Literature DB >> 31311552

Temporal changes in Plasmodium falciparum reticulocyte binding protein homolog 2b (PfRh2b) in Senegal and The Gambia.

Cyrille K Diédhiou1,2, Rahama A Moussa2, Amy K Bei2,3,4, Rachel Daniels3, Nasserdine Papa Mze1,2, Daouda Ndiaye4, Ngor Faye5, Dyann Wirth3, Alfred Amambua-Ngwa6, Souleymane Mboup1, Ambroise D Ahouidi7,8.   

Abstract

BACKGROUND: The Plasmodium falciparum reticulocyte binding protein homolog 2b (PfRh2b) is an important P. falciparum merozoite ligand that mediates invasion of erythrocytes by interacting with a chymotrypsin-sensitive "receptor Z". A large deletion polymorphism is found in the c-terminal ectodomain of this protein in many countries around the world, resulting in a truncated, but expressed protein. The varying frequencies by region suggest that there could be region specific immune selection at this locus. Therefore, this study was designed to determine temporal changes in the PfRh2b deletion polymorphism in infected individuals from Thiès (Senegal) and Western Gambia (The Gambia). It was also sought to determine the selective pressures acting at this locus and whether prevalence of the deletion in isolates genotyped by a 24-SNP molecular barcode is linked to background genotype or whether there might be independent selection acting at this locus.
METHODS: Infected blood samples were sourced from archives of previous studies conducted between 2007 and 2013 at SLAP clinic in Thiès and from 1984 to 2013 in Western Gambia by MRC Unit at LSHTM, The Gambia. A total of 1380 samples were screened for the dimorphic alleles of the PfRh2b using semi-nested Polymerase Chain Reaction PCR. Samples from Thiès were previously barcoded.
RESULTS: In Thiès, a consistent trend of decreasing prevalence of the PfRh2b deletion over time was observed: from 66.54% in 2007 and to 38.1% in 2013. In contrast, in Western Gambia, the frequency of the deletion fluctuated over time; it increased between 1984 and 2005 from (58.04%) to (69.33%) and decreased to 47.47% in 2007. Between 2007 and 2012, the prevalence of this deletion increased significantly from 47.47 to 83.02% and finally declined significantly to 57.94% in 2013. Association between the presence of this deletion and age was found in Thiès, however, not in Western Gambia. For the majority of isolates, the PfRh2b alleles could be tracked with specific 24-SNP barcoded genotype, indicating a lack of independent selection at this locus.
CONCLUSION: PfRh2b deletion was found in the two countries with varying prevalence during the study period. However, these temporal and spatial variations could be an obstacle to the implementation of this protein as a potential vaccine candidate.

Entities:  

Keywords:  Gambia; PfRh2b; Plasmodium falciparum; SNPs; Senegal

Mesh:

Substances:

Year:  2019        PMID: 31311552      PMCID: PMC6636118          DOI: 10.1186/s12936-019-2868-x

Source DB:  PubMed          Journal:  Malar J        ISSN: 1475-2875            Impact factor:   2.979


Background

Despite significant efforts and progress directed towards malaria prevention and control, malaria from Plasmodium falciparum parasite infection remains a major global health challenge. This is due to multiple factors, including insecticide resistance in anopheline vectors, the emergence and rapid spread of drug-resistant parasite strains and especially the lack of an effective vaccine. Therefore, the development of an effective malaria vaccine remains critical for malaria eradication. However, efforts at developing a malaria vaccine have been hampered by the extensive genetic diversity in malaria parasite populations and allele specific immunity in endemic human populations [1, 2]. Characterization of genetic polymorphisms in key vaccine antigens of P. falciparum will enable a better understanding of the molecular evolution of parasite populations that could affect efficacy of future vaccines [3]. Plasmodium falciparum Reticulocyte binding protein homologues (PfRhs) are expressed at the apical surface of invasive merozoite [4-7] and are believed to play a role in the recognition of the erythrocyte and in tight junction formation [8]. Towards design of a vaccine, several studies are looking at the immunity and diversity of the PfRh family of proteins [6, 8–13]. There are five functional PfRh genes: P. falciparum Reticulocyte-binding protein homolog 1 (PfRh1) [14, 15], PfRh2a, PfRh2b [16-18], PfRh4 [19, 20], and PfRh5 [21-23]. Two members of the P. falciparum Rh ligands, PfRh2a and PfRh2b, are important mediators of parasite invasion. PfRh2b mediates invasion by interacting with a chymotrypsin-sensitive erythrocyte receptor Z [24]. These proteins are currently being assessed as invasion-blocking vaccine candidates [11, 25]. However, they differ structurally at the c-terminal. The c-terminal region of PfRh2b gene presents a large structural polymorphism (0.58 kb) and this was found at high frequencies in field isolates from different areas of Africa [10, 26, 27]. The prevalence of this deletion was characterized for the first time in 2006 in parasite populations from different areas [10]. However, the prevalence and evolution of the PfRh2b protein as malaria declines remains unknown. Understanding the changes over time in the frequencies of allelic variants in potential vaccine candidate will be important, as these changes could affect the efficacy of a candidate vaccine. Therefore, it is important to assess temporal changes in the PfRh2b gene and prevalence of the dimorphic alleles PfRh2b deletion (PfRh2bdel) over time in endemic populations. As shown for Thiès, in Senegal, neutral single nucleotide polymorphism (SNP) markers can sensitively determine temporal changes in P. falciparum genotypic diversity [28]. There are extensive hotspots of diversity across the genome, mostly within genes exposed on the surface of the parasite and erythrocyte, including invasion ligands. These ligands are a target of immune responses and remain a major focus for development of a blood stage vaccine [29, 30]. As the frequency of genotypes changes as well as the PfRh2b alleles, the prevalence of the deletion was determined using molecular barcode to examine whether allelic frequencies are strictly related to barcode haplotype clusters or independent selection at the PfRh2b locus could be driving frequencies in the population. This provides data relevant for further consideration of PfRh2b and other structurally variant proteins as targets for vaccine development.

Methods

Study sites and Plasmodium falciparum field isolates

Archived P. falciparum DNA samples from infected blood samples of consenting individuals were sourced from previous studies conducted between 2007 and 2013 at the Service de Lutte Anti-Parasitaire (SLAP) clinic in Thiès (70 km from Dakar, the capital city of Senegal) and from 1984 to 2013 in Western Gambia. Overall, malaria prevalence is moderate in The Gambia with high seasonal transmission [31, 32]. In contrast, Thiès is characterized by a perennial hypo-endemic transmission. These studies had received ethical approval from the Institutional Review Boards of the Harvard School of Public Health, the Ethics Committee of the Ministry of Health in Senegal and the Joint Gambian Government/MRCG Ethics Committee. A total of 1380 (849 from Thiès and 531 from Western Gambia) P. falciparum malaria infected blood samples were analysed. Among the Thiès samples, 580 that has been previously genotyped using a molecular barcode of 24 SNPs by Daniels et al. [33] were used for determining the association between alleles of PfRh2b and the specific barcode of parasite.

PfRh2b genotyping

Semi-nested PCR method, as described previously [10], was used to amplify an PfRh2b gene fragment including the deletion in all extracted DNA samples. A positive control (P. falciparum laboratory cloned line 3D7) and negative control (reagent grade water) were included in all PCR amplifications. The size of the PCR products was estimated using Gene Ruler 100 bp DNA ladder marker (Quick Load®, 100pb DNA Ladder).

Statistical analysis

For continuous variables median and interquartile range were calculated, while for categorical variables, the proportion or prevalence of the outcome with 95% CI was calculated. For each year, to take into account the prevalence in mixed genotype isolates, the prevalence of PfRh2b full-length and PfRh2b deletion was calculated as follows: (number of PfRh2b allele isolates + (0.5 * number of mixed isolates))/total number of isolates [10]. The Chi square linear trends was used to determine if the differences in frequency over the years was statistically significant. Differences between groups were assessed using Mann–Whitney U-test. Wright’s fixation index (Fst) was also calculated to assess the extent of genetic differentiation of PfRh2b polymorphism in Thiès and Western Gambia over time.

Results

Evolution of the prevalence of PfRh2b deletion in fields isolates from Thiès and Western Gambia

In Thiès, the prevalence of the deletion decreased significantly from 66.54% in 2007 to 38.1% in 2013 (P < 0.0001). This decline was not homogeneous with the presence of a peak in 2012, where PfRh2bdel form was present in 43.62% of infections (Fig. 1a).
Fig. 1

Evolution of PfRh2b deletion in Thiès (a) and Western Gambia (b). Scheme showing the variation in the prevalence of PfRh2b deletion over the time, including mixed infections (PfRh2 full-length and PfRh2b deletion) in both areas using formula described previously by Ahouidi et al. [10]. Alleles frequencies of the dimorphic PfRh2b gene were determined using semi-nested Polymerase Chain Reaction (PCR). a A decrease of PfRh2b deletion from 2007 to 2013 in Thiès was noted. b A fluctuation of this deletion from 1984 to 2013 in The Gambia was observed. N, number of isolates; Del, deletion

Evolution of PfRh2b deletion in Thiès (a) and Western Gambia (b). Scheme showing the variation in the prevalence of PfRh2b deletion over the time, including mixed infections (PfRh2 full-length and PfRh2b deletion) in both areas using formula described previously by Ahouidi et al. [10]. Alleles frequencies of the dimorphic PfRh2b gene were determined using semi-nested Polymerase Chain Reaction (PCR). a A decrease of PfRh2b deletion from 2007 to 2013 in Thiès was noted. b A fluctuation of this deletion from 1984 to 2013 in The Gambia was observed. N, number of isolates; Del, deletion In Western Gambia, temporal variation in prevalence in PfRh2b deletion was observed between 1984 and 2013. The prevalence of PfRh2b deletion increased between 1984 and 2005 from (58.04%) to (69.33%) (P = 0.03). From 2005 to 2007 there was a decline of the deletion to (47.47%) (P = 0.004). Between 2007 and 2012, the prevalence of this deletion increased significantly from 47.47 to 83.02% (P = 0.00005) and finally declined significantly to 57.94% in 2013 (P = 0.001) (Fig. 1b). Since mixed infections are uncommon in endemic populations, the frequency of infections with both deleted and full-length parasites (mixed) was determined. The result was highest in 2007 (0.10) and lowest in 2009 (0.02) in Thiès. In Western Gambia, mixed infections were most common in the earliest population from 1984 (0.23) and lowest in 2008 with (0.04) (Additional file 1: Table S1). Overall, a significant decrease of the prevalence of PfRh2b deletion from 2007 to 2013 in Thiès (P < 0.0001) and fluctuating prevalence from 1984 to 2013 in Western Gambia were observed.

Prevalence of PfRh2b deletion according to age in Thiès and western Gambia

The presence of the deletion at high frequency in the general population and the acquisition of antibodies in an age-dependent manner against the c-terminal region of PfRh2b [10], have raised the interest to determine the prevalence of the deletion by age-group to see if the deletion would be more frequent in adults since they are long exposed. Thus, among the 1380 Plasmodium isolates assayed, 934 samples were available for age data and were analysed (651 from Thiès and 283 from Western Gambia). A median age was used to divide each population into two numerically equal groups. In Thiès, since the study population mainly consists of adults (62%), the median age of the 651 patients was 18 years. Thus, the PfRh2b deletion form was less common in children compared to older patients (Fig. 2a). Using the Mann–Whitney U-test, a significant difference in the presence of PfRh2b deletion was found (P = 0.037), suggesting that there is an association between age and the presence of this deletion in Thiès.
Fig. 2

Percentage of PfRh2b deletion according to age groups in Thiès (a) and Western Gambia (b). Variation in the presence of PfRh2b deletion according to age of patients from two distinct populations. a In Thiès, the median age of the 651 Patients was 18 years. A significant difference in the presence of PfRh2b deletion was observed (P = 0,037). b In Western Gambia, the median age of the 283 Patients was 5 years. No difference in the presence of PfRh2b deletion was found (P = 0.316). P, P value; ns, not significant; Del, deletion

Percentage of PfRh2b deletion according to age groups in Thiès (a) and Western Gambia (b). Variation in the presence of PfRh2b deletion according to age of patients from two distinct populations. a In Thiès, the median age of the 651 Patients was 18 years. A significant difference in the presence of PfRh2b deletion was observed (P = 0,037). b In Western Gambia, the median age of the 283 Patients was 5 years. No difference in the presence of PfRh2b deletion was found (P = 0.316). P, P value; ns, not significant; Del, deletion In contrast, in Western Gambia, the population study is consisting of children (under 16 years of age); the median age of the 283 patients was 5 years. The PfRh2b deletion was more common in younger children compared to older children (Fig. 2b), but the difference is not significant by the Mann–Whitney U-test (P = 0.316).

Temporal differentiation of PfRh2b polymorphisms in Senegal and Gambia populations

Genetic diversity of the genes in natural parasites populations is a real obstacle for the validation of potential vaccine candidate. In this study, the degree of divergence to which PfRh2b gene is subject to selection was estimated by calculating Fst from the allelic frequencies of this locus according to years. In Senegal the Fst value obtained from 2007 to 2013 was high (0.09), suggesting high degree of allelic divergence in this region over the time. In contrast, the Fst value obtained in The Gambia from 1984 to 2013 was low (0.057), suggesting less genetic differentiation of these alleles in this area over the time (Table 1).
Table 1

Allele frequencies used to calculate Fst according to years

YearsTHIESWESTERN GAMBIA
PfRh2bdel PfRh2bfull Gene diversity (h) PfRh2bdel PfRh2bfull Gene diversity (h)
19840.580.420.487
20050.690.310.428
20070.670.330.4420.470.530.498
20080.650.350.4550.660.340.449
20090.580.420.487
20100.390.610.3720.730.270.394
20110.370.630.466
20120.440.560.4930.830.170.282
20130.380.620.4710.580.420.487
Average0.4970.5030.4550.6480.3510.432
Fst = 0.09Fst = 0.057

Temporal differentiation of PfRh2b polymorphism in Thiès and Western Gambia populations. Fst value was calculated to assess the extent of temporal variation in the frequencies of PfRh2b alleles in both areas. The overall estimated value of Fst from 2007 to 2013 in Thiès was 0.09. In Western Gambia the Fst value from 1984 to 2013 was 0.057

Fst, wright’s fixation index; h, gene diversity

Allele frequencies used to calculate Fst according to years Temporal differentiation of PfRh2b polymorphism in Thiès and Western Gambia populations. Fst value was calculated to assess the extent of temporal variation in the frequencies of PfRh2b alleles in both areas. The overall estimated value of Fst from 2007 to 2013 in Thiès was 0.09. In Western Gambia the Fst value from 1984 to 2013 was 0.057 Fst, wright’s fixation index; h, gene diversity

Prevalence of PfRh2b in isolates grouped by molecular barcode

It has been observed by barcoding in Thiès that the parasite, having undergone various interventions and pressures, has adapted by evolving towards to a type of parasite [28]. It is also assumed that parasite, initially having the PfRh2b full-length, has adapted by presenting the deletion following the different pressures. To test the hypothesis that the parasite with PfRh2b deletion may be linked by specific cluster, the prevalence of PfRh2b deletion according to molecular barcode was determined. Among the samples that were analysed for PfRh2b polymorphism, 580 from Thiès had been previously genotyped using the 24-SNP barcode [33] and the results were classified into two groups: a group named “cluster” which includes the samples having similarities with at least one other isolate in their nucleotide sequences and a group called “unique” grouping parasites with unique SNP barcode. 41.73% (242/580) of samples belonged to the cluster-group and 58.27% (338/580) were in the unique group (Table 2).
Table 2

Nucleotide sequence of haplotype clusters in Thiès

Haplotype clusterMolecular barcodesN (%)N (isolats)PfRh2bdel (%)PfRh2bfull (%)
Haplotype cluster 36CACTGCAGACCGCACCCAAGCCTG0.34521000
Haplotype cluster 38CACTCGAGATCGTCACCACGCTTG0.34520100
Haplotype cluster 45TATTCCGGTCCGTCCCCTCGCTTG0.34521000
Haplotype cluster 51TACTCCGGTTCGCACACACGACTG0.34521000
Haplotype cluster 49TATTCGAAATCGCACCCTAGATTG0.34521000
Haplotype cluster 48TACTCCAGTCCATACACACGATTG0.34521000
Haplotype cluster 46TACTGCAGATTGTACCCAAAACTG0.34525050
Haplotype cluster 57CACTGCGGATTGTACCTAAGACTG0.34525050
Haplotype cluster 54CGCTCCAGACTACACCCTAAACTG0.34520100
Haplotype cluster 53TACTCCGGATTGTCACCAAGACTG0.34521000
Haplotype cluster 59TACTCCGGTTTATACCTTAGACTG0.34520100
Haplotype cluster 61TACCGGAGTCCGTACCTAAGCCTG0.34520100
Haplotype cluster 15TACTCCGGTTCGTAAACTCGCCTG0.34525050
Haplotype cluster 63TACTCCAGACCGCCCCTAAAATTG0.34520100
Haplotype cluster 9TATTCCAGATXGCAACTTCGACTG0.34521000
Haplotype cluster 62TACTCGAGACTGCNCATACACTTG0.34520100
Haplotype cluster 13TACTCGAAACTXCCCATAAGCTTG0.34520100
Haplotype cluster 68TACCCCGGACCACCAATAAGACTG0.34520100
Haplotype cluster 69TACTGGGATCCGCACCTAAGACTG0.34520100
Haplotype cluster 67CACTCCGGATTGCCACTTAGATTG0.34525050
Haplotype cluster 70TATTCCGGACXACACACTAGCTTG0.34520100
Haplotype cluster 22TACTCCGGATCGCACCCTAGATTG0.34525050
Haplotype cluster 74TACTCCAGACTATCCATTCGATTG0.34525050
Haplotype cluster 71CACTCGGGATTXCCACTAAGCTTG0.34520100
Haplotype cluster 80CATTCCAGTCCXCCAATAAGATTG0.34520100
Haplotype cluster 72TATTGGGGATCGCAACCAAGATTG0.34521000
Haplotype cluster 77TACTGGAGTCCGTACCTTAGCTTG0.34525050
Haplotype cluster 97CACTCGAAATXATACCTTAGCTTG0.34525050
Haplotype cluster 87TACTCGGGTCTATAAATAAGACTG0.34520100
Haplotype cluster 89TACTCGAGTTTATACCTTAGACTG0.34520100
Haplotype cluster 92TATTGCAGTCCXCAAATAAGCTTG0.34520100
Haplotype cluster 84CACTCCAGTCCACCACNTAGATTG0.34521000
Haplotype cluster 96TATTCCAGACCGCACATTAGCCTG0.34525050
Haplotype cluster 93TACTCCAGTCCGTCACTTAGACTG0.34521000
Haplotype cluster 44TACTCCAGACTACAACTACGCCTG0.34520100
Haplotype cluster 43TATTCCAGATTGCAACTTCGCCTG0.51731000
Haplotype cluster 58CACTCGAGTTXACAACCTAGCCTG0.51733367
Haplotype cluster 7CACTCCGGATTGCCACTAAGATTG0.51733367
Haplotype cluster 19TATTCGAGTCTACACCTTCACTTG0.51731000
Haplotype cluster 21TACCCCGGTCCACCACTAAAATTG0.51730100
Haplotype cluster 23CACCCGAGTCCACCAACAAGACTG0.51730100
Haplotype cluster 95CACCCCGAATCXCACCTAAGACTG0.51730100
Haplotype cluster 99TACTCCGAACTGCACATTAGATTG0.51731000
Haplotype cluster 55TACTCCGGTTTGCACACACGACTG0.6941000
Haplotype cluster 64TACTCGAGATXATACATACACTTG0.6940100
Haplotype cluster 10CATTGCGATCTGCAACCTAAACTG0.6941000
Haplotype cluster 24CATTCCAGTCCXCCCATTAGATTG0.6942575
Haplotype cluster 81TACTCCAGATCGCACCCAAGCCTG0.6947525
Haplotype cluster 98CACTCGAGTTTACAACTAAGATTG0.6942575
Haplotype cluster 5TACTCGAAACTGCCCATAAGCTTG0.6940100
Haplotype cluster 65CACTCCAAATCGTACCTTAGATTG0.86251000
Haplotype cluster 8TACCCCGGTCCACACCTTAACTTG0.86251000
Haplotype cluster 11TACTCGAGATCATACATACACTTG0.86250100
Haplotype cluster 12CACTGCGATCTGCAACCTAAACTG0.86251000
Haplotype cluster 6CATTCCAGTCCGCCAATAAGATTG1.03460100
Haplotype cluster 26CACTCCAGTCCGTCACCAAGATTG1.03461783
Haplotype cluster 17TACCCCGGTCCACCAATAAGATTG1.20770100
Haplotype cluster 16TACTCCAGATTACAACCTAGCCTG1.20771000
Haplotype cluster 66TGTTCCAGTTTATCACCACGCCTG1.379812.5087.50
Haplotype cluster 18TATTCCAGTCCACCCATAAGACTG1.55298911
Haplotype cluster 4TACTCCGGTTXGCACACACGACTG2.586151000
Haplotype cluster 29TACCCCGGTCCACCAATAAGACTG7.241429.5090.50
UNIQUES58.2733849.1150.89

N, number of isolates; PfRh2bdel, deletion present; PfRh2bfull, full-length sequence

Nucleotide sequence of haplotype clusters in Thiès N, number of isolates; PfRh2bdel, deletion present; PfRh2bfull, full-length sequence No significant difference in the frequency of PfRh2b deletion between the cluster-group and the unique group was found (P = 0.5014). Among the 338 isolates having unique barcodes, 166 (49.11%) had the deletion and 172 (50.89%) had the full-length fragment of PfRh2b gene. Therefore, both alleles PfRh2b deletion and PfRh2b full-length, had a similar distribution within the unique genotype group. Furthermore, all the 242 isolates belonging to the cluster-group were also tested to assess the frequency of PfRh2b alleles. In this group, 62 distinct subgroups were identified. The results showed that 20 haplotype clusters had only the deletion variant of PfRh2b gene, 24 subgroups had only the full-length fragment and the remaining 18 subgroups were parasites having the deletion and full-length (Table 2). The number of samples is differently distributed in each of the 20 haplotype clusters with the deletion, and this distribution varies also over time (Table 3). Evolution over time of the 20 haplotype clusters containing only the PfRh2b deletion shows a decrease of the prevalence between 2008 and 2010 as well as a slight increase between 2010 and 2013 (Fig. 3). Since the numbers in the majority of the cluster group with the PfRh2b deletion are limited, haplotypes with n > 5 were examined further (haplotype 4 and 16) (Fig. 4). Haplotype cluster 4 with the deletion was found in 2008 (n = 12) and 2009 (n = 3), but not in the other years. Meanwhile, haplotype cluster 16 with the deletion was present in 2011 (n = 1), and 2012 (n = 6), but not in the other years (Fig. 5). The analysis of the results over time suggests that the frequency of PfRh2b deletion is related to the presence of some haplotype clusters in this population.
Table 3

Frequency of the deletion over time within each cluster that contain only the deletion

Fig. 3

Evolution over time of PfRh2b deletion in haplotype clusters having only the deletion in Thiès

Fig. 4

Percentage of isolates of cluster-group and unique based on PfRh2b polymorphism in Thiès. Scheme showing the association between the polymorphism of PfRh2b gene and specific barcode of parasite. “Haplotype clusters” which had n = 4 samples were represented. Haplotype cluster 55; 10; 65; 8; 12; 16 and 4 had only the deletion of PfRh2b gene (Blue pie chart); Haplotype cluster 64; 5; 11; 6 and 17 had only the full-length fragment (orange pie chart). The remaining (Haplotype cluster 24; 31; 98; 26; 66; 18 and 29) were parasites having deletion and full-length alleles. The last pie chart (with n = 338) represented the parasites with unique barcode. Del, deletion; Full, full-length sequence; n, number of isolates

Fig. 5

Frequency of deletion by year in haplotype clusters 4 and 16. Monitoring of the population frequency and PfRh2b alleles frequencies of haplotype cluster 4 and 16 over the time. a Haplotype cluster 4 was found in 2008 (n = 12) and 2009 (n = 3), but not in the other years. b Haplotype cluster 16 was present in 2011 (n = 1) and 2012 (n = 6), but not in the other years. Del, deletion; Full, full-length sequence; n, number of isolates

Frequency of the deletion over time within each cluster that contain only the deletion Evolution over time of PfRh2b deletion in haplotype clusters having only the deletion in Thiès Percentage of isolates of cluster-group and unique based on PfRh2b polymorphism in Thiès. Scheme showing the association between the polymorphism of PfRh2b gene and specific barcode of parasite. “Haplotype clusters” which had n = 4 samples were represented. Haplotype cluster 55; 10; 65; 8; 12; 16 and 4 had only the deletion of PfRh2b gene (Blue pie chart); Haplotype cluster 64; 5; 11; 6 and 17 had only the full-length fragment (orange pie chart). The remaining (Haplotype cluster 24; 31; 98; 26; 66; 18 and 29) were parasites having deletion and full-length alleles. The last pie chart (with n = 338) represented the parasites with unique barcode. Del, deletion; Full, full-length sequence; n, number of isolates Frequency of deletion by year in haplotype clusters 4 and 16. Monitoring of the population frequency and PfRh2b alleles frequencies of haplotype cluster 4 and 16 over the time. a Haplotype cluster 4 was found in 2008 (n = 12) and 2009 (n = 3), but not in the other years. b Haplotype cluster 16 was present in 2011 (n = 1) and 2012 (n = 6), but not in the other years. Del, deletion; Full, full-length sequence; n, number of isolates

Discussion

Plasmodium falciparum reticulocyte binding protein homolog 2b (PfRh2b), has been reported to present a large structural polymorphism (0.58 kb deletion) in the c-terminal region. It is an important target of immunity [10] and could be considered as a potential candidate for blood stage vaccine development. Previous works showed that PfRh2b deletion was highly prevalent in isolates from Senegal and Africa [10, 26, 27] and present in different populations of the world [10]. However, malaria prevalence has been declining and interventions are taking place across sub-Saharan Africa. As these may be selecting for parasite subtypes, the changes imposed on this PfRh2b protein remains unknown. Therefore, the goal of this study was to follow the temporal evolution of the prevalence of PfRh2b deletion using samples from 2007 to 2013 in Thiès and from 1984 to 2013 in Western Gambia. For the two populations, the prevalence of the deletion variant of PfRh2b ranged from 30 to 80%. However, while the prevalence of this deletion declined in Senegal, there was a steady increase in the Gambian populations studied until 2012. The differences in the trends between the two countries and within each country can be the result in random shifts in parasite allele frequencies in different geographic region due to genetic drift in isolated populations. Other explanations could be the genetic background of the host, the environmental modification, immune pressure, drug pressure and or drug resistance [28, 34]. Furthermore, the prevalence of PfRh2b deletion in different age groups in Thiès showed that the deletion was significantly less present in children compared to older patients. In Western Gambia, the prevalence of PfRh2b deletion was more common in younger children compared to older children, but the difference is not significant. With those results observed in these two sites, the association between age and deletion is not clear. However, a previous study did not find a relation between age and deletion [10]. Moreover, the evaluation of temporal variation of PfRh2b polymorphism in Senegal and Gambia populations was performed by using Fst to estimate the degree by which this locus is subject to a selection. Indeed, selection intensity can lead to differences in diversity and generate divergence among natural populations. Thus, the Fst value (0.09) in Thiès, from 2007 to 2013 is higher than those observed for PfRh2b, Msp2, EBA 175 and Pfs48/45 within Senegal and between African countries [10]. However, this Fst value was lower than those observed for Msp2 and EBA 175 dimorphisms, which has been reported to exhibit less genetic differentiation and possible balancing selection in the global populations (African, South East Asian and Latin American populations) [10]. In Western Gambia, the Fst value was low and similar to that observed for the EBA 175 dimorphism within Senegal, which has been shown to have also minimal genetic differentiation globally [10]. Overall, the Fst values obtained in this study indicate less genetic differentiation suggesting that PfRh2b polymorphism is under balancing selection over time in Thiès and Western Gambia. Additionally, the prevalence of PfRh2b deletion according to the molecular barcode of isolates from Thiès was analysed to determine whether the deletion is associated with a specific barcode in this region. Analysis of the distribution of PfRh2b polymorphism in shared barcode clusters suggests that deletion is associated at some haplotype clusters in the population. However, the removal of large clusters from the population do not effect the prevalence of the deletion over time. The results of the study provide information on the genetic diversity of the PfRh2b gene that could be useful in the validation of this antigen as a potential vaccine candidate.

Conclusion

Temporal trends in the frequency of the deleted PfRh2b variant differed in Senegal and The Gambia. This may suggest an effect of local factors on the prevalence of PfRh2b deletion between the years. Changes in the frequency of PfRh2b polymorphism over the time could be an obstacle to the implementation of this protein as a potential vaccine candidate as allele specific immunity may affect its efficacy. It will be important to investigate the natural antibodies responses against PfRh2b over the time in different malaria endemic countries to evaluate this antigen as a vaccine candidate. Additional file 1: Table S1. Number of samples by year of PfRh2b polymorphism in Thiès and Western Gambia. Column N shows the number of samples analysed. n = the number of samples of each allele. PfRh2bdel = deletion present; PfRh2bfull = full-length sequence; Mix = PfRh2bDel/PfRh2bfull.
  34 in total

1.  Gene structure and expression of a Plasmodium falciparum 220-kDa protein homologous to the Plasmodium vivax reticulocyte binding proteins.

Authors:  Osamu Kaneko; Jianbing Mu; Takafumi Tsuboi; Xinzhuan Su; Motomi Torii
Journal:  Mol Biochem Parasitol       Date:  2002-05       Impact factor: 1.759

2.  Identification of proteins from Plasmodium falciparum that are homologous to reticulocyte binding proteins in Plasmodium vivax.

Authors:  T Triglia; J Thompson; S R Caruana; M Delorenzi; T Speed; A F Cowman
Journal:  Infect Immun       Date:  2001-02       Impact factor: 3.441

3.  Two Plasmodium falciparum genes express merozoite proteins that are related to Plasmodium vivax and Plasmodium yoelii adhesive proteins involved in host cell selection and invasion.

Authors:  J C Rayner; M R Galinski; P Ingravallo; J W Barnwell
Journal:  Proc Natl Acad Sci U S A       Date:  2000-08-15       Impact factor: 11.205

Review 4.  The mechanisms of resistance to antimalarial drugs in Plasmodium falciparum.

Authors:  Jacques Le Bras; Rémy Durand
Journal:  Fundam Clin Pharmacol       Date:  2003-04       Impact factor: 2.748

5.  Molecular mechanism for switching of P. falciparum invasion pathways into human erythrocytes.

Authors:  Janine Stubbs; Ken M Simpson; Tony Triglia; David Plouffe; Christopher J Tonkin; Manoj T Duraisingh; Alexander G Maier; Elizabeth A Winzeler; Alan F Cowman
Journal:  Science       Date:  2005-08-26       Impact factor: 47.728

6.  A recombinant blood-stage malaria vaccine reduces Plasmodium falciparum density and exerts selective pressure on parasite populations in a phase 1-2b trial in Papua New Guinea.

Authors:  Blaise Genton; Inoni Betuela; Ingrid Felger; Fadwa Al-Yaman; Robin F Anders; Allan Saul; Lawrence Rare; Moses Baisor; Kerry Lorry; Graham V Brown; David Pye; David O Irving; Thomas A Smith; Hans-Peter Beck; Michael P Alpers
Journal:  J Infect Dis       Date:  2002-02-14       Impact factor: 5.226

7.  Phenotypic variation of Plasmodium falciparum merozoite proteins directs receptor targeting for invasion of human erythrocytes.

Authors:  Manoj T Duraisingh; Tony Triglia; Stuart A Ralph; Julian C Rayner; John W Barnwell; Geoffrey I McFadden; Alan F Cowman
Journal:  EMBO J       Date:  2003-03-03       Impact factor: 11.598

Review 8.  Invasion of red blood cells by malaria parasites.

Authors:  Alan F Cowman; Brendan S Crabb
Journal:  Cell       Date:  2006-02-24       Impact factor: 41.582

9.  Variation in the expression of a Plasmodium falciparum protein family implicated in erythrocyte invasion.

Authors:  Helen M Taylor; Munira Grainger; Anthony A Holder
Journal:  Infect Immun       Date:  2002-10       Impact factor: 3.441

10.  A Plasmodium falciparum homologue of Plasmodium vivax reticulocyte binding protein (PvRBP1) defines a trypsin-resistant erythrocyte invasion pathway.

Authors:  J C Rayner; E Vargas-Serrato; C S Huber; M R Galinski; J W Barnwell
Journal:  J Exp Med       Date:  2001-12-03       Impact factor: 14.307

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.