Literature DB >> 31285762

The role of Nav1.7 and methylglyoxal-mediated activation of TRPA1 in itch and hypoalgesia in a murine model of type 1 diabetes.

Ruo-Xiao Cheng1,2,3, Yu Feng1,2, Di Liu4,5, Zhi-Hong Wang2, Jiang-Tao Zhang2, Li-Hua Chen6, Cun-Jin Su1,2, Bing Wang2, Ya Huang2, Ru-Rong Ji4,5, Ji Hu1, Tong Liu1,2,7.   

Abstract

Methylglyoxal (MGO), an endogenous reactive carbonyl compound, plays a key role in the pathogenesis of diabetic neuropathy. The aim of this study is to investigate the role of MGO in diabetic itch and hypoalgesia, two common symptoms associated with diabetic neuropathy.
Methods: Scratching behavior, mechanical itch (alloknesis), and thermal hypoalgesia were quantified after intradermal (i.d.) injection of MGO in naïve mice or in diabetic mice induced by intraperitoneal (i.p.) injection of streptozotocin (STZ). Behavioral testing, patch-clamp recording, transgenic mice, and gene expression analysis were used to investigate the mechanisms underlying diabetic itch and hypoalgesia in mice.
Results: I.d. injection of MGO evoked dose-dependent scratching in normal mice. Addition of MGO directly activated transient receptor potential ankyrin 1 (TRPA1) to induce inward currents and calcium influx in dorsal root ganglia (DRG) neurons or in TRPA1-expressing HEK293 cells. Mechanical itch, but not spontaneous itch was developed in STZ-induced diabetic mice. Genetic ablation of Trpa1 (Trpa1-/- ), pharmacological blockade of TRPA1 and Nav1.7, antioxidants, and mitogen-activated protein kinase kinase enzyme (MEK) inhibitor U0126 abrogated itch induced by MGO or in STZ-induced diabetic mice. Thermal hypoalgesia was induced by intrathecal (i.t.) injection of MGO or in STZ-induced diabetic mice, which was abolished by MGO scavengers, intrathecal injection of TRPA1 blockers, and in Trpa1-/- mice.
Conclusion: This study revealed that Nav1.7 and MGO-mediated activation of TRPA1 play key roles in itch and hypoalgesia in a murine model of type 1 diabetes. Thereby, we provide a novel potential therapeutic strategy for the treatment of itch and hypoalgesia induced by diabetic neuropathy.

Entities:  

Keywords:  Diabetes; Hypoalgesia; Itch; Methylglyoxal; TRPA1

Mesh:

Substances:

Year:  2019        PMID: 31285762      PMCID: PMC6599654          DOI: 10.7150/thno.36077

Source DB:  PubMed          Journal:  Theranostics        ISSN: 1838-7640            Impact factor:   11.556


Introduction

Itch (pruritus) is a unpleasant cutaneous sensation that causes the desire or reflex to scratch 1. Acute itch protects us against harmful stimuli by rapid remove them from the skin. Primary sensory neurons are responsible for detecting pruritogens by peripheral free nerve terminals, and they relay sensory information via their central branches to spinal cord dorsal horn, then project to higher brain centers to produce the perception of itch 2; 3. Chronic itch is an important symptom of systemic diseases, including skin, liver, and kidney diseases, and it is debilitating and dramatically reduced quality of life 4. Unfortunately, there are few therapeutic strategies for management of chronic itch. Lack of information about the mechanisms underlying chronic itch caused by systemic diseases is a major hurdle to develop effective anti-itch treatment. Diabetic neuropathy is a debilitating complication in both type 1 and type 2 diabetes 5; 6. Up to 50% of diabetes patients develop peripheral neuropathy during their lifetime 7; 8. Many patients with diabetic neuropathy suffer from chronic neuropathic pain, such as tactile allodynia (touch-evoked pain) 9. Intriguingly, clinicians have a strong impression that itch is more frequent or severe in diabetic patients compared with nondiabetic patients 10. Recent epidemiological study showed that itch was observed in about 12% of general diabetic outpatients in a frequency similar to that of feet pain 10. Thus, itch is now considered as a newly recognized symptom of diabetic neuropathy, and it may reflect the dysfunction of skin or peripheral nervous system 10. Alarmingly, itch is an often overlooked symptom for diabetic patients, although itch substantially reduces the quality of life 4. Additionally, pain hypersensitivity is progressively replaced by loss of pain sensation, termed hypoalgesia, possibly due to loss of peripheral free nerve terminals 11. Unfortunately, there are current lack of medications for the treatment of itch and hypoalgesia associated with diabetic neuropathy 11; 12. Although the molecular mechanisms underlying diabetic neuropathic pain are increasingly being uncovered 9; 13-15, the etiology of itch and hypoalgesia associated with diabetic neuropathy remains poorly understood. Methylglyoxal (MGO) is a reactive α-dicarbonyl metabolite that is synthesized as a byproduct of flux through multiple pathways, including glycolysis and lipid peroxidation 16; 17. Elevated levels of plasma MGO (over 800 nmol/L) was demonstrated in diabetic patients 6; 18. MGO mediates rapid non-enzymatic glycation of proteins, lipids, and DNA to promote formation of advanced glycation end products (AGEs), which eventually renders irreversible damage to these macromolecules, including their integrity of structure and function 18-20. Accelerated AGEs formation contributes to the pathogenesis of certain types of diabetic complications, including peripheral neuropathy, cardiomyopathy, retinopathy, and vascular damage 19-22. MGO is primarily metabolized to the end product D-lactate by glyoxalase 1 (GLO1) and GLO2, which belong to the evolutionarily conserved glutathione-dependent glyoxalase system 23. Peripheral nerves are considered to be particularly susceptible to toxicity of MGO, since the activity of GLO1 is low in these tissues 13. Systemic increase in MG levels by pharmacological inhibition or genetic deletion of GLO1 has been shown to produce painful diabetic neuropathy in the absence of hyperglycemia in rodents 24; 25. Thus, elevated levels of MGO and formation of AGEs contribute to the pathogenesis of peripheral diabetic neuropathy 26. However, a recent clinical study failed to confirm an association between the serum MGO level and diabetic peripheral neuropathy in a cohort of well-treated patients with short-term Type 2 diabetes 27. Notably, previous studies demonstrated that MGO-mediated modification of voltage gated sodium channel Nav1.8 and MGO-mediated activation of transient receptor potential ankyrin 1 (TRPA1) contribute to diabetic neuropathic pain 13; 28; 29. To date, it remains elusive about the roles of MGO in itch and loss of pain sensation (hypoalgesia) associated with diabetic neuropathy. In this study, to better understand the mechanisms underlying diabetic itch and hypoalgesia, we sought to identify the role of MGO and its downstream signaling in itch and hypoalgesia in a mouse model of type 1 diabetes by using patch clamp recording, calcium imaging, pharmacological or genetic manipulations, and behavioral testing. Our results reveal that MGO-mediated activation of TRPA1 and Nav1.7 play crucial roles in diabetic itch and hypoalgeisa.

Materials and Methods

Ethics

This study was approved by the Ethics Review Board of all authors' institutions.

Animals

Male ICR mice (6-8 weeks old) were obtained from the Shanghai SLAC Laboratory Animal CO., LTD. (Shanghai, China). Male C57BL/6J, Trpv1, and Trpa1 mice were purchased from Jackson Laboratories (Bar Harbor, ME, USA). Both Trpv1 and Trpa1 mice were continuously backcrossed to C57BL/6J. All animals were maintained under a 12-h light/dark cycle with food and water available ad libitum, and the room was kept at 22 ± 2°C and 40%-60% humidity. All animal experiments were performed according to the National Institutes of Health Guide for the Care and Use of Laboratory Animals and the guidelines of the International Association for the Study of Pain. All animal care and experimental procedures were approved by the Institutional Animal Care and Use Committee at Soochow University and Duke University.

Generation of STZ-induced diabetic mice

Diabetes model was induced by a single intraperitoneal injection of streptozotocin (STZ; 100 mg/kg, Sigma-Aldrich, St. Louis, MO). STZ was freshly dissolved in citrate buffer (0.1 mol/L, citrate:Na citrate = 1:1, pH 4.2-4.4). The control group received citrate buffer only in an equivalent volume. One week later, diabetes was confirmed by measurements of blood glucose concentrations in samples obtained from the tail vein. Only mice with random blood glucose concentration >16.7 mmol/L (300 mg/dL) were further used in the study.

Behavioral testing

Mice were intradermally injected of 50 μl of agents into the nape of the neck or cheek, and scratching behavior were recorded and quantified as described previously 30; 31. The alloknesis score was determined by calculating the total number of scratching reaction elicited by ten mechanical stimuli, providing by a von Frey filament (0.7 mN) as previous reports 32; 33. For testing alloknesis in diabetic model, von Frey stimuli were applied at the nape of the neck area to elicit scratching response at 1, 3, and 5 weeks after injection of streptozotocin (STZ). The terminal 3 cm of a mouse's tail was immersed in hot water bath at 52 °C and the latency of tail flick was recorded. The results were conveyed as a percent of the maximum possible effect (% MPE) according to the equation: % MPE = 100 × (Experimental latency - Baseline latency)/(10 sec - Baseline latency). Behavioral tests were videotaped from a side angle and behavioral tests were done by observers blind to the treatments or animal genotypes. The detailed methods see Supplementary material.

Pharmacological treatments

(1) Morphine (1 mg/kg), naloxone (1 mg/kg), or chlorpheniramine (1 and 10 mg/kg), N-Acetyl-L-cysteine (NAC; 200 mg/kg), N-tert-butyl-a-phenylnitrone (PBN; 100 mg/kg) or alpha-lipoic acid (ALA; 100 mg/kg) was intraperitoneal (i.p.) injected into mice 20 min before intradermally (i.d.) injection of 3 μmol MGO in mice. (2) We depleted mast cells by daily treatment with compound 48/80 (1, 3, 10 and 10 μg per site on the 1st, 2nd, 3rd and 4th days, respectively) before injection of MGO. (3) We destroyed the C-fibers by daily treatment with the resiniferatoxin (RTX, 30, 70 and 100 μg/kg; subcutaneously for 3 consecutive days), one week before injection of MGO. (4) Capsazepine (50 μg), HC-030031 (50 μg), A967079 (50 μg), A803467 (3 μg), TTX (100 ng), PF-05089771 (10 μg), ALA (100, 200, and 300 μg), or U0126 (1 and 10 nmol) were co-administrated with 3 μmol MGO in the nape of neck in mice. (5) Aminoguanidine (180 mM) and D-arginine (180 mM), two MGO scavengers, were incubated with MGO (60 mM) at 37 °C for 3 hours and then was i.d. injected (total volume 50 μl) in mice. (6) Intrathecal (I.t.) injection of mitogen-activated protein kinase kinase (MEK) inhibitor U0126 (1 nmol) was performed 20 min before i.d. injection of MGO.

Dissociation of mouse DRG neurons and patch clamp recording

DRG in cervical segments (C4-C8) were isolated and cultured using a previous described protocol 34. Briefly, after laminectomies on control or diabetic mice, bilateral DRGs were dissected and incubated in dissecting solution with collagenase (1.25mg/ml, Roche, Switzerland)/dispase-II (2.4 units/ml, Roche, Switzerland) for 90 min at 37 °C, then digested with 0.25% trypsin for 8 min at 37 °C, followed by 0.25% trypsin inhibitor. DRGs were mechanically dissociated with a flame polished Pasteur pipette in the presence of 0.05% DNAse I (Cat#ampd1, Sigma-Aldrich, St. Louis, MO, USA). DRG neurons were plated on glass cover slips and grown in a medium (with 2% B27 supplement, Thermo Fisher Scientific) with 5 μM arabinosylcytosine (AraC) and 5% carbondioxide at 36.5 °C. Whole-cell patch clamp recordings were performed at room temperature (22-24 °C) using an Axon 700B amplifier (Molecular Devices, Sunnyvale, CA, USA). The patch pipettes were pulled from borosilicate capillaries (Chase Scientific Glass Inc.). Pipette resistance was 4-6 MΩ. To prevent large current-induced desensitization or tachyphylaxis in the recordings after repeated application of the agonist (AITC, 50 μM) and MGO (1 mM), current amplitudes that were no larger than 1500 pA were used for analysis. The bath solution (in mM) contained: 140 NaCl, 5 KCl, 1 MgCl2, 2 CaCl2, 5 EGTA, 10 glucose, and 10 HEPES (pH7.4, adjusted with NaOH and osmolarity 300-310 mOsm). The pipette solution (in mM) contained 126 K-gluconate, 10 NaCl, 1 MgCl2, 10 EGTA, 2 NaATP, and 0.1 MgGTP (pH 7.3, adjusted with KOH and osmolarity 295-300 mOsm). The pClamp10 (Axon Instruments) software was used during experiments and data analysis.

Live Cell Ca2+ imaging

We used Live Cell Imaging System to measure the level of intracellular free calcium using the fluorescent marker Fluo 3-AM (Cat#39294, Sigma-Aldrich, St. Louis, MO, USA) dissolved in dimethyl sulfoxide (DMSO) as a stock solution, according to the manufacturer's instructions. HEK-293 cells were purchased from ATCC (ATCC CRL-1573). Cells were grown as a monolayer maintained in Dulbecco's modified Eagles medium (DMEM) (Life Technologies, Carlsbad, CA, USA), supplemented with 10% fetal bovine serum (FBS) (Life Technologies), 100 units/ml penicillin, and 100 μg/ml streptomycin in a humidified incubator at 37 °C with 5% CO2. Cells were cultured in confocal microscope at least 12 h before treatment. cDNAs for mouse TRPV1 (mTRPV1) or mouse TRPA1 (mTRPA1) were transiently transfected into HEK293 cells using the TurboFect Transfection Reagent (Cat#R0531, ThermoFisher Scientific, Lithuania) for at least 36 h. HEK293 were then washed with PBS for 3 times, and was replaced with 1 mL Fluo 3-AM (10 μmol/L), the cells were incubated at 37 °C for 60 min, and washed three times with cold PBS. The change of intracellular calcium of mTRPA1-expressing or mTRPV1-expressing HEK293 cells after treating with MGO (1 mM), capsaicin (1μM), or ATIC (200μM) were measured by Live Cell Imaging System (Cell'R; Olympus, Japan).

Measurement of intracellular ROS in ND7-23 cells

The intracellular ROS levels were measured using the fluorescent marker 2,7-dichlorodihydrofluorescein diacetate (DCFH-DA, Molecular Probes, USA) dissolved in DMSO according to the manufacturer's instructions 31. Briefly, a cell line derived from DRG cells ND7-23 cells (mouse neuroblastoma X rat neuronal hybrid) were seeded in 6-well plates at least 12 h before treatment. Before MGO (1 mM) was added, cells were treated with PBS, PBN (200 μM) for 15 min. After 30 min incubation, the medium was replaced with 1 mL DCFH-DA (25 μM), the cells were incubated at 30 min, then washed 3 times with PBS and suspended in 500 μL PBS for flow cytometry (FC500; Beckman Coulter, Brea, CA). Fluorescence intensity was measured and analyzed by Cxp (FC500; Beckman Coulter).

Western blotting analysis

ND7-23 cells (mouse neuroblastoma X rat neuronal hybrid) were plated at a density of 1.5 x 105 cells per 6 cm dish. After at least 12 h, the cells were incubated with or without MGO (750 μM) for 15, 30 and 60 min at 37 °C. Then, cells were lysed with Radio-Immunoprecipitation Assay (RIPA) buffer containing a cocktail of phosphatase inhibitors and protease inhibitors after washed with Phosphate Buffered Saline (PBS). The lumbar spinal dorsal horns and dorsal root ganglia were rapidly removed from mice, which were terminally anesthetized with isoflurane 5 min after injection of MGO only or co-administration of MGO with HC030031 or capsazepine, or 30 minutes after intraperitoneal (i.p.) injection of antioxidants NAC or PBN and transcardially perfused with sterile saline. At the 5th week after STZ injection, the mice were terminally anesthetized with 4% chloral hydrate (i.p. 10 mL/kg) and transcardially perfused with saline. The lumbar spinal dorsal horns and dorsal root ganglia were also rapidly collected and homogenized in lysis buffer containing a cocktail of phosphatase inhibitors and protease inhibitors for total protein extraction assays as previously reported 24,25. The protein concentrations were measured by Pierce bicinchoninic acid (BCA) protein assay (ThermoFisher Scientific, Cat#23250; Waltham, MA, USA), and equal amounts of protein (25 μg) were loaded onto each lane and separated on 10% sodium dodecyl-sulfate polyacrylamide gel electrophoresis (SDS-PAGE). After transfer, the blots were blocked with 5% nonfat milk diluted in Tris-HCl Buffer Saline (TBS) at room temperature for 1 h and the PVDF membranes were incubated overnight at 4 °C with primary monoclonal anti-p-ERK (mouse, 1:1000; Cat#sc-7383, Santa Cruz Biotechnology, USA) or anti-TRPA1 antibody (rabbit, 1:500; Cat#ACC-037, Alomone labs, Jerusalem, Israel). For loading control, the blots were probed with α-tubulin antibody (1:2000, Cat#4413s, Vazyme; Nanjing, China). The blots were washed and incubated with horseradish peroxidase-conjugated goat anti-mouse or goat anti-rabbit IgG secondary antibody (1:2000, Vazyme). Protein bands were visualized using an enhanced chemiluminescence detection kit (Pierce) and the band densities were assessed and analyzed using the Molecular Imager ChemiDoc XRS+ System (Bio-Rad, Hercules, CA). Data from five mice were used for statistical analysis.

Real-time quantitative PCR

Total RNA was extracted from cervical DRG tissue using RNeasyPlus Mini kit (Cat#74134, Qiagen, Valencia) according to manufacturer's instruction. RNA was treated with DNase I (Invitrogen) and the cDNA was synthesized using ThermoScript RT-PCR System kit (Invitrogen). Reactions were carried out in a volume of 20 μl per reaction containing 10 μl SYBR Green master mix (2×) (Cat#mf015, mei5bio, Beijing, China), 0.5 μl cDNA, 1.2 μl 5 μM primer mix, and 8.3 μl water using Opticon real-time PCR Detection System (ABI Life7500, USA). Relative mRNA expression levels of different target gene compared to GAPDH were calculated using 2-ΔΔCt methods. Triplicate RT-PCR analyses were performed. Q-RT-PCR primer sequences (5' to 3') used were: TRPA1: GGAAATACCCCACTGCATTGT (forward) and CAGCTATGTGAAGGGGTGACA (reverse); TRPV1: ACCACGGCTGCTTACTATCG (forward) and GCTGGAATCCTCGGGTGTAG (reverse); Cav3.2: TCTCGCTACCCAATGACAGC (forward) and CTCCGTGTAGTCTGGGATGC (reverse); Nav1.8: ATGACGGGGAGGTGAACAAC (forward) and AACTGGTAATGGCCCGACTG (reverse); Nav1.7: TGGATCAGAATCCGCAGGTG (forward) and TTTCCCCTTCGGATCCTTACC (reverse).

Reagents

Streptozocin (STZ, Cat#S0130), methylglyoxal solution (MGO, Cat#M0252), glyoxal solution (GO, Cat#50649), U0126 (Cat#U120), aminoguanidine hydrochloride (Cat#396494), D-Arginine monohydrochloride (Cat#A6757), serotonin hydrochloride (5-HT, Cat#H9523), compound 48/80 (Cat#C2313), chloroquine (CQ, Cat#C6628), resiniferatoxin (RTX, Cat#R8756), capsaicin (Cat#12084), chlorpheniramine maleate (Cat#C3025), N-acetyl-L-cysteine (NAC, Cat#A7250), allylisothiocyanate (AITC,Cat#377430), N-tert-butyl-a-phenylnitrone (PBN, Cat#B7263) was obtained from Sigma-Aldrich (St. Louis, MO, USA). A967079 (Cat#4716/10), PF-05089771 (Cat#5931), endothelin 1 (ET-1, Cat#1160), capsazepine (CPZ, Cat#0464) and HC-030031 (Cat#2896) was obtained from Tocris (Bristol, UK). Alpha-lipoic acid (ALA) was obtained from Hameln Pharmaceuticals GmbH (LangesFeld, Hameln, Germany). Morphine hydrochloride was obtained from China Northeast Pharmaceutical Group Shenyang No.1 Pharmaceutical CO., Ltd (Shenyang City, Liaoning Province, China). Naloxone hydrochloride was obtained from China Sinopharm Group Guorui Pharmaceutical CO., Ltd (Huainan City, Anhui Province, China). Resiniferatoxin (RTX), PBN, capsazepine, HC-030031, and A967079 were freshly dissolved in 10% dimethyl sulfoxide (DMSO). Allylisothiocyanate (AITC), capsaicin, MGO were dissolved in Artificial cerebrospinal fluid (ACSF) when use in Live Cell Imaging System. Other reagents were dissolved in sterile saline if not specified.

Statistical analysis

Data were analyzed using Graphpad Prism 6 (GraphPad, La Jollar, CA). All data were expressed as the mean ± standard error of the mean (S.E.M.). Statistical analysis were performed by Student's t test, one-way analysis of variance (ANOVA) followed by Dunnett multiple comparison tests, or two-way repeated-measured ANOVA followed by post hoc Bonferroni's multiple comparison tests as appropriately indicated. Difference with P < 0.05 was considered to be statistically significant.

Results

Intradermal (i.d.) injection of MGO induces itch behavior in mice

To identify the potential pruritogens related to diabetic neuropathy, we first examined the possible prurigenic activities of MGO, glyoxal (GO), and glucose by using neck model by i.d. injection of chemicals into nape of the neck in mice. Cheek model was further employed to behaviorally distinguish itch and pain responses in mice by i.d. injection of chemicals into cheek of mice 35. I.d. injection of painful reagents into the cheek evokes wiping behavior, while i.d. injection of pruritogens evokes scratching behavior in mice 35. We found that i.d. injection MGO (1 μmol-40 μmol) into the nape of the neck dose-dependently evoked robust scratching behavior in mice (Figure ). The dose-response curve showed an obvious invert “U” shape (Figure ). I.d. injection of MGO into the cheek dose-dependently induced scratching behavior, but only elicited wiping at the highest dose (10 μmol) in mice (Figure ). In sharp contrast, i.d. injection GO (1 μmol-10 μmol) into the neck slightly induced scratching behavior at the highest dose (10 μmol) in mice (Figure ), and i.d. injection of GO into the cheek slightly produced mixed wiping and scratching behavior in mice at the highest dosage (10 μmol) (Figure ). Additionally, i.d. injection of glucose into the nape of neck was not able to induce scratching behavior in mice at all tested dosage (Supplementary Figure ). We next demonstrated that pre-incubation of MGO scavengers D-arginine (0.18 M) or aminoguanidine (0.18 M) with MGO (0.06 M) significantly reduced MGO-induced scratching behavior in mice (Saline: 149.8 ± 10.58 vs. D-arginine: 90.83 ± 8.499; t10 = 4.348; P = 0.0014; Saline: 149.8 ± 10.58 vs. aminoguanidine: 33.75 ± 5.519; t12 = 10.47; P < 0.0001; Figure ). Intraperitoneal (i.p.) injection of naloxone (1 mg/kg; Figure ), an opioid receptor antagonist, but not morphine (1mg/kg; Figure ), attenuated MGO-induced scratching in mice (Saline: 133.8 ± 13.52 vs. naloxone: 69.60 ± 16.47; t8 = 3.013; P = 0.0167). It was noteworthy that repeated injection of MGO (3 μmol) induced behavioral desensitization of scratching response in mice (First injection: 97.89 ± 9.387 vs. second injection: 48.11 ± 7.473; t16 = 4.149; P = 0.0008; Figure ).

Involvement of capsaicin-sensitive C-fibers, mast cells and sodium channel Nav1.7 in MGO induces itch behavior in mice

We next examined the roles of capsaicin-sensitive C-fibers, voltage-gated sodium channels (VGSCs), mast cells, and histamine in MGO-induced scratching behavior in mice. MGO-induced scratching was significantly decreased in resiniferatoxin (RTX)-treated mice compared with control mice (Vehicle: 78.80 ± 9.013 vs. RTX: 170.0 ± 12.22; t8 = 6.005; P = 0.0003; Figure ), suggesting capsaicin-sensitive C-fibers were involved in this process. Local co-administration of pan sodium channels blocker tetrodotoxin (TTX; 100 ng) abolished MGO-induced scratching in mice (Vehicle: 168.8 ± 28.90 vs. TTX: 50.33 ± 14.08; t12 = 3.308; P = 0.0063; Figure ). Local co-administration of Nav1.7 selective blocker PF-05089771 (10 μg; Figure ), but not a Nav1.8 blocker A803467 (3 μg; Figure ) and a pan T-type calcium channels blocker mibefradil (10 nmol; Figure ), significantly reduced MGO-induced scratching in mice (Vehicle: 126.2 ± 10.94 vs. PF-05089771: 82.86 ± 11.62; t11 = 2.683; P = 0.0213). MGO-induced scratching was significantly decreased in compound 48/80-pretreatment mice compared with control mice (Vehicle group: 35.80 ± 6.484 vs. compound 48/80-treated group: 189.8 ± 27.77; t8 = 5.401; P = 0.0006; Figure ). MGO-induced scratching (Figure ), but not chloroquine (CQ)-induced scratching (Figure ), was dose-dependently decreased by i.p. injection of a histamine H1 receptor antagonist chlorpheniramine (1 mg/kg) in mice (F(2, 12) = 24.01; P < 0.0001). CQ-induced scratching in mice was significantly enhanced by both i.p. injection of MGO (50 mg/kg) (Saline: 85.60 ± 14.80 vs. MGO: 268.0 ± 16.27; t8 = 8.292; P < 0.0001; Figure ) or i.t. injection of MGO (1 nmol) (Saline: 151.4 ± 12.21 vs. MGO: 193.2 ± 12.09; t8 = 2.432; P = 0.0410; Figure ).

MGO-mediated activation of TRPA1 in dorsal root ganglia (DRG) neurons mediates MGO-induced itch behavior in mice

To identify the potential molecular targets of MGO, we performed whole-cell patch clamp recording on dissociated C4-C8 DRG neurons to identify the direct effects of MGO on TRPV1 or TRPA1, two important ion channels in itch 36. Under the voltage clamp mode, bath application of 1 mM MGO evoked obvious inward currents in dissociated DRG neurons from mice, which responded to a TRPA1 selective agonist allyl-isothiocyanate (AITC) (Figure ). Incubation of a TRPA1 blocker HC030031 (100 μM) abolished MGO-evoked inward currents in dissociated DRG neurons (Figure ). To test the possibility that MGO directly activates either TRPV1 or TRPA1, we transfected HEK-293 cell with either mouse TRPA1 or mouse TRPV1 construct and measured TRP channels activities using live-cell Ca2+ imaging. MGO did not affect intracellular Ca2+ in mTRPV1-transfected HEK-293 cells (Figure ). In contrast, MGO evoked robust intracellular Ca2+ increase in mTRPA1-transfected HEK-293 cells (Figure ). We subsequently examined the role of TRP channels in MGO-induced itch in mice by using genetic and pharmacological approaches. Co-administration of selective TRPA1 blocker HC-030031 (50 μg; Vehicle: 170.0 ± 12.22 vs. HC030031: 97.00 ± 4.183; t8 = 5.651; P = 0.0005) or A967079 (50 μg; Vehicle: 157.8 ± 13.52 vs. A967079: 36.40 ± 9.190; t9 = 7.103; P < 0.0001), but not a TRPV1 selective blocker capsazepine (CPZ; 50 μg), significantly decreased MGO-induced scratching in mice (Figure ). Furthermore, MGO-induced scratching was abolished in Trpa1 mice (WT mice: 419.8 ± 26.38 vs. Trpa1 mice: 78.80 ± 20.90; t8 = 10.13; P < 0.0001; Figure ), but not in Trpv1mice (Figure ).

Mechanical itch is enhanced in streptozocin (STZ)-induced diabetic mice

To further investigate the itch-related behavioral phenotypes under diabetes condition, we established streptozocin (STZ)-induced diabetic mouse model 37. Our results showed that blood glucose level of STZ-induced diabetes mice was increased compared with control mice (Figure ), while body weight increased much slower than that of control mice (Supplementary Figure ). Rota-rod test showed that the motor function was comparable between control and diabetic mice (Supplementary Figure ). The latency of tail flick response to hot water (52 °C) was significantly prolonged in diabetic mice compared with control mice (Figure ). There was no spontaneous scratching behavior observed in diabetic mice (Supplementary Figure ). Furthermore, several pruritogens, including ET-1 (100 pmol), 5-HT (30 μg), chloroquine (CQ; 200 μg), compound 48/80 (48/80; 100 μg), and MGO (3 μmol), induced less scratching behavior in diabetic mice at the 5th week after STZ injection than that of control mice (Figure ), suggesting impaired function of C-fibers may be responsible for decreased chemical pruritogens-induced itch. Mechanical itch (alloknesis; namely touch-evoked itch) is a remarkable feature of chronic itch, which is caused by skin diseases, systemic diseases, aging, or neurological disorders 33; 38. Intriguingly, diabetic mice displayed significant more mechanical itch behaviors compared with that of control mice at the 5th week after STZ injection (Figure ). In contrast, we found that diabetic mice showed early mechanical pain hypersensitivity only within one week after STZ treatment (Figure ), suggesting different time course of mechanical allodynia and mechanical itch under diabetic condition. Thus, our data suggested that mechanical itch, as an itch-related modality, is enhanced in STZ-induced diabetic mice.

The expression and function of TRPA1 is enhanced in STZ-induced diabetic mice

To examine the expression and function of TRPA1 in the DRGs under diabetes condition, we utilized q-PCR analysis, Western blotting, and electrophysiological methods. We demonstrated that mRNA expression of TRPA1 was significantly increased in the C4-C8 DRGs from diabetic mice (P = 0.0003; Figure ). In contrast, the mRNA expression of TRPV1 was significantly decreased in the DRGs from diabetic mice (P < 0.001; Figure ). Western blotting analysis also confirmed the up-regulation of TRPA1 protein in the DRGs from diabetic mice (P < 0.0001; Figure ). Whole-cell patch clamp recording analysis confirmed that MGO-induced inward currents in the DRG neurons dissociated from STZ-induced diabetic mice were significantly amplified (P < 0.01; Figure ). Incubation with TRPA1 selective blockers HC030031 (P < 0.001; Figure ) or A-967079 (P < 0.001; Figure ) significantly inhibited MGO-induced inward currents in the DRG neurons dissociated from STZ-induced diabetic mice.

Activation of TRPA1 and sodium channel Nav1.7 mediates mechanical itch induced by i.d. injection of MGO in mice

Subsequently, we asked whether activation of TRPA1 was required for mechanical itch induced by i.d. injection of MGO or in STZ-induced diabetic mice. As expected, we found that i.d. MGO induced obvious mechanical itch in mice (Saline: 3.167 ± 0.6009 vs. MGO: 7.143 ± 0.5948; t11 = 4.677; P = 0.0007; Figure ). Pre-incubation of MGO scavengers (D-arginine or aminoguanidine) with MGO significantly reduced MGO-induced mechanical itch in mice (Saline: 6.714 ± 0.2857 vs. D-arginine: 2.333 ± 0.6667; t11 = 6.379; P < 0.0001; Saline: 6.714 ± 0.2857 vs. aminoguanidine: 3.286 ± 0.5216; t12 = 5.765; P < 0.0001; Figure ). Co-administration of TRPA1 blockers HC030031 (50 μg; Vehicle: 7.143 ± 0.5948 vs. HC030031: 2.200 ± 0.5831; t11 = 5.736; P = 0.0002), A967079 (50 μg; Vehicle: 5.400 ± 0.5099 vs. A967079: 1.500 ± 0.5976; t12 = 4.520; P = 0.0009), but not a TRPV1 blocker CPZ (50 μg), significantly reduced MGO-induced mechanical itch in mice (Figure ). MGO-induced mechanical itch in mice was abolished in Trpa1 mice compared with WT control mice (WT: 6.500 ± 0.6708 vs. Trpa1: 3.429 ± 0.3689; t11 = 4.177; P = 0.0015; Figure ). Co-administration of TTX (100 ng; Vehicle: 5.667 ± 0.4216 vs. TTX: 1.833 ± 0.4014; t10 = 6.585; P < 0.0001; Figure ), and PF-05089771 (10 μg; Vehicle: 5.000 ± 0.6172 vs. PF-05089771: 2.143 ± 0.3401; t12 = 4.054; P = 0.0016; Figure ), but not A803467 (3 μg; Figure ) and mibefradil (10 nmol; Figure ), significantly reduced MGO-induced mechanical itch in mice.

Activation of TRPA1 and sodium channel Nav1.7 mediates mechanical itch in STZ-induced diabetic mice

We further explored the contribution of MGO-mediated activation of TRPA1 to mechanical itch in STZ-induced diabetic mice. We found that i.p. injection of MGO scavengers, including aminoguanidine (50-200 mg/kg) and D-Arginine (300-600 mg.kg), significantly inhibited mechanical itch in STZ-induced diabetic mice (Figure ). I.d. injection of a TRPA1 blocker HC-030031 (100 μg), but not a TRPV1 blocker CPZ (100 μg), significantly inhibited mechanical itch in STZ-induced diabetic mice (P < 0.001; Figure ). In addition, diabetes-induced mechanical itch was also abolished in Trpa1 mice (P < 0.0001; Figure ). I.d. administration of TTX (100 ng; P < 0.001) or PF-05089771 (10 μg; P < 0.01), but not for A803467 (3 μg), significantly inhibited mechanical itch in STZ-induced diabetic mice (Figure ). Additionally, q-PCR analysis confirmed that mRNA expression of Nav1.7 was significantly increased (t10 = 9.930; P = 0.0001), but the mRNA expression of Cav3.2 and Nav1.8, was significantly decreased in the DRGs of STZ-induced diabetic mice compared with that of control mice (Figure ).

Oxidative stress contributes to itch induced by i.d. injection of MGO or in STZ-induced diabetic mice

Our previous work showed that oxidative stress played a key role in acute and chronic itch 31; 39. We next found that incubation of a dorsal root ganglia-derived cell line ND7-23 cells (mouse neuroblastoma X rat neuronal hybrid) with MGO (1 mM) significantly increased the levels of intracellular reactive oxygen species (ROS), as reflected by enhanced dichloro-dihydro-fluorescein diacetate (DCFH-DA) fluorescence intensity compared with control, while antioxidants phenyl-tert-butynitrone (PBN) remarkable decreased it (Figure ). MGO-induced scratching behavior was significantly reduced by pretreatment with N-Acetyl-L-cysteine (NAC; i.p. 200 mg/kg; Saline: 141.0 ± 19.69 vs. NAC: 33.71 ± 6.948; t10 = 5.858, P = 0.0002; Figure ), PBN (i.p. 100 mg/kg; Saline: 141.0 ± 19.69 vs. PBN: 31.80 ± 13.36; t8 = 4.589; P = 0.0018; Figure ), α-lipoic acid (ALA; i.p. 100 mg/kg; Saline: 203.8 ± 26.00 vs. ALA: 60.80 ± 21.34; t11 = 3.838; P = 0.0028; Figure ). I.d. co-administration of ALA also reduced MGO-induced scratching behavior in mice (Saline: 141.71 ± 60.68 vs. ALA 200 μg: 53.63 ± 29.34 vs. ALA 300 μg: 47.88 ±31.47; F = 6.818, P = 0.0014; Figure ). MGO-induced mechanical itch was significantly reduced by systemic injection of ALA (i.p. 100 mg/kg; Saline: 6 ± 1.07 vs. ALA: 2.38 ± 0.26; t10 = 3.506; P = 0.0039; Figure ) and local co-administration of ALA in mice (Saline: 11.0 ± 5 vs. ALA 100 μg: 4.8 ± 0.98 vs. ALA 200 μg: 2.85 ± 1.25 vs. ALA 300 μg: 4.17 ± 1.34; F = 8.166, P < 0.001; Figure ). In STZ-induced diabetic mice, i.p. injection of antioxidant ALA (100 mg/kg) also inhibited mechanical itch (t11 = 6.599; P < 0.0001; Figure ). Thus, these data suggested that oxidative stress contributes to itch (including mechanical itch) induced by i.d. injection of MGO or in STZ-induced diabetic mice.

Intracellular ERK signaling contributes to itch induced by i.d. injection of MGO or in STZ-induced diabetic mice

To further investigate the downstream signaling of MGO-mediated activation of TRPA1 under diabetes, we subsequently examined the role of ERK signaling activation in itch induced by i.d. injection of MGO or in STZ-induced diabetic mice. We used Western blotting to determine p-ERK expression in vivo and in vitro in order to test whether MGO is able to induce p-ERK activation. Our results demonstrated that i.d. injection of MGO induced the expression of p-ERK in the DRGs (P < 0.0001; Figure ) and spinal cord (P = 0.0004; Figure ). We also found that incubation ND7-23 cells with MGO (1 mM) from 10 minutes to 60 minutes significantly induced the expression of p-ERK (F(3, 8) = 526.0; P < 0.0001; Figure ). These results suggest that MGO is able to induce p-ERK activation in the DRGs and spinal cord in mice. Western blotting analysis showed that MGO-induced p-ERK expression in the spinal cord was significantly suppressed by i.d. injection of HC030031 (P < 0.01), but not CPZ (P = 0.2745) (Figure ). MGO-induced p-ERK expression in the spinal cord was also significantly suppressed by antioxidants NAC (P < 0.05) and PBN (P < 0.01) (Figure ). Thus, our data indicated oxidative stress and TRPA1 activation contribute to MGO-induced ERK activation in the spinal cord. We next found that i.t. injection of U0126 (1 nmol) significantly inhibited MGO-induced scratching (Vehicle: 170.0 ± 12.22 vs. U0126: 49.60 ± 13.01; t8 = 6.745; P = 0.0001; Figure ) and mechanical itch in mice (P < 0.001; Figure ). Additionally, i.d. co-injection of U0126 (10 nmol) also significantly inhibited MGO-induced scratching in mice (P < 0.001; Figure ). In STZ-induced diabetic mice, i.d. injection of U0126 (1 nmol) was also able to reduce mechanical itch behavior (P < 0.001; Figure ). Thus, these data suggested that ERK signaling activation in the DRGs and spinal cord contributes to itch induced by i.d. injection of MGO or in STZ-induced diabetic mice.

Activation of TRPA1 in spinal cord mediates thermal hypoalgesia induced by injection of MGO or in STZ-induced diabetic mice

Finally, we aimed to study the role of MGO-mediated activation of TRPA1 in hypoalgesia under diabetes condition. We found that the latency of tail-flick in response to 52 °C hot water was increased by i.p. or i.t. injection of MGO increased in normal mice (Figure ). Interestingly, the higher dose of MGO (i.p. 100 mg/kg or i.t. 3 nmol) produced less anti-nociceptive effects than that of lower dose of MGO (i.p. 50 mg/kg or i.t. 1 nmol), suggesting a non-linear dose-response curve for MGO-induced anti-nociception in normal mice. As expected, pre-incubation MGO scavenges aminoguanidine and D-arginine with MGO abolished MGO-induced anti-nociception in control mice (Figure ). I.t. co-administration of TRPA1 blocker HC-030031 (10 μg; Figure ), but not capsazepine (10 μg; Figure ), abolished MGO-induced anti-nociception in normal mice (P < 0.001). MGO-induced anti-nociception was impaired in Trpa1 mice compared with WT mice (Figure ). Thus, these data provided strong evidence to suggest that activation of TRPA1 in the spinal cord contributed to MGO-mediated thermal hypoalgesia in mice. For STZ-induced diabetic mice, i.p. injection of MGO scavenges aminoguanidine (200 mg/kg) and D-arginine (300 mg/kg) significantly reversed diabetes-induced thermal hypoalgesia in mice (Figure ). I.t. injection of HC-030031 (10 μg) and A967079 (10 μg), two selective TRPA1 blockers, significantly reversed diabetes-induced thermal hypoalgesia in STZ-induced diabetic mice (Figure ). In sharp contrast, i.t. injection of TRPV1 blocker CPZ failed to change the latency of tail-flick in response to 52 °C hot water in STZ-induced diabetic mice (Figure ). Thus, these data suggested that MGO-mediated activation of TRPA1 in the spinal cord contributes to thermal hypoalgesia in STZ-induced diabetic mice.

Discussion

Itch and hypoalgesia are two common symptoms associated with diabetic neuropathy 5; 8. However, the underlying molecular mechanisms are poorly understood. Here, using patch clamp recording, calcium imaging, pharmacological or genetic manipulations, and behavioral testing, we defined a novel signaling pathway by which itch and hypoalgesia is induced by diabetic neuropathy in mice. First, we found that i.d. injection of MGO (an endogenous reactive carbonyl compound) evoked itch behaviors in a dose-dependent manner, while i.t. injection of MGO induced thermal hypoalgesia in normal mice. Second, MGO directly activated TRPA1 channel to induce inward currents and calcium influx in primary cultured DRG neurons. Third, MGO scavengers, genetic ablation of Trpa1 (Trpa1), and pharmacological blockade of TRPA1 abrogated MGO-induced itch and thermal hypoalgesia in mice. Fourth, STZ-induced diabetic mice developed obvious mechanical itch and thermal hypoalgesia. Fifth, antioxidants NAC, PBN or ALA significantly reduced itch induced by MGO or in STZ-induced diabetic mice. Lastly, MGO is sufficient to induce ERK activation in the DRGs and spinal cord, and administration of MEK inhibitor U0126 significantly reduced itch induced by MGO or in STZ-induced diabetic mice. Together, our studies revealed MGO-mediated activation of TRPA1 in periphery and spinal cord contributes to diabetic itch and hypoalgesia, which may provide a novel therapeutic strategy for clinical management of diabetic itch and hypoalgesia.

MGO, a potential itch mediator related to diabetes or other pathological conditions

There has been much interest in identifying potential itch mediators and characterizing their receptors under chronic itch conditions, including skin, liver, kidney diseases, and metabolic diseases 12; 40; 41. In the current study, we identified and functionally characterized MGO as a potential itch mediator under diabetes condition. We found that i.d. injection of glucose was not sufficient to induce itch behavior in normal mice, suggesting hyperglycemia may be not a root cause of diabetic itch. In stark contrast, i.d. injection of MGO induced robust scratching behavior and mechanical itch in normal mice. We provided several evidences to support MGO as a potential pruritogen under diabetes condition. First, the dose-response curve for MGO-induced itch shows a typical “invert-U” shape, which is similar with H2O2 39, imiquimod 30 or chloroquine-induced itch 42 in mice. Thus, we postulated that higher doses of MGO may produce pain sensation to suppress itch responses, which is consistent with many previous studies supporting MGO as critical contributor to diabetic neuropathic pain 13; 28; 29; 43. Second, in cheek model, i.d. injection of low-dose MGO induced only scratching behavior, whereas MGO at the highest dose induced both wiping and scratching behavior in mice. It suggests MGO induces either pain or itch, which is dependent on its local concentrations. MGO at the lower concentrations mainly induces itch, while MGO at the higher concentrations induces pain. Third, we found that MGO-induced itch was suppressed by naloxone, but not morphine, which served as pharmacological evidence to support MGO at lower doses are one of pruritogens. Fourth, we confirmed that neutralizing MGO by D-arginine or aminoguanidine was able to abolish MGO-induced itch in normal mice and mechanical itch in STZ-induced diabetic mice. Since the levels of MGO are also elevated under other diseases, including chronic kidney disease 44, MGO may be considered as a pruritogen not limited to diabetes. Together, we identified MGO as a new potential itch mediator under diabetes condition, possible other pathological conditions associated with elevated level of MGO.

Mechanical itch is a feature for diabetic neuropathy

In our present study, we tried to establish an animal model to investigate itch and hypoalgesia induced by diabetes. Unfortunately, we did not observe spontaneous scratching behavior in STZ-induced diabetic mice. Additionally, several pruritogens-induced acute scratching behaviors were reduced in diabetic mice. An explanation for this phenotype may be due to the impairment of nociceptive C-fibers caused by diabetic neuropathy, which are also involved in mediating itch transmission. Mechanical itch, also called touch-evoked itch, is considered as a remarkable feature of chronic itch, which is caused by skin diseases, systemic diseases, aging, or neurological disorders 33; 38. In sharp contrast, we observed obvious mechanical itch in STZ-induced diabetic mice. Previous reports demonstrated mechanical itch may be gated by neuropeptide Y (NPY)-expressing inhibitory interneurons in the spinal cord 33. Aging-induced loss of Merkel cells in the skin or mechanosensitive ion channel Piezo2 deficiency in Merkel cells led to chronic mechanical itch in mice 45. It warrants further investigation whether dysfunction of NPY-expressing inhibitory interneurons in the spinal cord, possible modulation piezo2 by MGO, and Merkel cells in the skin, are involved in diabetic mechanical itch.

The role of MGO-mediated activation of TRPA1 in diabetic itch

Mounting evidence indicates that TRP channels expressed by primary sensory neurons and non-neuronal cells (e.g., immune cells) play a key role in the regulation of pain and itch 36; 46; 47. There is a simplified concept that TRPV1 and TRPA1 channel mediate histaminergic and nonhistaminergic itch, respectively 1; 48. Nevertheless, it remains unclear whether and which TRP channels play a role in the regulation of itch associated with diabetic neuropathy. Previous reports demonstrated that MGO directly activated TRPA1 through an intracellular binding site of TRPA1, which may contribute to the pathogenesis of diabetic neuropathy 49 and pain 13; 28; 29; 50. Recent studies also described that direct activation of TRPA1 by miRNA-711 (a kind of microRNA) by binding extracellularly to it can drive acute and chronic itch in mice 51. Imiquimod was also shown to directly activate TRPA1 to evoke itch in mice and zebrafish 52. Our previous work also demonstrated that H2O2 induced itch via activation of TRPA1 in mice 39. Previous report demonstrated that streptozotocin (STZ), the toxin used to generate type 1 diabetic animal model in the current study, directly activates the TRPA1 channel in sensory neurons, TRPA1 cell lines, and membrane patches 53. Intraplantar injections of low dose STZ evoked acute pain within hours in mice systemic STZ treatment (180 mg/kg) evoked a loss of cold and mechanical sensitivity within an hour of injection, which lasted for at least 10 days 53. In contrast, we tested mechanical itch after STZ-injection 5 weeks, when the levels of blood glucose remained high and STZ may be excreted form the body. Thus, both indirect activation of TRPA1 by signaling from G-protein coupled receptors and direct activation of TRPA1 are sufficient to transduce itch signaling in primary sensory neurons. In the present study, we provided strong evidence supporting that MGO-mediated direct activation of TRPA1 contributed to diabetic itch in mice. First, pharmacological approach revealed that MGO scavengers (e.g., D-arginine and aminoguanidine) and selective TRPA1 blockers (e.g., HC030031 and A-967079) effective attenuated itch induced by MGO or STZ-induced diabetic mice. Second, using TRPA1 knockout mice, we demonstrated that itch induced by MGO or in STZ-induced diabetic mice was attenuated in Trpa1 mice compared with that of WT mice. Third, we demonstrated that the expression and function of TRPA1 in DRG neurons are significantly up-regulated in the setting of diabetes in mice. Our studies are also consistent with previous studies, which showed that the hyperexcitability of primary sensory fibers in the skin, especially Mas-related G protein-coupled receptor (Mrgpr) A3 and MrgprD-positive primary afferents, contributes to peripheral sensitization and is required for the development of chronic itch 54; 55. Together, it suggests that direct activation and up-regulation of expression and function of TRPA1 in primary sensory neurons contributes to the pathogenesis of diabetic itch.

The role of Nav1.7 in diabetic itch

It is well demonstrated that VGSCs play a key role in the genesis and propagation of action potentials (APs) and regulation of membrane excitability in neurons of peripheral and central nervous system 56; 57. According to the pharmacological sensitivity of VGSCs to TTX, VGSCs can be divided into TTX-sensitive VGSCs (e.g., Nav1.1, Nav1.2, Nav1.3, Nav1.4, Nav1.6, and Nav1.7) and TTX-resistant VGSCs (e.g., Nav1.5, Nav1.8, and Nav1.9) 56; 57. Multiple VGSC subtypes are demonstrated to be involved in the pain signaling pathways 57. Recently, it was demonstrated that certain subtypes of VGSCs, such as Nav1.7 and Nav1.9, were involved in itch signaling transduction 58; 59. However, the role of VGSCs in diabetic itch remains unclear. Previous study identified that modification of Nav1.8 by MGO contributed to neuronal hyperexcitability of DRG neurons and pain hypersensitivity in mice 13; 28. Surprisingly, our present data indicates that Nav1.7, but not Nav1.8, play a key role in diabetic itch in mice. First, pharmacological method showed that local co-administration of Nav1.7 selective blocker PF-05089771 abolished itch induced by MGO or in STZ-induced diabetic in mice, but not for Nav1.8 selective blocker A803467. Consistently, local application of low-dose TTX dramatically inhibited itch induced by MGO and in STZ-induced diabetic mice. Second, q-PCR analysis revealed that mRNA expression of Nav1.7 was significantly increased, but the mRNA expression of Nav1.8 was significantly decreased in the DRGs of STZ-induced diabetic mice compared with that of control mice. Although Nav1.8 is involved in multiple forms of chronic pain, including inflammatory pain, bone cancer pain and diabetic neuropathic pain 57, our data did not support an important role of Nav1.8 in diabetic itch in mice. Although our previous data showed T-type calcium channels were involved in acute itch responses in mice 60, our pharmacological data found that pan T-type calcium channels blocker mibefradil did not affect MGO-induced itch in mice. Additionally, q-PCR analysis found that the expression of Cav3.2 was down-regulated in the DRGs from STZ-induced diabetic mice. Thus, these data suggested TTX-sensitive VGSC subtype Nav1.7 was required for the pathogenesis of diabetic itch, but not TTX-resistant VGSC subtype Nav1.8 and T-type calcium channels.

The role of oxidative stress and ERK signaling in diabetic itch

Our and others' previous reports demonstrated that oxidative stress play a key role in the development of acute and chronic itch 31; 39; 61. In the present study, we provided evidence supporting oxidative stress may be also involved in diabetic itch. First, application of MGO in cultured ND7-23 cells increased the levels of intracellular ROS and was attenuated by antioxidants. Second, antioxidants NAC and PBN suppressed MGO-induced itch behavior and ERK activation in the spinal cord in mice. Third, administration of clinical used antioxidant ALA was also able to attenuate itch induced by MGO or mechanical itch in STZ-induced diabetic mice. Thus, oxidative stress may be another important contributor to diabetic itch. Extracellular signal-regulated kinases ERK1/2 transduce extracellular stimuli into intracellular signaling through transcriptional and post-translational mechanisms 62. ERK1/2 activation in the DRGs and spinal cord contributes to the development of many types of chronic pain, including inflammatory pain 63-66, neuropathic pain 67, and cancer pain 66. It was found that ERK1/2 activation in the DRGs, skin, and spinal cord was required for acute and chronic itch 31; 68-70. In the present study, MGO was shown to be able to induce phosphorylation of ERK1/2 (p-ERK) in the DRGs and spinal cord in mice. Suppression of ERK activation by MEK inhibitor U0126 attenuated itch induced by MGO or STZ-induced diabetic mice. These data are consistent with our previous results that inhibition of pruritogens-induced ERK activation was involved in anti-itch effects of antioxidants in mice 31. Furthermore, blockade of TRPA1 or antioxidants treatment significantly decreased MGO-induced ERK activation in spinal cord in mice. Thus, these data suggests that TRPA1 activation and oxidative stress are required for MGO-induced ERK activation and itch behavior.

Does MGO play a role in diabetic hypoalgesia?

To date, molecular mechanisms underlying loss of pain perception (hypoalgesia) in diabetic neuropathy remain poorly understood. Notably, animal models for diabetic neuropathy showed either thermal hyperalgesia or hypoalgesia, dependent on species or time course of disease 11; 71; 72. It was reported that thermal hyperalgesia and mechanical allodynia were developed in STZ-induced diabetic rats 15; 49; 73, while thermal hypoalgesia and tactile allodynia were developed in STZ-induced diabetic mice 74. It was showed thermal hyperalgesia was developed in the early phase and thermal hypoalgeisa occurred in the late phase in diabetic mice 72. In our study, thermal hypoalgesia developed in STZ-induced diabetic mice after STZ injection 5 weeks, while tactile allodynia developed in diabetic mice one week after STZ injection. MGO is widely appreciated to be a key precursor of advanced glycation end products (AGEs) 19. Interestingly, a previous study found that the receptor for advanced glycation end products (RAGE), a receptor associated with sustained NF-κB activation contributed to hypoalgesia in diabetic mice 11. Our present results showed that systemic or intrathecal injection of MGO induced thermal hypoalgesia in normal mice, indicating that elevated MGO level may contributes to loss of pain perception under diabetic neuropathy. We further showed that blockade of TRPA1 channel in spinal cord abolished MGO-induced thermal hypoalgesia, suggesting activation of spinal TRPA1 channel contributes to MGO-mediated thermal hypoalgesia in normal mice. In STZ-induced diabetic mice, administration of MGO scavengers or TRPA1 blockers reversed thermal hypoalgesia, suggesting MGO-mediated activation of TRPA1 in the spinal cord mediates thermal hypoalgesia under diabetes condition. It is noteworthy that a recent study revealed that spinal TRPA1 activation produces hypoalgesia (or anti-nociception) in mice, possibly via central modulation of synaptic transmission in spinal cord 75. Thus, our data reveals an alternative mechanism underlying thermal hypoalgesia induced by diabetic neuropathy, which involved in MGO-mediated direct activation of TRPA1 in the spinal cord. Thus, neutralizing MGO or blockade TRPA1 in the spinal cord could be a potential therapeutic strategy for thermal hypoalgesia in diabetic neuropathy.

Conclusions

In summary, the results we present in this study focus on the role of Nav1.7 and MGO-mediated activation of TRPA1 in diabetic itch and hypoalgesia in mice. Although clinical evidence supporting MGO as a pruritogen is still lacking, we have provided strong preclinical evidences that Nav1.7 and activation of TRPA1 in the DRG neurons are required for itch induced by MGO or in STZ-induced diabetic mice. Additionally, MGO-mediated activation of TRPA1 in the spinal cord contributes to thermal hypoalgesia in STZ-induced diabetic mice. Thus, these findings will help to develop novel effective treatments of itch and hypoalgesia related to diabetic neuropathy by neutralizing excessive MGO, blocking TRPA1 channel, and/or inhibiting ERK signaling pathways. Supplementary methods and figures. Click here for additional data file.
  75 in total

1.  Nociceptive-specific activation of ERK in spinal neurons contributes to pain hypersensitivity.

Authors:  R R Ji; H Baba; G J Brenner; C J Woolf
Journal:  Nat Neurosci       Date:  1999-12       Impact factor: 24.884

2.  Biochemistry and molecular cell biology of diabetic complications.

Authors:  M Brownlee
Journal:  Nature       Date:  2001-12-13       Impact factor: 49.962

Review 3.  Methylglyoxal in living organisms: chemistry, biochemistry, toxicology and biological implications.

Authors:  M P Kalapos
Journal:  Toxicol Lett       Date:  1999-11-22       Impact factor: 4.372

Review 4.  Methylglyoxal comes of AGE.

Authors:  Ravichandran Ramasamy; Shi Fang Yan; Ann Marie Schmidt
Journal:  Cell       Date:  2006-01-27       Impact factor: 41.582

5.  Loss of pain perception in diabetes is dependent on a receptor of the immunoglobulin superfamily.

Authors:  Angelika Bierhaus; Karl-Matthias Haslbeck; Per M Humpert; Birgit Liliensiek; Thomas Dehmer; Michael Morcos; Ahmed A R Sayed; Martin Andrassy; Stephan Schiekofer; Jochen G Schneider; Jörg B Schulz; Dieter Heuss; Bernhard Neundörfer; Stefan Dierl; Jochen Huber; Hans Tritschler; Ann-Marie Schmidt; Markus Schwaninger; Hans-Ulrich Haering; Erwin Schleicher; Michael Kasper; David M Stern; Bernd Arnold; Peter P Nawroth
Journal:  J Clin Invest       Date:  2004-12       Impact factor: 14.808

6.  ERK is sequentially activated in neurons, microglia, and astrocytes by spinal nerve ligation and contributes to mechanical allodynia in this neuropathic pain model.

Authors:  Zhi-Ye Zhuang; Peter Gerner; Clifford J Woolf; Ru-Rong Ji
Journal:  Pain       Date:  2005-01-26       Impact factor: 6.961

7.  Influence of genotype, dose and sex on pruritogen-induced scratching behavior in the mouse.

Authors:  Amanda D Green; Katrina K Young; Sonya G Lehto; Shad B Smith; Jeffrey S Mogil
Journal:  Pain       Date:  2006-05-11       Impact factor: 6.961

8.  Phosphatidylinositol 3-kinase activates ERK in primary sensory neurons and mediates inflammatory heat hyperalgesia through TRPV1 sensitization.

Authors:  Zhi-Ye Zhuang; Haoxing Xu; David E Clapham; Ru-Rong Ji
Journal:  J Neurosci       Date:  2004-09-22       Impact factor: 6.167

9.  Activation of spinal ERK signaling pathway contributes to pain-related responses induced by scorpion Buthus martensi Karch venom.

Authors:  Xue-Yan Pang; Tong Liu; Feng Jiang; Yong-Hua Ji
Journal:  Toxicon       Date:  2008-01-17       Impact factor: 3.033

10.  Influence of TRPV1 on diabetes-induced alterations in thermal pain sensitivity.

Authors:  Reddy M Pabbidi; Shuang-Quan Yu; Siying Peng; Romesh Khardori; Mary E Pauza; Louis S Premkumar
Journal:  Mol Pain       Date:  2008-03-01       Impact factor: 3.395

View more
  16 in total

1.  New insights into the mechanisms behind mechanical itch.

Authors:  Kent Sakai; Tasuku Akiyama
Journal:  Exp Dermatol       Date:  2020-07-19       Impact factor: 3.960

2.  Study of the Involvement of the P2Y12 Receptor in Chronic Itching in Type 2 Diabetes Mellitus.

Authors:  Xiumei Xu; Huiqing Zhang; Lin Li; Runan Yang; Guilin Li; Shuangmei Liu; Günther Schmalzing; Hong Nie; Shangdong Liang
Journal:  Mol Neurobiol       Date:  2022-01-09       Impact factor: 5.590

Review 3.  Neuroinflammation Involved in Diabetes-Related Pain and Itch.

Authors:  Xiao-Xia Fang; Heng Wang; Hao-Lin Song; Juan Wang; Zhi-Jun Zhang
Journal:  Front Pharmacol       Date:  2022-06-20       Impact factor: 5.988

4.  Glabridin, a bioactive component of licorice, ameliorates diabetic nephropathy by regulating ferroptosis and the VEGF/Akt/ERK pathways.

Authors:  Hongtao Tan; Junxian Chen; Yicong Li; Yingshan Li; Yunchang Zhong; Guangzhao Li; Lingling Liu; Yiqun Li
Journal:  Mol Med       Date:  2022-05-20       Impact factor: 6.376

5.  3'-O-Methylorobol Inhibits the Voltage-Gated Sodium Channel Nav1.7 with Anti-Itch Efficacy in A Histamine-Dependent Itch Mouse Model.

Authors:  Fan Zhang; Ying Wu; Shuwen Xue; Shuangyan Wang; Chunlei Zhang; Zhengyu Cao
Journal:  Int J Mol Sci       Date:  2019-12-01       Impact factor: 5.923

Review 6.  Advances in Understanding the Initial Steps of Pruritoceptive Itch: How the Itch Hits the Switch.

Authors:  Shirin Kahremany; Lukas Hofmann; Arie Gruzman; Guy Cohen
Journal:  Int J Mol Sci       Date:  2020-07-10       Impact factor: 5.923

7.  New Insight into the Origins of Itch and Pain: How are Itch and Pain Signals Coded and Discriminated by Primary Sensory Neurons?

Authors:  Yue Hu; Wen-Qi Shan; Bin Wu; Tong Liu
Journal:  Neurosci Bull       Date:  2021-03-08       Impact factor: 5.203

8.  IL-33/ST2 induces neutrophil-dependent reactive oxygen species production and mediates gout pain.

Authors:  Chengyu Yin; Boyu Liu; Yuanyuan Li; Xiaojie Li; Jie Wang; Ruixiang Chen; Yan Tai; Qiyang Shou; Ping Wang; Xiaomei Shao; Yi Liang; Hong Zhou; Wenli Mi; Jianqiao Fang; Boyi Liu
Journal:  Theranostics       Date:  2020-10-27       Impact factor: 11.556

9.  Circular RNA circPPM1F modulates M1 macrophage activation and pancreatic islet inflammation in type 1 diabetes mellitus.

Authors:  Caiyan Zhang; Xiao Han; Lan Yang; Jinrong Fu; Chengjun Sun; Saihua Huang; Wenfeng Xiao; Yajing Gao; Qiuyan Liang; Xiang Wang; Feihong Luo; Wei Lu; Yufeng Zhou
Journal:  Theranostics       Date:  2020-08-29       Impact factor: 11.556

Review 10.  Th2 Modulation of Transient Receptor Potential Channels: An Unmet Therapeutic Intervention for Atopic Dermatitis.

Authors:  Jianghui Meng; Yanqing Li; Michael J M Fischer; Martin Steinhoff; Weiwei Chen; Jiafu Wang
Journal:  Front Immunol       Date:  2021-06-30       Impact factor: 7.561

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.