B-EGFP and pHuji-LC3B signal during the first frames is due to focal movement. (B), the same cell at time 0:45. (C), the same cell at time 11:18. (D), tracking of mitophagosome i over 320 s. Normalized fluorescence intensities over time of one representative track out of 15 tracks from 2 independent experiments. Relative amplitude differences between different trackings are related to the different total fluorescence intensities. (E), western blot showing the efficiency of CHMP2A knockdown.
Sustained mitophagosomal recruitment of CHMP4B upon CHMP2A depletion. RPE-1 cells stably expressing CHMP4B-EGFP and pHuji-LC3B were transfected with siRNA against CHMP2A for 48 h and then transiently transfected with SNAP-Tom70 before incubation with 1 mM DFP for 12 h. The DFP-treated cells were incubated with SNAP-Cell 647-SiR for 30 min, then washed with EBSS 3 times and incubated for 30 min in EBSS and transferred to live-cell imaging buffer containing 20 mM glucose. Images were recorded every 3 s for 15 min. (A), single cell at time 0, with example of CHMP4B-containing mitophagosome (i) indicated. The increase in CHMP4B-EGFP and pHuji-LC3B signal during the first frames is due to focal movement. (B), the same cell at time 0:45. (C), the same cell at time 11:18. (D), tracking of mitophagosome i over 320 s. Normalized fluorescence intensities over time of one representative track out of 15 tracks from 2 independent experiments. Relative amplitude differences between different trackings are related to the different total fluorescence intensities. (E), western blot showing the efficiency of CHMP2A knockdown.
A novel optogenetic closure assay indicates that CHMP2A mediates mitophagosome sealing
The transient recruitment of ESCRT-III to nascent mitophagosomes would be consistent with a role for ESCRTs in mitophagosome sealing, and we wanted to test this experimentally. To this end, we developed a novel optogenetic assay for detection of sealed vs open mitophagosomes, based on the LOVTRAP system for photoinduced protein dissociation [34]. LOVTRAP utilizes the light sensitive association between the light-oxygen-voltage 2 (LOV2) domain from Avena sativa phototropin 1 and the protein A-derived ligand Zdk1. For our assay we used LOV2 fused with the N terminus of the mitochondrial outer membrane protein TOMM20 (NTOMM20), and Zdk1 fused with mCherry [34] (Figure 7A). The association between NTOMM20-LOV2 and cytosolic mCherry-Zdk1 causes mitochondria to be positive for mCherry. Upon exposure of the cells to 488 nm wavelength light, the LOV2 domain dissociates from Zdk1 and mCherry-Zdk1 reversibly translocates from mitochondria to cytosol until the 488 nm light is turned off. We reasoned that if mitochondria are enclosed by sealed autophagic membranes, the release of mCherry-Zdk1 into the cytosol should be inhibited. Conversely, if sealing is inhibited, mCherry-Zdk1 release should occur even if the mitochondrion is surrounded by SNAP-LC3B.
Figure 7.
Optogenetic assay of mitophagosome closure. (A), Schematic representation of the optogenetic mitophagosome closure assay. Labelling of mitochondria as cargo was achieved by expression of NTOMM20-LOV2 and Cherry-Zdk1. Upon exposure of cells to 488 nm wavelength light, the mCherry-Zdk1 probe reversibly dissociates from the NTOMM20-LOV2 into the cytoplasm. With time mCherry-Zdk1 associates again with the LOV2-domain. Upon closure of autophagosomes during mitophagy around mitochondria, the release of mCherry-Zdk1 is inhibited and the mitochondria remain fluorescent. If closure is inhibited, mCherry fluorescence is transiently lost. Using this system unclosed autophagosomes should be observed by fluctuations in mCherry fluorescence intensity upon repeated pulses of light exposure. (B), RPE-1 cells stably expressing SNAP-LC3B and transiently expressing NTOMM20-LOV2 and mCherry-Zdk1 were treated with DFP. Live cell imaging was performed to follow autophagosome formation around damaged mitochondria. Cells were imaged every 2 s and exposed to 488 nm light every 12 time points. Fluorescence intensity was measured for each track and the corresponding gallery added. Time points of light exposure are indicated by the orange triangle.
Optogenetic assay of mitophagosome closure. (A), Schematic representation of the optogenetic mitophagosome closure assay. Labelling of mitochondria as cargo was achieved by expression of NTOMM20-LOV2 and Cherry-Zdk1. Upon exposure of cells to 488 nm wavelength light, the mCherry-Zdk1 probe reversibly dissociates from the NTOMM20-LOV2 into the cytoplasm. With time mCherry-Zdk1 associates again with the LOV2-domain. Upon closure of autophagosomes during mitophagy around mitochondria, the release of mCherry-Zdk1 is inhibited and the mitochondria remain fluorescent. If closure is inhibited, mCherry fluorescence is transiently lost. Using this system unclosed autophagosomes should be observed by fluctuations in mCherry fluorescence intensity upon repeated pulses of light exposure. (B), RPE-1 cells stably expressing SNAP-LC3B and transiently expressing NTOMM20-LOV2 and mCherry-Zdk1 were treated with DFP. Live cell imaging was performed to follow autophagosome formation around damaged mitochondria. Cells were imaged every 2 s and exposed to 488 nm light every 12 time points. Fluorescence intensity was measured for each track and the corresponding gallery added. Time points of light exposure are indicated by the orange triangle.Control experiments with DFP-treated RPE-1 cells expressing NTOMM20-LOV2, mCherry-Zdk1 and SNAP-LC3B showed that mitochondria were indeed positive for mCherry-Zdk1, which instantly dissociated from the mitochondria when exposed to 488 nm light. This dissociation was rapidly reversible upon shutting off the 488 nm illumination (Figure 7B), Some of the mCherry-Zdk1 positive mitochondria were also positive for SNAP-LC3B, indicating that they were subject to mitophagy. Importantly, mCherry-Zdk1 in these mitophagosomes was, in general, insensitive to 488 nm light, indicating that the mitophagosomes were sealed. However, in a rare case we could observe an LC3B-positive structure with light sensitive mCherry-Zdk1 which became light resistant over time (Figure 7B, Movie 6). We interpret this as a mitophagosome that was sealed during the course of imaging.In cells treated with control siRNA, only 5% of the LC3B- and mCherry-Zdk1-positive structures were sensitive to 488 nm light (Figure 8A,C, Movie 7), indicating that almost all mitophagosomes are closed at any time. To test the possible function of ESCRT-III in mitophagosome sealing, we chose to deplete cells of CHMP2A because depletion of this subunit strongly inhibits nuclear envelope sealing [6] and because CHMP2A depletion caused a strongly increased mitophagosomal dwell time of CHMP4B (Figure 5). Interestingly, in CHMP2A-depleted cells, 23% of LC3B and mCherry-Zdk1-positive structures were sensitive to 488 nm light (Figure 8B,C, Movie 8, knockdown efficiency confirmed in Figure 8D). By comparing the light sensitivity of mCherry-Zdk1 containing mitophagosomes in control and CHMP2A-depleted cells (Figure 8C) we conclude that a large proportion of the latter contained unsealed mitophagosomes. This is consistent with a role for CHMP2A in phagophore closure.
Figure 8.
CHMP2A depletion inhibits mitophagosome closure. (A, B), Example galleries and vesicle tracks for mitophagy closure assay. Cells stably expressing SNAP-LC3B and transiently expressing NTOMM20-LOV2 and Cherry-Zdk1 were treated with DFP. Live cell imaging was performed to follow autophagosome formation around damaged mitochondria. Cells were imaged every 2 s and exposed to 488 nm light every 12 time points. Fluorescence intensity was measured for each track and the corresponding gallery added for a scrambled siRNA transfected cell (A) and a CHMP2A knockdown cell (B). Time points of light exposure are indicated by the orange triangle. (C), Graph comparing the amount of closed autophagosomes to open autophagosomes in cells treated with control scrambled siRNA or CHMP2A siRNA. Data represent tracking of 19 profiles for control siRNA- and 40 profiles for CHMP2A siRNA-treated cells from 2 independent experiments. (D), Knockdown efficency of CHMP2A as detected by western blotting for 2 live cell imaging experiments.
CHMP2A depletion inhibits mitophagosome closure. (A, B), Example galleries and vesicle tracks for mitophagy closure assay. Cells stably expressing SNAP-LC3B and transiently expressing NTOMM20-LOV2 and Cherry-Zdk1 were treated with DFP. Live cell imaging was performed to follow autophagosome formation around damaged mitochondria. Cells were imaged every 2 s and exposed to 488 nm light every 12 time points. Fluorescence intensity was measured for each track and the corresponding gallery added for a scrambled siRNA transfected cell (A) and a CHMP2A knockdown cell (B). Time points of light exposure are indicated by the orange triangle. (C), Graph comparing the amount of closed autophagosomes to open autophagosomes in cells treated with control scrambled siRNA or CHMP2A siRNA. Data represent tracking of 19 profiles for control siRNA- and 40 profiles for CHMP2A siRNA-treated cells from 2 independent experiments. (D), Knockdown efficency of CHMP2A as detected by western blotting for 2 live cell imaging experiments.To further evaluate the effect of ESCRT inactivation mitophagosome integrity, we studied mitochondria-containing pHuji-LC3B- and CHMP4B-EGFP-positive structures of VPS4A/B-depleted RPE-1 cells by CLEM. This analysis showed mitochondria surrounded by aberrant membranes (Figure S6), similar to what has previously been observed with faulty nuclear envelope sealing upon ESCRT inactivation [6]. This supports the notion that a functional ESCRT-III machinery is required for proper mitophagosome sealing.
ESCRT-III is required for PRKN-independent and -dependent mitophagy
If ESCRT-III is indeed involved in closure of mitophagosomes, one would predict that its dysfunction would impair mitophagic flux. To address this issue we took advantage of a newly developed mitophagic flux reporter, based on fusion of an MLS to green-fluorescent EGFP and red-fluorescent mCherry [31,35,36]. When this construct is targeted to mitochondria, yellow fluorescence will be detected because of the overlapping EGFP and mCherry signals, while mitochondria-containing autolysosomes only will emit red fluorescence due to quenching of EGFP at the low pH found in the autolysosome lumen. U2-OS cells with stable inducible expression of the MLS-EGFP-mCherry construct were used to monitor mitophagy in control versus ESCRT-depleted cells treated with DFP for 24 h (Figure 9A and Figure S7). Interestingly, both CHMP2A and CHMP4B depletion caused a marked reduction in DFP-induced mitophagy as analyzed by quantification of red only structures, as did co-depletion of the 2 VPS4 isoforms, VPS4A and VPS4B (Figure 9A). Thus, we conclude that ESCRT-III is required for DFP-induced, PRKN-independent mitophagy.
Figure 9.
ESCRT depletion inhibits mitophagy. ((A), U2-OS cells expressing the MLS-EGFP-mCherry probe were treated with the indicated siRNAs for 24 h, then incubated with DFP for 24 h, and mitophagy was measured as described in Materials and Methods. Representative microscopy images are shown to the left, and the quantifications based on 3 independent experiments are shown to the right. Knockdown efficiency, as determined by real-time PCR, is shown in Suppl. Fig. S7. An illustration of the principle of the assay is included. (B), U2-OS cells expressing the MLS-EGFP-mCherry probe and PRKN were treated with the indicated siRNAs for 24 h, then incubated with oligomycin and antimycin A (O + A) for 6 h, and mitophagy was measured as described in Materials and Methods. Examples of microscopy images are shown to the left, and the quantifications based on 3 independent experiments are shown to the right.
ESCRT depletion inhibits mitophagy. ((A), U2-OS cells expressing the MLS-EGFP-mCherry probe were treated with the indicated siRNAs for 24 h, then incubated with DFP for 24 h, and mitophagy was measured as described in Materials and Methods. Representative microscopy images are shown to the left, and the quantifications based on 3 independent experiments are shown to the right. Knockdown efficiency, as determined by real-time PCR, is shown in Suppl. Fig. S7. An illustration of the principle of the assay is included. (B), U2-OS cells expressing the MLS-EGFP-mCherry probe and PRKN were treated with the indicated siRNAs for 24 h, then incubated with oligomycin and antimycin A (O + A) for 6 h, and mitophagy was measured as described in Materials and Methods. Examples of microscopy images are shown to the left, and the quantifications based on 3 independent experiments are shown to the right.PRKN-dependent mitophagy is a well-characterized mechanism for degradation of depolarized mitochondria [30]. U2-OSMLS-EGFP-mCherry cells stably expressing PRKN were incubated with oligomycin and antimycin A for 6 h to induce mitophagy [36]. Like with PRKN-independent mitophagy, we detected a profound inhibition of mitophagy after CHMP2A depletion (Figure 9B).In order to verify that mitophagic degradation is ESCRT-dependent, we also monitoried degradation of the mitochondrial inner membrane protein, MT-CO2/COX-II (mitochondrially encoded cytochrome c oxidase II) by western blotting. This protein was found to be partially degraded in a pH-dependent manner (as measured with bafilomycin A1 sensitivity) upon induction of PRKN-dependent mitophagy, whereas siRNA-mediated depletion of CHMP2A or CHMP4B abolished this degradation (Figure 10A,B). Taken together, our data show that ESCRT-III is required for both PRKN-dependent and -independent mitophagy flux, consistent with a role for ESCRT-III in autophagosome sealing.
Figure 10.
CHMP2A or CHMP4B depletion inhibits PRKN-dependent mitophagic protein degradation. U2-OS cells expressing PRKN were treated with scrambled siRNA or siRNA against CHMP2A (A) or CHMP4B (B) and incubated with or without oligomycin (10 μM), antimycin A (1 μM) and bafilomycin A1 (100 nm) at 37°C for 12 h, and cell lysates were analyzed by SDS-polyacrylamide gel electrophoresis followed by western blotting (middle panel) against MT-CO2. Antibodies against VCL and TUBG were used as loading controls. The V-ATPase inhibitor bafilomycin A1 was used to evaluate the importance of acidification and thus membrane closure for MT-CO2 degradation. Quantifications from 3 independent experiments are shown in the lower panel, with mean values ± SEM indicated. *, p < 0.05; **, p < 0.005.
CHMP2A or CHMP4B depletion inhibits PRKN-dependent mitophagic protein degradation. U2-OS cells expressing PRKN were treated with scrambled siRNA or siRNA against CHMP2A (A) or CHMP4B (B) and incubated with or without oligomycin (10 μM), antimycin A (1 μM) and bafilomycin A1 (100 nm) at 37°C for 12 h, and cell lysates were analyzed by SDS-polyacrylamide gel electrophoresis followed by western blotting (middle panel) against MT-CO2. Antibodies against VCL and TUBG were used as loading controls. The V-ATPase inhibitor bafilomycin A1 was used to evaluate the importance of acidification and thus membrane closure for MT-CO2 degradation. Quantifications from 3 independent experiments are shown in the lower panel, with mean values ± SEM indicated. *, p < 0.05; **, p < 0.005.
Discussion
It has remained an open question how the phagophore is sealed to form an autophagosome [19,37]. Here we have used live microscopy, electron microscopy and a novel optogenetic assay to show that phagophore closure during mitophagy is mediated by ESCRT-III. This is consistent with a recent study of starvation-induced autophagy which used selective ligand accessibility of Halo-tagged LC3 to show that CHMP2A is required for autophagosome sealing in permeabilized cells [21], and also with recent results showing a requirement for ESCRT-III in autophagosome sealing in budding yeast as measured with a protease protection assay [38]. In addition, our studies have revealed the dynamics of ESCRT-III recruitment during starvation-induced autophagy and mitophagy, and the dynamics of mitophagosome formation. Our findings are in agreement with the canonical functions of ESCRT-III, namely in scission of cytosol-containing double-membrane openings, a topology shared with phagophore closure [39].We measured the dwell time of CHMP4B-EGFP on the starvation-induced autophagosome to less than 1 min, which is slightly shorter than the published dwell time of 80 s for CHMP4B-EGFP on endosomes during formation of intraluminal vesicles [26]. It is interesting that we consistently measured the somewhat longer dwell times over 2 min for CHMP4B-EGFP on mitophagosomes during their biogenesis, which are to be compared with about 8 min for the entire biogenesis of a mitophagosome. It is not clear why closure of a phagophore surrounding a mitochondrion would take longer time than closure of a smaller cytosol-filled phagophore, but we speculate that the differences might be related to the size/volume differences of the 2 types of phagophores.Can defective autophagosome closure explain the pronounced accumulation of autophagosome-like structures observed in ESCRT-depleted cells [13-18]? It is interesting to note that STX17 (syntaxin17), which mediates fusion of autophagosomes with lysosomes, is only recruited to the autophagosome after it has been sealed [40]. Thus, one would expect unsealed autophagosomes to accumulate if sealing is inhibited. Given that the annulus closed by ESCRT-III is likely to be very small, based on knowledge from other ESCRT-mediated scission events [5,7,8], detection of unsealed phagophores by electron microscopy would be very difficult, and unsealed phagophores might therefore easily be interpreted as autophagosomes. This could, at least in part, explain the increased autophagosome numbers reported in ESCRT-depleted cells.The involvement of ESCRT-III in phagophore closure raises the question of how this multimeric complex is recruited to the phagophore. Given that both ESCRT-I and ESCRT-II depletion results in autophagosome accumulation, albeit with lower penetrance than ESCRT-III depletion [14-16], it is possible that ESCRT-III is recruited via these upstream ESCRTs, similar to what is the case during ILV formation, cytokinetic abscission and lysosome repair [5,11,12,41,42]. On the other hand, there are also multiple examples of ESCRT-III recruitment in the absence of ESCRT-I and -II [1], so further studies will be required to clarify the issue of ESCRT recruitment to phagophores.Even though CHMP2A depletion led to a marked increase in the fraction of unclosed mitophagosomes, the majority of mitophagosomes appeared sealed even in CHMP2A-depleted cells. Because the knockdown efficiency was high, it is unlikely that this can be attributed to remaining CHMP2A protein sufficient to seal phagophores. More likely, the number of open mitophagosomes might be underestimated because of restricted diffusion of mCherry-Zdk1 out of phagophores with very small openings. We also cannot rule out the possibility that alternative mechanisms for mitophagosome sealing exist, which are independent of CHMP2A and other ESCRTs.The notion that ESCRT-III mediates phagophore closure does not exclude the possibility that ESCRT proteins have additional functions in autophagy. Studies of ESCRT knockdown phenotypes in the nematode C.elegans have suggested that autophagosome accumulation is secondary to formation of enlarged endosomes and increased pro-autophagic signalling [16]. It also remains a possibility that ESCRT proteins mediate fusion of autophagosomes with endosomes or lysosomes, although direct evidence for this is still lacking. Because at least some lysosomal enzymes follow the ILV pathway [43,44], it is also plausible that lysosome biogenesis, which is essential for autophagic flux [45], could be affected by ESCRT depletion. Indeed, the complex phenotypes observed in ESCRT-depleted cells would be consistent with the functions of ESCRT proteins at several steps in the autophagic pathway.
Materials and methods
Cell culture and generation of stable cell lines
hTERT-RPE-1 cells (human retinal pigment epithelial cells immortalized with telomerase) and stable cell lines derived from these cells were maintained in F12/Dulbecco’s Modified Eagle’s Medium high glucose (DMEM, Sigma-Aldrich, D0819), supplemented with 10% fetal bovine serum (Sigma Aldrich, F7524), 100 U/ml penicillin and 100 μg/ml streptomycin. All cells were cultured at 37°C supplemented with 5% CO2. For amino acid and growth factor starvation experiments, the growth medium was removed, cells washed 3 times and the medium replaced with EBSS (GIBCO BRL, 24,010–043) or Live Cell Imaging Solution (Molecular Probes, A14291DJ), supplemented with 20 mM glucose (Merck, 108,342) in experiments with DFP treatment. U2-OS FlpIN TRex cells and stable cell lines derived from these were grown and maintained in a complete DMEM (Lonza, 12-741F) supplemented with 10% fetal bovine serum, 100 U/ml penicillin and 100 µg/ml streptomycin (ThermoFisher Scientific, 15,140,122) in a humidified incubator at 37°C with 5% CO2.All other stable cell lines used in this study were lentivirus-generated pools, using plasmids (described below) pCDH-PGK-Tom70-3xSNAPf-IRES-Blast, pCDH-PGK-pHuji-LC3B-IRES-Neo, pCDH-PGK-SNAP-RAB5-IRE S-SNAP-RAB7-IRES-Neo and pCDH-PGK-CHMP4B-EGFP-IRES-Puro for stable expression of SNAP-Tom70, pHuji-LC3B, SNAP-LC3B, SNAP-RAB5/7 and CHMP4B-EGFP, respectively. The weak PGK promoter was used for transgene expression at rather low expression levels. Third generation lentivirus was generated as previously published in [46]. Briefly, pHuji, SNAP-, mCherry or EGFP fusions were generated as Gateway ENTRY plasmids using standard molecular biology techniques. From these vectors, lentiviral transfer vectors were generated by recombination into customized pCDH (System Biosciences CD532-A) Destination vectors using a Gateway LR reaction. VSV-G pseudotyped lentiviral particles were packaged using a third-generation packaging system that was a gift from Didier Tromo (deposited by Tromo at Addgene, 12,251, 12,253 and 12,259). Cells were then transduced with low virus titers and stable expressing populations were generated by antibiotic selection. RPE-1CHMP4B-EGFP cells were sorted by flow cytometry for lower expression, and additional tagged proteins were introduced by viral transduction when needed.
Materials
Complete protease inhibitor cocktail was from Roche Diagnostics (05056489001). Rabbit anti-CHMP4B was described previously [47]. Rabbit anti-CHMP2A (10,477–1-AP) was purchased from Proteintech. Rabbit anti-LC3B (2775s), from Cell Signalling Technology. Mouse anti-VCL (vinculin, v9131), mouse anti-TUBG/γ-Tubulin (T6557) from Sigma-Aldrich. Mouse anti-MT-CO2 was from Abcam (ab110258). Mouse anti-RAB5 (sc-46,692), rabbit anti-RAB7 (sc-10,767) were from Santa Cruz Biotechnology. Deferiprone (DFP) (379,409), oligomycin A (O4876), antimycin A (A8674), bafilomycin A1 (B1793), BSA (A7030) were from Sigma-Aldrich.
Plasmids
The mitochondrially targeted SNAP-tag plasmid encodes the first 38 amino acids of the Saccharomyces cerevisiaeTom70 as an MLS, followed by the blue fluorophore TagBFP2 and 3 codon-shuffled SNAP-tag moieties. The construct was made as 3 synthesized fragments (IDT, IA, USA), cloned by Gibson Assembly (New England Biolabs, MA, USA) into a customized Gateway compatible (Life Technologies, CA, USA) vector between NheI and NotI restriction sites and verified by Sanger sequencing. Expression plasmids were obtained by Gateway reactions into a pcDNA3.1 (ThermoFisher Scientific, V79020) based plasmid modified to be Gateway compatible and expressed under a CMV promoter. The LOVTRAP plasmids [34] pTriEX-NTOMM20-LOV (Addgene, 81,009) and pTriEX-mCherry-Zdk1 (Addgene, 81,057) were a gift from the depositing lab, Klaus Hahn. For the SNAP-RAB5/RAB7 vector, RAB5 was inserted by ligation (AgeI/SalI) while SNAP-RAB7 was inserted by Gibson Assembly (vector opened BspEI/XmaI). SNAP-LC3B was assembled using Gibson Assembly (XhoI/BamHI) into the pSNAP-C1 vector backbone (based off the pEGFP vector series, Takara Bio Europe). To generate pSNAP-C1, EGFP in pEGFP-C1 was replaced with a synthetic gene fragment encoding the SNAP tag. To construct lentiviral vectors expressing pHuji-LC3B, the open reading frame of pHuji was synthesized as Genestring (Thermo Fisher). The GFP open reading frame in pEGFP-C3-LC3B (Addgene, 11,546, deposited by Karla Kirkegaard) was replaced with a synthetic gene fragment encoding the pHuji ORF (Thermo Fisher Geneart), using Gibson assembly. The resulting pHuji-LC3B fusion was subcloned,using NheI/BamHI, into a custom-synthesized Gateway-enabled vector (pENTR20,). pENTR20 was generated by cutting pEGFP-C1 (Clontech, 6084–1) using AseI and MfeI. Into the cut vector, a synthesized gateway cassette, containing AttL and AttR sites, a multiple cloning site, and a mNeonGreen stuffer fragment, was inserted by Gibson assembly. The resulting vector, pENTR20-pHuji-LC3B, was used to generate lentiviral vectors (pCDH-PGK-pHuji-LC3B-IRES-Neo, pCDH-EF1a-pHuji-LC3B-IRES-Neo) by Gateway cloning.
siRNA transfection
Silencer Select siRNAs against humanCHMP2A, CHMP2B, VPS4A, VSP4B, or CHMP4B, and nontargeting control “scrambled” siRNA (predesigned, 4,390,844) were purchased from Ambion® (Thermo Fisher Scientific). Cells at 50% confluency were transfected with 10–20 nM final siRNA concentration using Lipofectamine RNAiMax transfection reagent (Life Technologies, 13,778–150) according to the manufacturer’s instructions and used for experiments after 20 h (VPS4A/B), 48 h (CHMP2A) or 96 h (CHMP4B).
siRNA oligonucleotides
All siRNA oligonucleotides (Table 1) have been validated previously for target specificity [6,26]. Knockdown levels were routinely confirmed by western blotting.
Table 1.
siRNA oligonucleotides used.
Target
Sequence
Non-targeting
5’-ACUUCGAGCGUGCAUGGCA-3’
VPS4A
5’-CCGAGAAGCTGAAGGATTA-3’
VPS4B
5’-CCAAAGAAGCACTGAAAGA-3’
CHMP2A
5’-AAGAUGAAGAGGAGAGUGA-3’
CHMP2B
5’-UCGAGCAGCUUUAGAGAAA-3’
CHMP4B
5’-CATCGAGTTCCAGCGGGAG-3’
siRNA oligonucleotides used.
Immunoblotting
Cells were washed with cold PBS and lysed in 2X Laemmli Sample Buffer (Bio-Rad Laboratories, 1,610,737). Whole-cell lysates were subjected to SDS-PAGE on 4–20% gradient gels (mini-PROTEAN TGX; Bio-Rad). Proteins were transferred to polyvinylidene difluoride (PVDF) membranes (TransBlot® TurboTM LF PVDF, Bio-Rad) followed by blocking in 3% BSA and antibody incubation in Tris-buffered saline with 0.1% Tween-20 (Sigma-Aldrich, P1379). Membranes incubated with fluorescent secondary antibodies (IRDye 680 rabbit, 926–68,073; IRDye 680 mouse, 926–68,072; IRDye 800 rabbit, 926–32,213; IRDye 800 mouse, 926–32,212)) were developed with an Odyssey infrared scanner (LI-COR Biosciences), whereas those incubated with HRP (horseradish peroxidase)–conjugated antibodies (HRP rabbit, 111 035 144; HRP mouse, 115 035 146) were developed using Clarity western ECL substrate solutions (Bio-Rad) with a ChemiDoc XRS+ imaging system (Bio-Rad).
Live-cell imaging and quantitative image analysis
RPE-1 cells stably expressing fluorescently tagged endocytic markers (RAB5, RAB7), LC3B, Tom70 or CHMP4B were seeded in MatTek 35 mm glass-bottom dishes (MatTek Corporation, P35G-1.5–20-C) the day before the experiement. For imaging, the medium was removed and replaced by pre-warmed Live Cell Imaging Solution (in the case of DFP-induced mitophagy, containing 20 mM glucose). Live-cell imaging was performed on an OMX V4 system (DeltaVision OMX Microscope Applied Precision, GE Healthcare) equipped with an Olympus 60x Plan Apochromat 1.42 numerical aperture objective, 3 cooled sCMOS cameras, a solid-state light source and a laser-base autofocus. Environmental control was provided by a heated stage, and an objective heater. 5% CO2 and humidity was provided via a CO2 mixer (Okolab). Time-lapse images were acquired every 2–8 s (depending on expression level) over a total time period of 15–20 min. Images were deconvolved and aligned using Softworx software (Applied Precision, GE Healthcare) and further processed in ImageJ/FIJI (https://imagej.net/Fiji). A custom-made Python script was used to manually track the recruitment of ESCRT-III (CHMP4B) in the individual LC3B-positive structures and to measure their fluorescence intensity over time [26].
Correlative light and electron microscopy (CLEM)
For CLEM, RPE-1 cells stably expressing fluorescently tagged LC3B, Tom70 and CHMP4B were plated on gridded 35 mm Matek dishes (MatTek Corporation P35G-1.5–14-CGRD) and initially fixed with 4% formaldehyde and 0.1% glutaraldehyde in 0.1 M PHEM buffer (240 mM PIPES, 100 mM HEPES, 8 mM MgCl2, 40 mM EGTA, pH 6.9) for 15 min at 37°C. For immunofluorescence microscopy, the cells were overlayed with ProLong Diamond Antifade Mountant (Thermo Fisher Scientific), and imaged on a Zeiss LSM 880 Airyscan microscope (Carl Zeiss MicroImaging GmbH, Jena, Germany), using a Zeiss plan-Apochromat 63xNA/1.4 oil DICII objective, and the Airyscan detector in superresolution mode. Twelve z-sections were acquired to cover the majority of the cell volume giving images with voxel size 0,0426 x 0,0426 x 0,1850 µm. Airyscan raw images were processed using the Array Detector Optical option within Huygens Essential version 18.10 (Scientific Volume Imaging B.V., Hilversum, The Netherlands). Images were corrected for chromatic aberrations in Huygens Essential and further processed in Fiji/ImageJ software or 3D-rendered in Imaris 7.7.2 (Bitplane AG, Zürich, Switzerland).After light microscopy cells were further fixed in 2% glutaraldehyde in 0.1 M PHEM buffer for 1 h. Postfixation was done in 1% OsO4 and 1.5% KFeCN in the same buffer. Samples were further stained en bloc with 4% aquaeus uranyl acetate for 1 h, dehydrated in graded ethanol series and embedded with Epon-filled BEEM capsules (EMS; Polysciences, Inc., 00224) placed on top of the Mattek dish. After polymerization blocks were trimmed down to the regions previously identified on the confocal microscope and now imprinted on the Epon block. Serial sections (200 nm) were cut on an Ultracut UCT ultramicrotome (Leica, Germany) and collected on formvar-coated slot grids. Samples were observed in a Thermo ScientificTM TalosTM F200C microscope at 200 kV and single images taken with a Ceta 16M camera. For electron tomography image series were taken at −60° to 60° tilt angles with 2° increment. Tomograms were computed using weighted back projection using the IMOD package. Display of tomogram slices was also performed using IMOD software version 4.9.3. Image overlay of immunofluorescence images and electron micrographs was performed manually using Adobe Photoshop in overlay mode with mitochondria as useful landmarks.
Optogenetic assay of mitophagosome closure
RPE-1 cells stably expressing SNAP-LC3B were grown on 35-mm MatTek glass bottom dishes and transfected with NTOMM20-LOV2 and Cherry-Zdk1 in a 2:1 ratio using FuGENE6 (Promega, E2692). Cells were treated with DFP at a final concentration of 0.8 mM overnight. The next morning cells were washed and incubated for 30 min with SNAP-ligand before imaging. Live cell imaging was performed on an OMX V4 system using a 60X objective with a heated stage. Selected cells were imaged for up to 12 min every 2 s. Release of the mCherry-Zdk1 from the NTOMM20-LOV2 was induced by exposure to 488 nm wavelength light 0.04–0.1 s (depending on expression levels) for every 12 time points. Movies were deconvolved and aligned using Softworx software and subsequently analyzed in Fiji. LC3B and Zdk1-mCherry positive structures were tracked manually and a custom-made Python script was used to measure the fluorescence intensity changes over time. To account for different length in DFP incubation due to imaging time, in one experiment first scrambled control RNA- and subsequently siRNA-treated cells were imaged, whereas in the second experiment the order was reversed.
Mitophagy assay
U2OS FlpIN TRex cells expressing a doxycycline inducible MLS- and tandem tagged EGFP-mCherry fusion protein (MLS-EGFP-mCherry) in the presence or absence of lentivirally transduced stable expression of PRKN were used for mitophagy analysis [36]. Cells were reverse transfected in OptiMEM media (ThermoFisher Scientific, 31,985,070) overnight (16 h) with 20 nM Silencer Select siRNAs as indicated in table above (ThermoFisher Scientific) with 0.1 µl RNAiMAX (Thermofisher Scientific, 13,778,150) per pmol of siRNA and plated into a 96-well µ-Plate (Ibidi, 89,626). Cell media was then changed to complete media for 24 h in the presence of 100 ng/ml doxycycline (Fisher Scientific, NC0424034). Mitophagy was induced in PRKN overexpressing cells by the combined addition of 10 µM oligomycin (SelleckChem. S1478) and 1 µM antimycin A (Sigma, A8674) for 6 h. In cells without PRKN overexpression, mitophagy was induced by addition of 1 mM Deferiprone (DFP, Sigma Aldrich, 379,409) to complete media containing doxycycline for 24 h. Following treatment, cells were washed once with PBS and fixed in 3.7% (w/v) paraformaldehyde (Sigma Aldrich, P6148), 200 mM HEPES (Sigma Aldrich, H3375) pH 7 for 10 min at 37°C. Samples were washed twice and then incubated for 15 min at room temperature in DMEM + 10 mM HEPES pH 7. Cells were washed twice with PBS prior to addition of PBS + 2 µg/ml Hoechst 33,342 (ThermoFisher Scientific, H3570) and incubated for a minimum of 1 h prior to imaging. Images were obtained on a Zeiss AxioObserver widefield microscope with a 20x objective acquiring a minimum of 35 fields of view per treatment. Analysis of red only punctate structures was carried out utilizing CellProfiler [48] from a minimum of 1000 cells per condition per replicate.
RNA isolation and quantitative PCR
RNA was isolated and cDNA generated from siRNA transfected U2OS cells using Power SYBR Green Cells-to-CT kit (ThermoFisher Scientific #4,402,955) as per manufacturer’s instructions. Analysis of siRNA efficiency was determined by qPCR using primers designed to amplify target genes as indicated in Table 2 following normalization of transcript levels to TATA-box-binding protein using the 2−ΔΔCt method.
Table 2.
Primers used for qPCR.
Target Gene
Forward Primer (5’->3’)
Reverse Primer (5’->3’)
TBP
TTGTACCGCAGCTGCAAAAT
TATATTCGGCGTTTCGGGCA
VPS4A
GGAAGACGGAAGGCTACTCG
AGGGGCCACAGACCTTTTTG
VPS4B
TCCCGAGCTGATCCTAACCA
CCGCAACATATCCGACATGGA
CHMP2A
AAGCAAGGCCAGATGGATGCT
GGCCTTGGTGACACCCTTCA
CHMP2B
GCCAAACAACTTGTGCATCTACGG
ACTGCCTGCATTGTTTTTGCTGT
CHMP4B
AGAACATGGGCTATGCCGCC
GCTCATCCTCGTCAAACTCTTCTCC
Primers used for qPCR.
Statistical analysis and considerations
Values are expressed as mean ± SEM for quantification of western blots. CHMP4B dwell times are calculated as mean ± SD. The number of individual experiments and the number of cells analyzed are indicated in each figure legend. For the calculation of statistical significance, the unpaired t test was used to test 2 samples with equal variance, and the one-sample t test was used in cases in which the value of the control sample was set to 1.
Authors: Antonia P Sagona; Ioannis P Nezis; Nina Marie Pedersen; Knut Liestøl; John Poulton; Tor Erik Rusten; Rolf I Skotheim; Camilla Raiborg; Harald Stenmark Journal: Nat Cell Biol Date: 2010-03-07 Impact factor: 28.824
Authors: Eric Campeau; Victoria E Ruhl; Francis Rodier; Corey L Smith; Brittany L Rahmberg; Jill O Fuss; Judith Campisi; Paul Yaswen; Priscilla K Cooper; Paul D Kaufman Journal: PLoS One Date: 2009-08-06 Impact factor: 3.240
Authors: Daniel J Klionsky; Kotb Abdelmohsen; Akihisa Abe; Md Joynal Abedin; Hagai Abeliovich; Abraham Acevedo Arozena; Hiroaki Adachi; Christopher M Adams; Peter D Adams; Khosrow Adeli; Peter J Adhihetty; Sharon G Adler; Galila Agam; Rajesh Agarwal; Manish K Aghi; Maria Agnello; Patrizia Agostinis; Patricia V Aguilar; Julio Aguirre-Ghiso; Edoardo M Airoldi; Slimane Ait-Si-Ali; Takahiko Akematsu; Emmanuel T Akporiaye; Mohamed Al-Rubeai; Guillermo M Albaiceta; Chris Albanese; Diego Albani; Matthew L Albert; Jesus Aldudo; Hana Algül; Mehrdad Alirezaei; Iraide Alloza; Alexandru Almasan; Maylin Almonte-Beceril; Emad S Alnemri; Covadonga Alonso; Nihal Altan-Bonnet; Dario C Altieri; Silvia Alvarez; Lydia Alvarez-Erviti; Sandro Alves; Giuseppina Amadoro; Atsuo Amano; Consuelo Amantini; Santiago Ambrosio; Ivano Amelio; Amal O Amer; Mohamed Amessou; Angelika Amon; Zhenyi An; Frank A Anania; Stig U Andersen; Usha P Andley; Catherine K Andreadi; Nathalie Andrieu-Abadie; Alberto Anel; David K Ann; Shailendra Anoopkumar-Dukie; Manuela Antonioli; Hiroshi Aoki; Nadezda Apostolova; Saveria Aquila; Katia Aquilano; Koichi Araki; Eli Arama; Agustin Aranda; Jun Araya; Alexandre Arcaro; Esperanza Arias; Hirokazu Arimoto; Aileen R Ariosa; Jane L Armstrong; Thierry Arnould; Ivica Arsov; Katsuhiko Asanuma; Valerie Askanas; Eric Asselin; Ryuichiro Atarashi; Sally S Atherton; Julie D Atkin; Laura D Attardi; Patrick Auberger; Georg Auburger; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Maria Laura Avantaggiati; Limor Avrahami; Suresh Awale; Neelam Azad; Tiziana Bachetti; Jonathan M Backer; Dong-Hun Bae; Jae-Sung Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Seung-Hoon Baek; Stephen Baghdiguian; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xue-Yuan Bai; Yannick Bailly; Kithiganahalli Narayanaswamy Balaji; Walter Balduini; Andrea Ballabio; Rena Balzan; Rajkumar Banerjee; Gábor Bánhegyi; Haijun Bao; Benoit Barbeau; Maria D Barrachina; Esther Barreiro; Bonnie Bartel; Alberto Bartolomé; Diane C Bassham; Maria Teresa Bassi; Robert C Bast; Alakananda Basu; Maria Teresa Batista; Henri Batoko; Maurizio Battino; Kyle Bauckman; Bradley L Baumgarner; K Ulrich Bayer; Rupert Beale; Jean-François Beaulieu; George R Beck; Christoph Becker; J David Beckham; Pierre-André Bédard; Patrick J Bednarski; Thomas J Begley; Christian Behl; Christian Behrends; Georg Mn Behrens; Kevin E Behrns; Eloy Bejarano; Amine Belaid; Francesca Belleudi; Giovanni Bénard; Guy Berchem; Daniele Bergamaschi; Matteo Bergami; Ben Berkhout; Laura Berliocchi; Amélie Bernard; Monique Bernard; Francesca Bernassola; Anne Bertolotti; Amanda S Bess; Sébastien Besteiro; Saverio Bettuzzi; Savita Bhalla; Shalmoli Bhattacharyya; Sujit K Bhutia; Caroline Biagosch; Michele Wolfe Bianchi; Martine Biard-Piechaczyk; Viktor Billes; Claudia Bincoletto; Baris Bingol; Sara W Bird; Marc Bitoun; Ivana Bjedov; Craig Blackstone; Lionel Blanc; Guillermo A Blanco; Heidi Kiil Blomhoff; Emilio Boada-Romero; Stefan Böckler; Marianne Boes; Kathleen Boesze-Battaglia; Lawrence H Boise; Alessandra Bolino; Andrea Boman; Paolo Bonaldo; Matteo Bordi; Jürgen Bosch; Luis M Botana; Joelle Botti; German Bou; Marina Bouché; Marion Bouchecareilh; Marie-Josée Boucher; Michael E Boulton; Sebastien G Bouret; Patricia Boya; Michaël Boyer-Guittaut; Peter V Bozhkov; Nathan Brady; Vania Mm Braga; Claudio Brancolini; Gerhard H Braus; José M Bravo-San Pedro; Lisa A Brennan; Emery H Bresnick; Patrick Brest; Dave Bridges; Marie-Agnès Bringer; Marisa Brini; Glauber C Brito; Bertha Brodin; Paul S Brookes; Eric J Brown; Karen Brown; Hal E Broxmeyer; Alain Bruhat; Patricia Chakur Brum; John H Brumell; Nicola Brunetti-Pierri; Robert J Bryson-Richardson; Shilpa Buch; Alastair M Buchan; Hikmet Budak; Dmitry V Bulavin; Scott J Bultman; Geert Bultynck; Vladimir Bumbasirevic; Yan Burelle; Robert E Burke; Margit Burmeister; Peter Bütikofer; Laura Caberlotto; Ken Cadwell; Monika Cahova; Dongsheng Cai; Jingjing Cai; Qian Cai; Sara Calatayud; Nadine Camougrand; Michelangelo Campanella; Grant R Campbell; Matthew Campbell; Silvia Campello; Robin Candau; Isabella Caniggia; Lavinia Cantoni; Lizhi Cao; Allan B Caplan; Michele Caraglia; Claudio Cardinali; Sandra Morais Cardoso; Jennifer S Carew; Laura A Carleton; Cathleen R Carlin; Silvia Carloni; Sven R Carlsson; Didac Carmona-Gutierrez; Leticia Am Carneiro; Oliana Carnevali; Serena Carra; Alice Carrier; Bernadette Carroll; Caty Casas; Josefina Casas; Giuliana Cassinelli; Perrine Castets; Susana Castro-Obregon; Gabriella Cavallini; Isabella Ceccherini; Francesco Cecconi; Arthur I Cederbaum; Valentín Ceña; Simone Cenci; Claudia Cerella; Davide Cervia; Silvia Cetrullo; Hassan Chaachouay; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Georgios Chamilos; Edmond Yw Chan; Matthew Tv Chan; Dhyan Chandra; Pallavi Chandra; Chih-Peng Chang; Raymond Chuen-Chung Chang; Ta Yuan Chang; John C Chatham; Saurabh Chatterjee; Santosh Chauhan; Yongsheng Che; Michael E Cheetham; Rajkumar Cheluvappa; Chun-Jung Chen; Gang Chen; Guang-Chao Chen; Guoqiang Chen; Hongzhuan Chen; Jeff W Chen; Jian-Kang Chen; Min Chen; Mingzhou Chen; Peiwen Chen; Qi Chen; Quan Chen; Shang-Der Chen; Si Chen; Steve S-L Chen; Wei Chen; Wei-Jung Chen; Wen Qiang Chen; Wenli Chen; Xiangmei Chen; Yau-Hung Chen; Ye-Guang Chen; Yin Chen; Yingyu Chen; Yongshun Chen; Yu-Jen Chen; Yue-Qin Chen; Yujie Chen; Zhen Chen; Zhong Chen; Alan Cheng; Christopher Hk Cheng; Hua Cheng; Heesun Cheong; Sara Cherry; Jason Chesney; Chun Hei Antonio Cheung; Eric Chevet; Hsiang Cheng Chi; Sung-Gil Chi; Fulvio Chiacchiera; Hui-Ling Chiang; Roberto Chiarelli; Mario Chiariello; Marcello Chieppa; Lih-Shen Chin; Mario Chiong; Gigi Nc Chiu; Dong-Hyung Cho; Ssang-Goo Cho; William C Cho; Yong-Yeon Cho; Young-Seok Cho; Augustine Mk Choi; Eui-Ju Choi; Eun-Kyoung Choi; Jayoung Choi; Mary E Choi; Seung-Il Choi; Tsui-Fen Chou; Salem Chouaib; Divaker Choubey; Vinay Choubey; Kuan-Chih Chow; Kamal Chowdhury; Charleen T Chu; Tsung-Hsien Chuang; Taehoon Chun; Hyewon Chung; Taijoon Chung; Yuen-Li Chung; Yong-Joon Chwae; Valentina Cianfanelli; Roberto Ciarcia; Iwona A Ciechomska; Maria Rosa Ciriolo; Mara Cirone; Sofie Claerhout; Michael J Clague; Joan Clària; Peter Gh Clarke; Robert Clarke; Emilio Clementi; Cédric Cleyrat; Miriam Cnop; Eliana M Coccia; Tiziana Cocco; Patrice Codogno; Jörn Coers; Ezra Ew Cohen; David Colecchia; Luisa Coletto; Núria S Coll; Emma Colucci-Guyon; Sergio Comincini; Maria Condello; Katherine L Cook; Graham H Coombs; Cynthia D Cooper; J Mark Cooper; Isabelle Coppens; Maria Tiziana Corasaniti; Marco Corazzari; Ramon Corbalan; Elisabeth Corcelle-Termeau; Mario D Cordero; Cristina Corral-Ramos; Olga Corti; Andrea Cossarizza; Paola Costelli; Safia Costes; Susan L Cotman; Ana Coto-Montes; Sandra Cottet; Eduardo Couve; Lori R Covey; L Ashley Cowart; Jeffery S Cox; Fraser P Coxon; Carolyn B Coyne; Mark S Cragg; Rolf J Craven; Tiziana Crepaldi; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Maria Teresa Cruz; Ana Maria Cuervo; Jose M Cuezva; Taixing Cui; Pedro R Cutillas; Mark J Czaja; Maria F Czyzyk-Krzeska; Ruben K Dagda; Uta Dahmen; Chunsun Dai; Wenjie Dai; Yun Dai; Kevin N Dalby; Luisa Dalla Valle; Guillaume Dalmasso; Marcello D'Amelio; Markus Damme; Arlette Darfeuille-Michaud; Catherine Dargemont; Victor M Darley-Usmar; Srinivasan Dasarathy; Biplab Dasgupta; Srikanta Dash; Crispin R Dass; Hazel Marie Davey; Lester M Davids; David Dávila; Roger J Davis; Ted M Dawson; Valina L Dawson; Paula Daza; Jackie de Belleroche; Paul de Figueiredo; Regina Celia Bressan Queiroz de Figueiredo; José de la Fuente; Luisa De Martino; Antonella De Matteis; Guido Ry De Meyer; Angelo De Milito; Mauro De Santi; Wanderley de Souza; Vincenzo De Tata; Daniela De Zio; Jayanta Debnath; Reinhard Dechant; Jean-Paul Decuypere; Shane Deegan; Benjamin Dehay; Barbara Del Bello; Dominic P Del Re; Régis Delage-Mourroux; Lea Md Delbridge; Louise Deldicque; Elizabeth Delorme-Axford; Yizhen Deng; Joern Dengjel; Melanie Denizot; Paul Dent; Channing J Der; Vojo Deretic; Benoît Derrien; Eric Deutsch; Timothy P Devarenne; Rodney J Devenish; Sabrina Di Bartolomeo; Nicola Di Daniele; Fabio Di Domenico; Alessia Di Nardo; Simone Di Paola; Antonio Di Pietro; Livia Di Renzo; Aaron DiAntonio; Guillermo Díaz-Araya; Ines Díaz-Laviada; Maria T Diaz-Meco; Javier Diaz-Nido; Chad A Dickey; Robert C Dickson; Marc Diederich; Paul Digard; Ivan Dikic; Savithrama P Dinesh-Kumar; Chan Ding; Wen-Xing Ding; Zufeng Ding; Luciana Dini; Jörg Hw Distler; Abhinav Diwan; Mojgan Djavaheri-Mergny; Kostyantyn Dmytruk; Renwick Cj Dobson; Volker Doetsch; Karol Dokladny; Svetlana Dokudovskaya; Massimo Donadelli; X Charlie Dong; Xiaonan Dong; Zheng Dong; Terrence M Donohue; Kelly S Doran; Gabriella D'Orazi; Gerald W Dorn; Victor Dosenko; Sami Dridi; Liat Drucker; Jie Du; Li-Lin Du; Lihuan Du; André du Toit; Priyamvada Dua; Lei Duan; Pu Duann; Vikash Kumar Dubey; Michael R Duchen; Michel A Duchosal; Helene Duez; Isabelle Dugail; Verónica I Dumit; Mara C Duncan; Elaine A Dunlop; William A Dunn; Nicolas Dupont; Luc Dupuis; Raúl V Durán; Thomas M Durcan; Stéphane Duvezin-Caubet; Umamaheswar Duvvuri; Vinay Eapen; Darius Ebrahimi-Fakhari; Arnaud Echard; Leopold Eckhart; Charles L Edelstein; Aimee L Edinger; Ludwig Eichinger; Tobias Eisenberg; Avital Eisenberg-Lerner; N Tony Eissa; Wafik S El-Deiry; Victoria El-Khoury; Zvulun Elazar; Hagit Eldar-Finkelman; Chris Jh Elliott; Enzo Emanuele; Urban Emmenegger; Nikolai Engedal; Anna-Mart Engelbrecht; Simone Engelender; Jorrit M Enserink; Ralf Erdmann; Jekaterina Erenpreisa; Rajaraman Eri; Jason L Eriksen; Andreja Erman; Ricardo Escalante; Eeva-Liisa Eskelinen; Lucile Espert; Lorena Esteban-Martínez; Thomas J Evans; Mario Fabri; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Nils J Færgeman; Alberto Faggioni; W Douglas Fairlie; Chunhai Fan; Daping Fan; Jie Fan; Shengyun Fang; Manolis Fanto; Alessandro Fanzani; Thomas Farkas; Mathias Faure; Francois B Favier; Howard Fearnhead; Massimo Federici; Erkang Fei; Tania C Felizardo; Hua Feng; Yibin Feng; Yuchen Feng; Thomas A Ferguson; Álvaro F Fernández; Maite G Fernandez-Barrena; Jose C Fernandez-Checa; Arsenio Fernández-López; Martin E Fernandez-Zapico; Olivier Feron; Elisabetta Ferraro; Carmen Veríssima Ferreira-Halder; Laszlo Fesus; Ralph Feuer; Fabienne C Fiesel; Eduardo C Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; John H Fingert; Steven Finkbeiner; Toren Finkel; Filomena Fiorito; Paul B Fisher; Marc Flajolet; Flavio Flamigni; Oliver Florey; Salvatore Florio; R Andres Floto; Marco Folini; Carlo Follo; Edward A Fon; Francesco Fornai; Franco Fortunato; Alessandro Fraldi; Rodrigo Franco; Arnaud Francois; Aurélie François; Lisa B Frankel; Iain Dc Fraser; Norbert Frey; Damien G Freyssenet; Christian Frezza; Scott L Friedman; Daniel E Frigo; Dongxu Fu; José M Fuentes; Juan Fueyo; Yoshio Fujitani; Yuuki Fujiwara; Mikihiro Fujiya; Mitsunori Fukuda; Simone Fulda; Carmela Fusco; Bozena Gabryel; Matthias Gaestel; Philippe Gailly; Malgorzata Gajewska; Sehamuddin Galadari; Gad Galili; Inmaculada Galindo; Maria F Galindo; Giovanna Galliciotti; Lorenzo Galluzzi; Luca Galluzzi; Vincent Galy; Noor Gammoh; Sam Gandy; Anand K Ganesan; Swamynathan Ganesan; Ian G Ganley; Monique Gannagé; Fen-Biao Gao; Feng Gao; Jian-Xin Gao; Lorena García Nannig; Eleonora García Véscovi; Marina Garcia-Macía; Carmen Garcia-Ruiz; Abhishek D Garg; Pramod Kumar Garg; Ricardo Gargini; Nils Christian Gassen; Damián Gatica; Evelina Gatti; Julie Gavard; Evripidis Gavathiotis; Liang Ge; Pengfei Ge; Shengfang Ge; Po-Wu Gean; Vania Gelmetti; Armando A Genazzani; Jiefei Geng; Pascal Genschik; Lisa Gerner; Jason E Gestwicki; David A Gewirtz; Saeid Ghavami; Eric Ghigo; Debabrata Ghosh; Anna Maria Giammarioli; Francesca Giampieri; Claudia Giampietri; Alexandra Giatromanolaki; Derrick J Gibbings; Lara Gibellini; Spencer B Gibson; Vanessa Ginet; Antonio Giordano; Flaviano Giorgini; Elisa Giovannetti; Stephen E Girardin; Suzana Gispert; Sandy Giuliano; Candece L Gladson; Alvaro Glavic; Martin Gleave; Nelly Godefroy; Robert M Gogal; Kuppan Gokulan; Gustavo H Goldman; Delia Goletti; Michael S Goligorsky; Aldrin V Gomes; Ligia C Gomes; Hernando Gomez; Candelaria Gomez-Manzano; Rubén Gómez-Sánchez; Dawit Ap Gonçalves; Ebru Goncu; Qingqiu Gong; Céline Gongora; Carlos B Gonzalez; Pedro Gonzalez-Alegre; Pilar Gonzalez-Cabo; Rosa Ana González-Polo; Ing Swie Goping; Carlos Gorbea; Nikolai V Gorbunov; Daphne R Goring; Adrienne M Gorman; Sharon M Gorski; Sandro Goruppi; Shino Goto-Yamada; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Yacine Graba; Martin Graef; Giovanna E Granato; Gary Dean Grant; Steven Grant; Giovanni Luca Gravina; Douglas R Green; Alexander Greenhough; Michael T Greenwood; Benedetto Grimaldi; Frédéric Gros; Charles Grose; Jean-Francois Groulx; Florian Gruber; Paolo Grumati; Tilman Grune; Jun-Lin Guan; Kun-Liang Guan; Barbara Guerra; Carlos Guillen; Kailash Gulshan; Jan Gunst; Chuanyong Guo; Lei Guo; Ming Guo; Wenjie Guo; Xu-Guang Guo; Andrea A Gust; Åsa B Gustafsson; Elaine Gutierrez; Maximiliano G Gutierrez; Ho-Shin Gwak; Albert Haas; James E Haber; Shinji Hadano; Monica Hagedorn; David R Hahn; Andrew J Halayko; Anne Hamacher-Brady; Kozo Hamada; Ahmed Hamai; Andrea Hamann; Maho Hamasaki; Isabelle Hamer; Qutayba Hamid; Ester M Hammond; Feng Han; Weidong Han; James T Handa; John A Hanover; Malene Hansen; Masaru Harada; Ljubica Harhaji-Trajkovic; J Wade Harper; Abdel Halim Harrath; Adrian L Harris; James Harris; Udo Hasler; Peter Hasselblatt; Kazuhisa Hasui; Robert G Hawley; Teresa S Hawley; Congcong He; Cynthia Y He; Fengtian He; Gu He; Rong-Rong He; Xian-Hui He; You-Wen He; Yu-Ying He; Joan K Heath; Marie-Josée Hébert; Robert A Heinzen; Gudmundur Vignir Helgason; Michael Hensel; Elizabeth P Henske; Chengtao Her; Paul K Herman; Agustín Hernández; Carlos Hernandez; Sonia Hernández-Tiedra; Claudio Hetz; P Robin Hiesinger; Katsumi Higaki; Sabine Hilfiker; Bradford G Hill; Joseph A Hill; William D Hill; Keisuke Hino; Daniel Hofius; Paul Hofman; Günter U Höglinger; Jörg Höhfeld; Marina K Holz; Yonggeun Hong; David A Hood; Jeroen Jm Hoozemans; Thorsten Hoppe; Chin Hsu; Chin-Yuan Hsu; Li-Chung Hsu; Dong Hu; Guochang Hu; Hong-Ming Hu; Hongbo Hu; Ming Chang Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Ya Hua; Canhua Huang; Huey-Lan Huang; Kuo-How Huang; Kuo-Yang Huang; Shile Huang; Shiqian Huang; Wei-Pang Huang; Yi-Ran Huang; Yong Huang; Yunfei Huang; Tobias B Huber; Patricia Huebbe; Won-Ki Huh; Juha J Hulmi; Gang Min Hur; James H Hurley; Zvenyslava Husak; Sabah Na Hussain; Salik Hussain; Jung Jin Hwang; Seungmin Hwang; Thomas Is Hwang; Atsuhiro Ichihara; Yuzuru Imai; Carol Imbriano; Megumi Inomata; Takeshi Into; Valentina Iovane; Juan L Iovanna; Renato V Iozzo; Nancy Y Ip; Javier E Irazoqui; Pablo Iribarren; Yoshitaka Isaka; Aleksandra J Isakovic; Harry Ischiropoulos; Jeffrey S Isenberg; Mohammad Ishaq; Hiroyuki Ishida; Isao Ishii; Jane E Ishmael; Ciro Isidoro; Ken-Ichi Isobe; Erika Isono; Shohreh Issazadeh-Navikas; Koji Itahana; Eisuke Itakura; Andrei I Ivanov; Anand Krishnan V Iyer; José M Izquierdo; Yotaro Izumi; Valentina Izzo; Marja Jäättelä; Nadia Jaber; Daniel John Jackson; William T Jackson; Tony George Jacob; Thomas S Jacques; Chinnaswamy Jagannath; Ashish Jain; Nihar Ranjan Jana; Byoung Kuk Jang; Alkesh Jani; Bassam Janji; Paulo Roberto Jannig; Patric J Jansson; Steve Jean; Marina Jendrach; Ju-Hong Jeon; Niels Jessen; Eui-Bae Jeung; Kailiang Jia; Lijun Jia; Hong Jiang; Hongchi Jiang; Liwen Jiang; Teng Jiang; Xiaoyan Jiang; Xuejun Jiang; Xuejun Jiang; Ying Jiang; Yongjun Jiang; Alberto Jiménez; Cheng Jin; Hongchuan Jin; Lei Jin; Meiyan Jin; Shengkan Jin; Umesh Kumar Jinwal; Eun-Kyeong Jo; Terje Johansen; Daniel E Johnson; Gail Vw Johnson; James D Johnson; Eric Jonasch; Chris Jones; Leo Ab Joosten; Joaquin Jordan; Anna-Maria Joseph; Bertrand Joseph; Annie M Joubert; Dianwen Ju; Jingfang Ju; Hsueh-Fen Juan; Katrin Juenemann; Gábor Juhász; Hye Seung Jung; Jae U Jung; Yong-Keun Jung; Heinz Jungbluth; Matthew J Justice; Barry Jutten; Nadeem O Kaakoush; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Bertrand Kaeffer; Katarina Kågedal; Alon Kahana; Shingo Kajimura; Or Kakhlon; Manjula Kalia; Dhan V Kalvakolanu; Yoshiaki Kamada; Konstantinos Kambas; Vitaliy O Kaminskyy; Harm H Kampinga; Mustapha Kandouz; Chanhee Kang; Rui Kang; Tae-Cheon Kang; Tomotake Kanki; Thirumala-Devi Kanneganti; Haruo Kanno; Anumantha G Kanthasamy; Marc Kantorow; Maria Kaparakis-Liaskos; Orsolya Kapuy; Vassiliki Karantza; Md Razaul Karim; Parimal Karmakar; Arthur Kaser; Susmita Kaushik; Thomas Kawula; A Murat Kaynar; Po-Yuan Ke; Zun-Ji Ke; John H Kehrl; Kate E Keller; Jongsook Kim Kemper; Anne K Kenworthy; Oliver Kepp; Andreas Kern; Santosh Kesari; David Kessel; Robin Ketteler; Isis do Carmo Kettelhut; Bilon Khambu; Muzamil Majid Khan; Vinoth Km Khandelwal; Sangeeta Khare; Juliann G Kiang; Amy A Kiger; Akio Kihara; Arianna L Kim; Cheol Hyeon Kim; Deok Ryong Kim; Do-Hyung Kim; Eung Kweon Kim; Hye Young Kim; Hyung-Ryong Kim; Jae-Sung Kim; Jeong Hun Kim; Jin Cheon Kim; Jin Hyoung Kim; Kwang Woon Kim; Michael D Kim; Moon-Moo Kim; Peter K Kim; Seong Who Kim; Soo-Youl Kim; Yong-Sun Kim; Yonghyun Kim; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Jason S King; Karla Kirkegaard; Vladimir Kirkin; Lorrie A Kirshenbaum; Shuji Kishi; Yasuo Kitajima; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Rudolf A Kley; Walter T Klimecki; Michael Klinkenberg; Jochen Klucken; Helene Knævelsrud; Erwin Knecht; Laura Knuppertz; Jiunn-Liang Ko; Satoru Kobayashi; Jan C Koch; Christelle Koechlin-Ramonatxo; Ulrich Koenig; Young Ho Koh; Katja Köhler; Sepp D Kohlwein; Masato Koike; Masaaki Komatsu; Eiki Kominami; Dexin Kong; Hee Jeong Kong; Eumorphia G Konstantakou; Benjamin T Kopp; Tamas Korcsmaros; Laura Korhonen; Viktor I Korolchuk; Nadya V Koshkina; Yanjun Kou; Michael I Koukourakis; Constantinos Koumenis; Attila L Kovács; Tibor Kovács; Werner J Kovacs; Daisuke Koya; Claudine Kraft; Dimitri Krainc; Helmut Kramer; Tamara Kravic-Stevovic; Wilhelm Krek; Carole Kretz-Remy; Roswitha Krick; Malathi Krishnamurthy; Janos Kriston-Vizi; Guido Kroemer; Michael C Kruer; Rejko Kruger; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Christian Kuhn; Addanki Pratap Kumar; Anuj Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Rakesh Kumar; Sharad Kumar; Mondira Kundu; Hsing-Jien Kung; Atsushi Kuno; Sheng-Han Kuo; Jeff Kuret; Tino Kurz; Terry Kwok; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert R La Spada; Frank Lafont; Tim Lahm; Aparna Lakkaraju; Truong Lam; Trond Lamark; Steve Lancel; Terry H Landowski; Darius J R Lane; Jon D Lane; Cinzia Lanzi; Pierre Lapaquette; Louis R Lapierre; Jocelyn Laporte; Johanna Laukkarinen; Gordon W Laurie; Sergio Lavandero; Lena Lavie; Matthew J LaVoie; Betty Yuen Kwan Law; Helen Ka-Wai Law; Kelsey B Law; Robert Layfield; Pedro A Lazo; Laurent Le Cam; Karine G Le Roch; Hervé Le Stunff; Vijittra Leardkamolkarn; Marc Lecuit; Byung-Hoon Lee; Che-Hsin Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Hsinyu Lee; Jae Keun Lee; Jongdae Lee; Ju-Hyun Lee; Jun Hee Lee; Michael Lee; Myung-Shik Lee; Patty J Lee; Sam W Lee; Seung-Jae Lee; Shiow-Ju Lee; Stella Y Lee; Sug Hyung Lee; Sung Sik Lee; Sung-Joon Lee; Sunhee Lee; Ying-Ray Lee; Yong J Lee; Young H Lee; Christiaan Leeuwenburgh; Sylvain Lefort; Renaud Legouis; Jinzhi Lei; Qun-Ying Lei; David A Leib; Gil Leibowitz; Istvan Lekli; Stéphane D Lemaire; John J Lemasters; Marius K Lemberg; Antoinette Lemoine; Shuilong Leng; Guido Lenz; Paola Lenzi; Lilach O Lerman; Daniele Lettieri Barbato; Julia I-Ju Leu; Hing Y Leung; Beth Levine; Patrick A Lewis; Frank Lezoualc'h; Chi Li; Faqiang Li; Feng-Jun Li; Jun Li; Ke Li; Lian Li; Min Li; Min Li; Qiang Li; Rui Li; Sheng Li; Wei Li; Wei Li; Xiaotao Li; Yumin Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Yulin Liao; Joana Liberal; Pawel P Liberski; Pearl Lie; Andrew P Lieberman; Hyunjung Jade Lim; Kah-Leong Lim; Kyu Lim; Raquel T Lima; Chang-Shen Lin; Chiou-Feng Lin; Fang Lin; Fangming Lin; Fu-Cheng Lin; Kui Lin; Kwang-Huei Lin; Pei-Hui Lin; Tianwei Lin; Wan-Wan Lin; Yee-Shin Lin; Yong Lin; Rafael Linden; Dan Lindholm; Lisa M Lindqvist; Paul Lingor; Andreas Linkermann; Lance A Liotta; Marta M Lipinski; Vitor A Lira; Michael P Lisanti; Paloma B Liton; Bo Liu; Chong Liu; Chun-Feng Liu; Fei Liu; Hung-Jen Liu; Jianxun Liu; Jing-Jing Liu; Jing-Lan Liu; Ke Liu; Leyuan Liu; Liang Liu; Quentin Liu; Rong-Yu Liu; Shiming Liu; Shuwen Liu; Wei Liu; Xian-De Liu; Xiangguo Liu; Xiao-Hong Liu; Xinfeng Liu; Xu Liu; Xueqin Liu; Yang Liu; Yule Liu; Zexian Liu; Zhe Liu; Juan P Liuzzi; Gérard Lizard; Mila Ljujic; Irfan J Lodhi; Susan E Logue; Bal L Lokeshwar; Yun Chau Long; Sagar Lonial; Benjamin Loos; Carlos López-Otín; Cristina López-Vicario; Mar Lorente; Philip L Lorenzi; Péter Lõrincz; Marek Los; Michael T Lotze; Penny E Lovat; Binfeng Lu; Bo Lu; Jiahong Lu; Qing Lu; She-Min Lu; Shuyan Lu; Yingying Lu; Frédéric Luciano; Shirley Luckhart; John Milton Lucocq; Paula Ludovico; Aurelia Lugea; Nicholas W Lukacs; Julian J Lum; Anders H Lund; Honglin Luo; Jia Luo; Shouqing Luo; Claudio Luparello; Timothy Lyons; Jianjie Ma; Yi Ma; Yong Ma; Zhenyi Ma; Juliano Machado; Glaucia M Machado-Santelli; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; John D MacMicking; Lee Ann MacMillan-Crow; Frank Madeo; Muniswamy Madesh; Julio Madrigal-Matute; Akiko Maeda; Tatsuya Maeda; Gustavo Maegawa; Emilia Maellaro; Hannelore Maes; Marta Magariños; Kenneth Maiese; Tapas K Maiti; Luigi Maiuri; Maria Chiara Maiuri; Carl G Maki; Roland Malli; Walter Malorni; Alina Maloyan; Fathia Mami-Chouaib; Na Man; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Serge N Manié; Claudia Manzoni; Kai Mao; Zixu Mao; Zong-Wan Mao; Philippe Marambaud; Anna Maria Marconi; Zvonimir Marelja; Gabriella Marfe; Marta Margeta; Eva Margittai; Muriel Mari; Francesca V Mariani; Concepcio Marin; Sara Marinelli; Guillermo Mariño; Ivanka Markovic; Rebecca Marquez; Alberto M Martelli; Sascha Martens; Katie R Martin; Seamus J Martin; Shaun Martin; Miguel A Martin-Acebes; Paloma Martín-Sanz; Camille Martinand-Mari; Wim Martinet; Jennifer Martinez; Nuria Martinez-Lopez; Ubaldo Martinez-Outschoorn; Moisés Martínez-Velázquez; Marta Martinez-Vicente; Waleska Kerllen Martins; Hirosato Mashima; James A Mastrianni; Giuseppe Matarese; Paola Matarrese; Roberto Mateo; Satoaki Matoba; Naomichi Matsumoto; Takehiko Matsushita; Akira Matsuura; Takeshi Matsuzawa; Mark P Mattson; Soledad Matus; Norma Maugeri; Caroline Mauvezin; Andreas Mayer; Dusica Maysinger; Guillermo D Mazzolini; Mary Kate McBrayer; Kimberly McCall; Craig McCormick; Gerald M McInerney; Skye C McIver; Sharon McKenna; John J McMahon; Iain A McNeish; Fatima Mechta-Grigoriou; Jan Paul Medema; Diego L Medina; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Yide Mei; Ute-Christiane Meier; Alfred J Meijer; Alicia Meléndez; Gerry Melino; Sonia Melino; Edesio Jose Tenorio de Melo; Maria A Mena; Marc D Meneghini; Javier A Menendez; Regina Menezes; Liesu Meng; Ling-Hua Meng; Songshu Meng; Rossella Menghini; A Sue Menko; Rubem Fs Menna-Barreto; Manoj B Menon; Marco A Meraz-Ríos; Giuseppe Merla; Luciano Merlini; Angelica M Merlot; Andreas Meryk; Stefania Meschini; Joel N Meyer; Man-Tian Mi; Chao-Yu Miao; Lucia Micale; Simon Michaeli; Carine Michiels; Anna Rita Migliaccio; Anastasia Susie Mihailidou; Dalibor Mijaljica; Katsuhiko Mikoshiba; Enrico Milan; Leonor Miller-Fleming; Gordon B Mills; Ian G Mills; Georgia Minakaki; Berge A Minassian; Xiu-Fen Ming; Farida Minibayeva; Elena A Minina; Justine D Mintern; Saverio Minucci; Antonio Miranda-Vizuete; Claire H Mitchell; Shigeki Miyamoto; Keisuke Miyazawa; Noboru Mizushima; Katarzyna Mnich; Baharia Mograbi; Simin Mohseni; Luis Ferreira Moita; Marco Molinari; Maurizio Molinari; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Marco Mongillo; Martha M Monick; Serena Montagnaro; Craig Montell; Darren J Moore; Michael N Moore; Rodrigo Mora-Rodriguez; Paula I Moreira; Etienne Morel; Maria Beatrice Morelli; Sandra Moreno; Michael J Morgan; Arnaud Moris; Yuji Moriyasu; Janna L Morrison; Lynda A Morrison; Eugenia Morselli; Jorge Moscat; Pope L Moseley; Serge Mostowy; Elisa Motori; Denis Mottet; Jeremy C Mottram; Charbel E-H Moussa; Vassiliki E Mpakou; Hasan Mukhtar; Jean M Mulcahy Levy; Sylviane Muller; Raquel Muñoz-Moreno; Cristina Muñoz-Pinedo; Christian Münz; Maureen E Murphy; James T Murray; Aditya Murthy; Indira U Mysorekar; Ivan R Nabi; Massimo Nabissi; Gustavo A Nader; Yukitoshi Nagahara; Yoshitaka Nagai; Kazuhiro Nagata; Anika Nagelkerke; Péter Nagy; Samisubbu R Naidu; Sreejayan Nair; Hiroyasu Nakano; Hitoshi Nakatogawa; Meera Nanjundan; Gennaro Napolitano; Naweed I Naqvi; Roberta Nardacci; Derek P Narendra; Masashi Narita; Anna Chiara Nascimbeni; Ramesh Natarajan; Luiz C Navegantes; Steffan T Nawrocki; Taras Y Nazarko; Volodymyr Y Nazarko; Thomas Neill; Luca M Neri; Mihai G Netea; Romana T Netea-Maier; Bruno M Neves; Paul A Ney; Ioannis P Nezis; Hang Tt Nguyen; Huu Phuc Nguyen; Anne-Sophie Nicot; Hilde Nilsen; Per Nilsson; Mikio Nishimura; Ichizo Nishino; Mireia Niso-Santano; Hua Niu; Ralph A Nixon; Vincent Co Njar; Takeshi Noda; Angelika A Noegel; Elsie Magdalena Nolte; Erik Norberg; Koenraad K Norga; Sakineh Kazemi Noureini; Shoji Notomi; Lucia Notterpek; Karin Nowikovsky; Nobuyuki Nukina; Thorsten Nürnberger; Valerie B O'Donnell; Tracey O'Donovan; Peter J O'Dwyer; Ina Oehme; Clara L Oeste; Michinaga Ogawa; Besim Ogretmen; Yuji Ogura; Young J Oh; Masaki Ohmuraya; Takayuki Ohshima; Rani Ojha; Koji Okamoto; Toshiro Okazaki; F Javier Oliver; Karin Ollinger; Stefan Olsson; Daniel P Orban; Paulina Ordonez; Idil Orhon; Laszlo Orosz; Eyleen J O'Rourke; Helena Orozco; Angel L Ortega; Elena Ortona; Laura D Osellame; Junko Oshima; Shigeru Oshima; Heinz D Osiewacz; Takanobu Otomo; Kinya Otsu; Jing-Hsiung James Ou; Tiago F Outeiro; Dong-Yun Ouyang; Hongjiao Ouyang; Michael Overholtzer; Michelle A Ozbun; P Hande Ozdinler; Bulent Ozpolat; Consiglia Pacelli; Paolo Paganetti; Guylène Page; Gilles Pages; Ugo Pagnini; Beata Pajak; Stephen C Pak; Karolina Pakos-Zebrucka; Nazzy Pakpour; Zdena Palková; Francesca Palladino; Kathrin Pallauf; Nicolas Pallet; Marta Palmieri; Søren R Paludan; Camilla Palumbo; Silvia Palumbo; Olatz Pampliega; Hongming Pan; Wei Pan; Theocharis Panaretakis; Aseem Pandey; Areti Pantazopoulou; Zuzana Papackova; Daniela L Papademetrio; Issidora Papassideri; Alessio Papini; Nirmala Parajuli; Julian Pardo; Vrajesh V Parekh; Giancarlo Parenti; Jong-In Park; Junsoo Park; Ohkmae K Park; Roy Parker; Rosanna Parlato; Jan B Parys; Katherine R Parzych; Jean-Max Pasquet; Benoit Pasquier; Kishore Bs Pasumarthi; Daniel Patschan; Cam Patterson; Sophie Pattingre; Scott Pattison; Arnim Pause; Hermann Pavenstädt; Flaminia Pavone; Zully Pedrozo; Fernando J Peña; Miguel A Peñalva; Mario Pende; Jianxin Peng; Fabio Penna; Josef M Penninger; Anna Pensalfini; Salvatore Pepe; Gustavo Js Pereira; Paulo C Pereira; Verónica Pérez-de la Cruz; María Esther Pérez-Pérez; Diego Pérez-Rodríguez; Dolores Pérez-Sala; Celine Perier; Andras Perl; David H Perlmutter; Ida Perrotta; Shazib Pervaiz; Maija Pesonen; Jeffrey E Pessin; Godefridus J Peters; Morten Petersen; Irina Petrache; Basil J Petrof; Goran Petrovski; James M Phang; Mauro Piacentini; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Federico Pietrocola; Felipe X Pimentel-Muiños; Mario Pinar; Benjamin Pineda; Ronit Pinkas-Kramarski; Marcello Pinti; Paolo Pinton; Bilal Piperdi; James M Piret; Leonidas C Platanias; Harald W Platta; Edward D Plowey; Stefanie Pöggeler; Marc Poirot; Peter Polčic; Angelo Poletti; Audrey H Poon; Hana Popelka; Blagovesta Popova; Izabela Poprawa; Shibu M Poulose; Joanna Poulton; Scott K Powers; Ted Powers; Mercedes Pozuelo-Rubio; Krisna Prak; Reinhild Prange; Mark Prescott; Muriel Priault; Sharon Prince; Richard L Proia; Tassula Proikas-Cezanne; Holger Prokisch; Vasilis J Promponas; Karin Przyklenk; Rosa Puertollano; Subbiah Pugazhenthi; Luigi Puglielli; Aurora Pujol; Julien Puyal; Dohun Pyeon; Xin Qi; Wen-Bin Qian; Zheng-Hong Qin; Yu Qiu; Ziwei Qu; Joe Quadrilatero; Frederick Quinn; Nina Raben; Hannah Rabinowich; Flavia Radogna; Michael J Ragusa; Mohamed Rahmani; Komal Raina; Sasanka Ramanadham; Rajagopal Ramesh; Abdelhaq Rami; Sarron Randall-Demllo; Felix Randow; Hai Rao; V Ashutosh Rao; Blake B Rasmussen; Tobias M Rasse; Edward A Ratovitski; Pierre-Emmanuel Rautou; Swapan K Ray; Babak Razani; Bruce H Reed; Fulvio Reggiori; Markus Rehm; Andreas S Reichert; Theo Rein; David J Reiner; Eric Reits; Jun Ren; Xingcong Ren; Maurizio Renna; Jane Eb Reusch; Jose L Revuelta; Leticia Reyes; Alireza R Rezaie; Robert I Richards; Des R Richardson; Clémence Richetta; Michael A Riehle; Bertrand H Rihn; Yasuko Rikihisa; Brigit E Riley; Gerald Rimbach; Maria Rita Rippo; Konstantinos Ritis; Federica Rizzi; Elizete Rizzo; Peter J Roach; Jeffrey Robbins; Michel Roberge; Gabriela Roca; Maria Carmela Roccheri; Sonia Rocha; Cecilia Mp Rodrigues; Clara I Rodríguez; Santiago Rodriguez de Cordoba; Natalia Rodriguez-Muela; Jeroen Roelofs; Vladimir V Rogov; Troy T Rohn; Bärbel Rohrer; Davide Romanelli; Luigina Romani; Patricia Silvia Romano; M Isabel G Roncero; Jose Luis Rosa; Alicia Rosello; Kirill V Rosen; Philip Rosenstiel; Magdalena Rost-Roszkowska; Kevin A Roth; Gael Roué; Mustapha Rouis; Kasper M Rouschop; Daniel T Ruan; Diego Ruano; David C Rubinsztein; Edmund B Rucker; Assaf Rudich; Emil Rudolf; Ruediger Rudolf; Markus A Ruegg; Carmen Ruiz-Roldan; Avnika Ashok Ruparelia; Paola Rusmini; David W Russ; Gian Luigi Russo; Giuseppe Russo; Rossella Russo; Tor Erik Rusten; Victoria Ryabovol; Kevin M Ryan; Stefan W Ryter; David M Sabatini; Michael Sacher; Carsten Sachse; Michael N Sack; Junichi Sadoshima; Paul Saftig; Ronit Sagi-Eisenberg; Sumit Sahni; Pothana Saikumar; Tsunenori Saito; Tatsuya Saitoh; Koichi Sakakura; Machiko Sakoh-Nakatogawa; Yasuhito Sakuraba; María Salazar-Roa; Paolo Salomoni; Ashok K Saluja; Paul M Salvaterra; Rosa Salvioli; Afshin Samali; Anthony Mj Sanchez; José A Sánchez-Alcázar; Ricardo Sanchez-Prieto; Marco Sandri; Miguel A Sanjuan; Stefano Santaguida; Laura Santambrogio; Giorgio Santoni; Claudia Nunes Dos Santos; Shweta Saran; Marco Sardiello; Graeme Sargent; Pallabi Sarkar; Sovan Sarkar; Maria Rosa Sarrias; Minnie M Sarwal; Chihiro Sasakawa; Motoko Sasaki; Miklos Sass; Ken Sato; Miyuki Sato; Joseph Satriano; Niramol Savaraj; Svetlana Saveljeva; Liliana Schaefer; Ulrich E Schaible; Michael Scharl; Hermann M Schatzl; Randy Schekman; Wiep Scheper; Alfonso Schiavi; Hyman M Schipper; Hana Schmeisser; Jens Schmidt; Ingo Schmitz; Bianca E Schneider; E Marion Schneider; Jaime L Schneider; Eric A Schon; Miriam J Schönenberger; Axel H Schönthal; Daniel F Schorderet; Bernd Schröder; Sebastian Schuck; Ryan J Schulze; Melanie Schwarten; Thomas L Schwarz; Sebastiano Sciarretta; Kathleen Scotto; A Ivana Scovassi; Robert A Screaton; Mark Screen; Hugo Seca; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Jose M Seguí-Simarro; Juan Segura-Aguilar; Ekihiro Seki; Christian Sell; Iban Seiliez; Clay F Semenkovich; Gregg L Semenza; Utpal Sen; Andreas L Serra; Ana Serrano-Puebla; Hiromi Sesaki; Takao Setoguchi; Carmine Settembre; John J Shacka; Ayesha N Shajahan-Haq; Irving M Shapiro; Shweta Sharma; Hua She; C-K James Shen; Chiung-Chyi Shen; Han-Ming Shen; Sanbing Shen; Weili Shen; Rui Sheng; Xianyong Sheng; Zu-Hang Sheng; Trevor G Shepherd; Junyan Shi; Qiang Shi; Qinghua Shi; Yuguang Shi; Shusaku Shibutani; Kenichi Shibuya; Yoshihiro Shidoji; Jeng-Jer Shieh; Chwen-Ming Shih; Yohta Shimada; Shigeomi Shimizu; Dong Wook Shin; Mari L Shinohara; Michiko Shintani; Takahiro Shintani; Tetsuo Shioi; Ken Shirabe; Ronit Shiri-Sverdlov; Orian Shirihai; Gordon C Shore; Chih-Wen Shu; Deepak Shukla; Andriy A Sibirny; Valentina Sica; Christina J Sigurdson; Einar M Sigurdsson; Puran Singh Sijwali; Beata Sikorska; Wilian A Silveira; Sandrine Silvente-Poirot; Gary A Silverman; Jan Simak; Thomas Simmet; Anna Katharina Simon; Hans-Uwe Simon; Cristiano Simone; Matias Simons; Anne Simonsen; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Debasish Sinha; Sangita Sinha; Frank A Sinicrope; Agnieszka Sirko; Kapil Sirohi; Balindiwe Jn Sishi; Annie Sittler; Parco M Siu; Efthimios Sivridis; Anna Skwarska; Ruth Slack; Iva Slaninová; Nikolai Slavov; Soraya S Smaili; Keiran Sm Smalley; Duncan R Smith; Stefaan J Soenen; Scott A Soleimanpour; Anita Solhaug; Kumaravel Somasundaram; Jin H Son; Avinash Sonawane; Chunjuan Song; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Wei Song; Kai Y Soo; Anil K Sood; Tuck Wah Soong; Virawudh Soontornniyomkij; Maurizio Sorice; Federica Sotgia; David R Soto-Pantoja; Areechun Sotthibundhu; Maria João Sousa; Herman P Spaink; Paul N Span; Anne Spang; Janet D Sparks; Peter G Speck; Stephen A Spector; Claudia D Spies; Wolfdieter Springer; Daret St Clair; Alessandra Stacchiotti; Bart Staels; Michael T Stang; Daniel T Starczynowski; Petro Starokadomskyy; Clemens Steegborn; John W Steele; Leonidas Stefanis; Joan Steffan; Christine M Stellrecht; Harald Stenmark; Tomasz M Stepkowski; Stęphan T Stern; Craig Stevens; Brent R Stockwell; Veronika Stoka; Zuzana Storchova; Björn Stork; Vassilis Stratoulias; Dimitrios J Stravopodis; Pavel Strnad; Anne Marie Strohecker; Anna-Lena Ström; Per Stromhaug; Jiri Stulik; Yu-Xiong Su; Zhaoliang Su; Carlos S Subauste; Srinivasa Subramaniam; Carolyn M Sue; Sang Won Suh; Xinbing Sui; Supawadee Sukseree; David Sulzer; Fang-Lin Sun; Jiaren Sun; Jun Sun; Shi-Yong Sun; Yang Sun; Yi Sun; Yingjie Sun; Vinod Sundaramoorthy; Joseph Sung; Hidekazu Suzuki; Kuninori Suzuki; Naoki Suzuki; Tadashi Suzuki; Yuichiro J Suzuki; Michele S Swanson; Charles Swanton; Karl Swärd; Ghanshyam Swarup; Sean T Sweeney; Paul W Sylvester; Zsuzsanna Szatmari; Eva Szegezdi; Peter W Szlosarek; Heinrich Taegtmeyer; Marco Tafani; Emmanuel Taillebourg; Stephen Wg Tait; Krisztina Takacs-Vellai; Yoshinori Takahashi; Szabolcs Takáts; Genzou Takemura; Nagio Takigawa; Nicholas J Talbot; Elena Tamagno; Jerome Tamburini; Cai-Ping Tan; Lan Tan; Mei Lan Tan; Ming Tan; Yee-Joo Tan; Keiji Tanaka; Masaki Tanaka; Daolin Tang; Dingzhong Tang; Guomei Tang; Isei Tanida; Kunikazu Tanji; Bakhos A Tannous; Jose A Tapia; Inmaculada Tasset-Cuevas; Marc Tatar; Iman Tavassoly; Nektarios Tavernarakis; Allen Taylor; Graham S Taylor; Gregory A Taylor; J Paul Taylor; Mark J Taylor; Elena V Tchetina; Andrew R Tee; Fatima Teixeira-Clerc; Sucheta Telang; Tewin Tencomnao; Ba-Bie Teng; Ru-Jeng Teng; Faraj Terro; Gianluca Tettamanti; Arianne L Theiss; Anne E Theron; Kelly Jean Thomas; Marcos P Thomé; Paul G Thomes; Andrew Thorburn; Jeremy Thorner; Thomas Thum; Michael Thumm; Teresa Lm Thurston; Ling Tian; Andreas Till; Jenny Pan-Yun Ting; Vladimir I Titorenko; Lilach Toker; Stefano Toldo; Sharon A Tooze; Ivan Topisirovic; Maria Lyngaas Torgersen; Liliana Torosantucci; Alicia Torriglia; Maria Rosaria Torrisi; Cathy Tournier; Roberto Towns; Vladimir Trajkovic; Leonardo H Travassos; Gemma Triola; Durga Nand Tripathi; Daniela Trisciuoglio; Rodrigo Troncoso; Ioannis P Trougakos; Anita C Truttmann; Kuen-Jer Tsai; Mario P Tschan; Yi-Hsin Tseng; Takayuki Tsukuba; Allan Tsung; Andrey S Tsvetkov; Shuiping Tu; Hsing-Yu Tuan; Marco Tucci; David A Tumbarello; Boris Turk; Vito Turk; Robin Fb Turner; Anders A Tveita; Suresh C Tyagi; Makoto Ubukata; Yasuo Uchiyama; Andrej Udelnow; Takashi Ueno; Midori Umekawa; Rika Umemiya-Shirafuji; Benjamin R Underwood; Christian Ungermann; Rodrigo P Ureshino; Ryo Ushioda; Vladimir N Uversky; Néstor L Uzcátegui; Thomas Vaccari; Maria I Vaccaro; Libuše Váchová; Helin Vakifahmetoglu-Norberg; Rut Valdor; Enza Maria Valente; Francois Vallette; Angela M Valverde; Greet Van den Berghe; Ludo Van Den Bosch; Gijs R van den Brink; F Gisou van der Goot; Ida J van der Klei; Luc Jw van der Laan; Wouter G van Doorn; Marjolein van Egmond; Kenneth L van Golen; Luc Van Kaer; Menno van Lookeren Campagne; Peter Vandenabeele; Wim Vandenberghe; Ilse Vanhorebeek; Isabel Varela-Nieto; M Helena Vasconcelos; Radovan Vasko; Demetrios G Vavvas; Ignacio Vega-Naredo; Guillermo Velasco; Athanassios D Velentzas; Panagiotis D Velentzas; Tibor Vellai; Edo Vellenga; Mikkel Holm Vendelbo; Kartik Venkatachalam; Natascia Ventura; Salvador Ventura; Patrícia St Veras; Mireille Verdier; Beata G Vertessy; Andrea Viale; Michel Vidal; Helena L A Vieira; Richard D Vierstra; Nadarajah Vigneswaran; Neeraj Vij; Miquel Vila; Margarita Villar; Victor H Villar; Joan Villarroya; Cécile Vindis; Giampietro Viola; Maria Teresa Viscomi; Giovanni Vitale; Dan T Vogl; Olga V Voitsekhovskaja; Clarissa von Haefen; Karin von Schwarzenberg; Daniel E Voth; Valérie Vouret-Craviari; Kristina Vuori; Jatin M Vyas; Christian Waeber; Cheryl Lyn Walker; Mark J Walker; Jochen Walter; Lei Wan; Xiangbo Wan; Bo Wang; Caihong Wang; Chao-Yung Wang; Chengshu Wang; Chenran Wang; Chuangui Wang; Dong Wang; Fen Wang; Fuxin Wang; Guanghui Wang; Hai-Jie Wang; Haichao Wang; Hong-Gang Wang; Hongmin Wang; Horng-Dar Wang; Jing Wang; Junjun Wang; Mei Wang; Mei-Qing Wang; Pei-Yu Wang; Peng Wang; Richard C Wang; Shuo Wang; Ting-Fang Wang; Xian Wang; Xiao-Jia Wang; Xiao-Wei Wang; Xin Wang; Xuejun Wang; Yan Wang; Yanming Wang; Ying Wang; Ying-Jan Wang; Yipeng Wang; Yu Wang; Yu Tian Wang; Yuqing Wang; Zhi-Nong Wang; Pablo Wappner; Carl Ward; Diane McVey Ward; Gary Warnes; Hirotaka Watada; Yoshihisa Watanabe; Kei Watase; Timothy E Weaver; Colin D Weekes; Jiwu Wei; Thomas Weide; Conrad C Weihl; Günther Weindl; Simone Nardin Weis; Longping Wen; Xin Wen; Yunfei Wen; Benedikt Westermann; Cornelia M Weyand; Anthony R White; Eileen White; J Lindsay Whitton; Alexander J Whitworth; Joëlle Wiels; Franziska Wild; Manon E Wildenberg; Tom Wileman; Deepti Srinivas Wilkinson; Simon Wilkinson; Dieter Willbold; Chris Williams; Katherine Williams; Peter R Williamson; Konstanze F Winklhofer; Steven S Witkin; Stephanie E Wohlgemuth; Thomas Wollert; Ernst J Wolvetang; Esther Wong; G William Wong; Richard W Wong; Vincent Kam Wai Wong; Elizabeth A Woodcock; Karen L Wright; Chunlai Wu; Defeng Wu; Gen Sheng Wu; Jian Wu; Junfang Wu; Mian Wu; Min Wu; Shengzhou Wu; William Kk Wu; Yaohua Wu; Zhenlong Wu; Cristina Pr Xavier; Ramnik J Xavier; Gui-Xian Xia; Tian Xia; Weiliang Xia; Yong Xia; Hengyi Xiao; Jian Xiao; Shi Xiao; Wuhan Xiao; Chuan-Ming Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Yuyan Xiong; Chuanshan Xu; Congfeng Xu; Feng Xu; Haoxing Xu; Hongwei Xu; Jian Xu; Jianzhen Xu; Jinxian Xu; Liang Xu; Xiaolei Xu; Yangqing Xu; Ye Xu; Zhi-Xiang Xu; Ziheng Xu; Yu Xue; Takahiro Yamada; Ai Yamamoto; Koji Yamanaka; Shunhei Yamashina; Shigeko Yamashiro; Bing Yan; Bo Yan; Xianghua Yan; Zhen Yan; Yasuo Yanagi; Dun-Sheng Yang; Jin-Ming Yang; Liu Yang; Minghua Yang; Pei-Ming Yang; Peixin Yang; Qian Yang; Wannian Yang; Wei Yuan Yang; Xuesong Yang; Yi Yang; Ying Yang; Zhifen Yang; Zhihong Yang; Meng-Chao Yao; Pamela J Yao; Xiaofeng Yao; Zhenyu Yao; Zhiyuan Yao; Linda S Yasui; Mingxiang Ye; Barry Yedvobnick; Behzad Yeganeh; Elizabeth S Yeh; Patricia L Yeyati; Fan Yi; Long Yi; Xiao-Ming Yin; Calvin K Yip; Yeong-Min Yoo; Young Hyun Yoo; Seung-Yong Yoon; Ken-Ichi Yoshida; Tamotsu Yoshimori; Ken H Young; Huixin Yu; Jane J Yu; Jin-Tai Yu; Jun Yu; Li Yu; W Haung Yu; Xiao-Fang Yu; Zhengping Yu; Junying Yuan; Zhi-Min Yuan; Beatrice Yjt Yue; Jianbo Yue; Zhenyu Yue; David N Zacks; Eldad Zacksenhaus; Nadia Zaffaroni; Tania Zaglia; Zahra Zakeri; Vincent Zecchini; Jinsheng Zeng; Min Zeng; Qi Zeng; Antonis S Zervos; Donna D Zhang; Fan Zhang; Guo Zhang; Guo-Chang Zhang; Hao Zhang; Hong Zhang; Hong Zhang; Hongbing Zhang; Jian Zhang; Jian Zhang; Jiangwei Zhang; Jianhua Zhang; Jing-Pu Zhang; Li Zhang; Lin Zhang; Lin Zhang; Long Zhang; Ming-Yong Zhang; Xiangnan Zhang; Xu Dong Zhang; Yan Zhang; Yang Zhang; Yanjin Zhang; Yingmei Zhang; Yunjiao Zhang; Mei Zhao; Wei-Li Zhao; Xiaonan Zhao; Yan G Zhao; Ying Zhao; Yongchao Zhao; Yu-Xia Zhao; Zhendong Zhao; Zhizhuang J Zhao; Dexian Zheng; Xi-Long Zheng; Xiaoxiang Zheng; Boris Zhivotovsky; Qing Zhong; Guang-Zhou Zhou; Guofei Zhou; Huiping Zhou; Shu-Feng Zhou; Xu-Jie Zhou; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Wenhua Zhu; Xiao-Feng Zhu; Yuhua Zhu; Shi-Mei Zhuang; Xiaohong Zhuang; Elio Ziparo; Christos E Zois; Teresa Zoladek; Wei-Xing Zong; Antonio Zorzano; Susu M Zughaier Journal: Autophagy Date: 2016 Impact factor: 16.016
Authors: Jaime Agudo-Canalejo; Sebastian W Schultz; Haruka Chino; Simona M Migliano; Chieko Saito; Ikuko Koyama-Honda; Harald Stenmark; Andreas Brech; Alexander I May; Noboru Mizushima; Roland L Knorr Journal: Nature Date: 2021-01-20 Impact factor: 49.962
Authors: Tzu-Huai Lin; Dana M Bis-Brewer; Amy E Sheehan; Louise N Townsend; Daniel C Maddison; Stephan Züchner; Gaynor A Smith; Marc R Freeman Journal: Proc Natl Acad Sci U S A Date: 2021-05-18 Impact factor: 11.205