Literature DB >> 31276057

Detection of Antibiotic Resistance and Classical Enterotoxin Genes in Coagulase -negative Staphylococci Isolated from Poultry in Poland.

Ewelina Pyzik1, Agnieszka Marek1, Dagmara Stępień-Pyśniak1, Renata Urban-Chmiel1, Łukasz S Jarosz2, Izabella Jagiełło-Podębska3.   

Abstract

INTRODUCTION: The study sought to characterise antimicrobial resistance among coagulase-negative Staphylococcus (CNS) species recovered from broiler chickens and turkeys in Poland including the presence of 12 antimicrobial resistance genes and five classical genes of staphylococcal enterotoxins.
MATERIAL AND METHODS: A panel of 11 antimicrobial disks evaluated the phenotypic sensitivity of the tested strains to antibiotics. Five multiplex PCR assays were performed using primer pairs for specific detection of antibiotic resistance genes and staphylococcal enterotoxin A to E genes.
RESULTS: Selected antimicrobial agent susceptibility testing revealed 100% of such in in vitro conditions to cefoxitin among strains of Staphylococcus sciuri and S. chromogenes. The blaZ (for ß-lactam) and mecA (for methicillin resistance) genes were in 58.3% and 27.5% of strains, respectively. Among genes resistant to tetracyclines, tetK was most frequent. Fewer (CNS) strains showed genes resistant to macrolides, lincosamides, and florfenicol/chloramphenicol. Multiplex PCR for classical enterotoxins (A-E) detected the see gene in two S. hominis strains, while the seb gene producing enterotoxin B was found in one strain of S. epidermidis.
CONCLUSION: CNS strains of Staphylococcus isolated from poultry were either phenotypically or genotypically multidrug resistant. Testing for the presence of the five classical enterotoxin genes showed that CNS strains, as in the case of S. aureus strains, can be a source of food intoxications.

Entities:  

Keywords:  antimicrobial resistance genes; coagulase-negative Staphylococcus; enterotoxigenicity; methicillin-resistant Staphylococcus; poultry

Year:  2019        PMID: 31276057      PMCID: PMC6598191          DOI: 10.2478/jvetres-2019-0023

Source DB:  PubMed          Journal:  J Vet Res        ISSN: 2450-7393            Impact factor:   1.744


Introduction

The genus Staphylococcus consists of 51 species and 27 sub-species (www.bacterio net/staphylococcus. html). The coagulase-positive S. aureus causes infections in humans and animals, and is consequently the most important species in this genus and one of the causes of food intoxication (1, 3, 5, 18, 24). Other Staphylococcus species termed coagulase-negative staphylococci (CNS) have gained in importance as they have been implicated in a variety of opportunistic infections in humans and animals (21, 26). Until recently, CNS were considered non-pathogenic members of the genus and thus were of little interest to scientists, but following their implication in infections in humans and animals, research interest in CNS has increased over the past decade (29). Coagulase-negative staphylococci, including many species such as S. gallinarum, S. arlettae, S. chromogenes, S. xylosus, and S. epidermidis, have commonly been isolated from the nares and skin of chickens (24, 29). Although CNS in chickens have generally been accepted as harmless inhabitants, it has gradually become clear that they manifest pathogenicity under suitable conditions. The CNS S. sciuri, S. simulans, and S. epidermidis have been isolated from cases of dermatitis, tendonitis, and endocarditis in chickens (26). CNS can also be opportunistic pathogens in humans, when they are often associated with medical devices, which the frequent causation of nosocomial infections by S. epidermidis bears out (21). The pathogenesis of CNS species relies on factors required for their commensal mode of life and one such factor increasing the importance of these microorganisms in the pathology of mammals and birds is their resistance to numerous antimicrobial agents (29). Slaughter poultry has been identified as one of the most important vehicles for antimicrobial-resistant foodborne pathogens and antimicrobial resistance genes (31). Detailed analysis of the resistance genes present in livestock-associated staphylococci has revealed a wide variety of them. These mainly include genes which are known to be commonly present in staphylococci of human and animal origin, such as the β-lactamase gene blaZ, methicillin resistance gene mecA, tetracycline resistance genes tet(K), tet(L), tet(M), and tet(O), macrolide-lincosamide-streptogramin B (MLSB) resistance genes erm(A) and erm(B), gene of inducible resistance to erythromycin msrA/B, aac (6′)-Ie aph (2″)-Ia gene of aminoglycoside modifying enzymes, and florfenicol/chloramphenicol resistance gene (cfr) (31). Resistance of Staphylococcus to methicillin is currently a global problem. The mechanisms of methicillin resistance in CNS are identical to those reported for S. aureus; however, mecA gene-mediated resistance is frequently expressed at lower levels than in methicillin-resistant S. aureus (MRSA), which makes it difficult to detect (31). Although research interest in CNS has increased in recent years, there is very little data on their prevalence and resistance profiles in poultry production. Therefore, the objectives of this study were to characterise the diversity of CNS Staphylococcus recovered from poultry in western Poland and to assess the isolates as potential dispersion vectors for the spread of antimicrobial resistance genes and genes encoding enterotoxicity.

Material and Methods

Sample collection. The study was conducted on material derived from broiler chickens and turkeys on farms located in central-western Poland between November 2016 and December 2017. During this time, samples from 137 flocks were collected. From each flock, randomly selected birds showing clinical signs of disease were examined and sampled to provide 3 to 5 specimens from the affected organs of each bird. A total of 435 samples from broilers and 112 samples from turkeys were collected, comprising material from the heart, liver, tarsal joints, and bone marrow of birds aged 1 day to 6 weeks (chickens) or 20 weeks (turkeys). The birds from which samples were taken showed increased mortality, dermatitis, cellulitis, lameness, arthritis, decreased weight gain, omphalitis, or yolk sac infections. The size of the flocks from which the samples were collected ranged from 8,000 to 44,000 birds. The material collected was plated on a blood agar medium (Blood LAB-AGAR, Biocorp, Poland) and Chapman selective medium (Mannitol Salt LAB-AGAR, Biocorp, Poland) and incubated under aerobic conditions at 37°C for 24–48 h, depending on the rate of growth of the bacteria. Single colonies were transferred to blood agar to isolate pure bacterial cultures, and a preliminary bacteriological characterisation was made of the isolated microbiota, involving Gram-staining, cell morphology and motility, examination under a microscope, and determination of the type of haemolysis. Quantitative measurement of the colonies was not performed. Isolated bacteria were stored for further testing at −85°C in 50% (v/v) glycerol in brain heart infusion broth (BHI, Sigma, Germany). Identification of bacterial strains. Identification of all Staphylococcus strains was carried out with MALDI-TOF mass spectrometry using the IVD MALDI Biotyper (Bruker Daltonik, Germany), as described by Marek et al. (15). Bacterial DNA extraction. Total DNA was extracted from strains inoculated individually on blood agar and incubated at 37°C/24 h. The Novabeads Bacterial DNA kit (Novazym, Poland) was used for DNA extraction according to the manufacturer’s protocol. Antimicrobial susceptibility testing. The phenotypic antimicrobial sensitivity response was evaluated using a panel of 11 antimicrobial discs which belonged to seven classes of antimicrobial agents (13). Disc diffusion tests were performed for each of the 127 isolates in their species groups, identified to be S. cohnii, S. epidermidis, S. haemolyticus, S. hominis, S. simulans, S. saprophyticus, S. lentus, S. xylosus, S. sciuri, and S. chromogenes using the method recommended by the CLSI (4). The drug-susceptibility profiles for the bacteria were determined for the following agents, supplied as discs (Oxoid, UK): amoxicillin 25 μg (AML25), amoxicillin + clavulanic acid 20 + 10 μg (AMC30), ampicillin 10 μg (AMP10), penicillin G 10 units (P10), cefoxitin 30 μg (FOX30), clindamycin 2 μg (DA2), chloramphenicol 30 μg (C30), erythromycin 15 μg (E15), tetracycline 30 μg (TE30), gentamycin 10 μg (CN10), and trimethoprim sulphamethoxazole 1:19, 25 μg (SXT25). For quality control, S. aureus ATCC 25923, S. aureus ATCC43300, and S. aureus ATCC 29213 were used in the disc diffusion tests. Multiplex PCR for antibiotic resistance genes. The PCR primers for the blaZ, mecA, aac(6’)-aph(2”), ermA, ermB, msrA/B, tetM, tetK, tetL, tetO, and cfr antibiotic resistance genes are listed in Table 1. Four different multiplex PCR assays were used, including all of the primer pairs for specific detection of antibiotic resistance genes. Multiplex PCR amplifications were performed according to Malhota-Kumar et al. (14), Toomey et al. (27), Vakulenko et al. (28), and Garofalo et al. (7). An internal control was integrated into every PCR to verify the efficiency of the amplification and to ensure that there was no significant PCR inhibition.
Table 1

Nucleotide sequences and sizes of PCR products of antibiotic resistance genes and enterotoxins (A–E)

Primer*Oligonucleotide sequence (5’-3’)**Genesize of amplified product (bp)Control strainReferences
MEC-1AAAATCGATGGTAAAGGTTGGCS. aureus
MEC-2AGTTCTGGCACTACCGGATTTGCmecA533ATCC43300(17)
BLAZ-1ACTTCAACACCTGCTGCTTTCblaZ240S. aureus(7)
BLAZ-2TAGGTTCAGATTGGCCCTTAGATCCBAA-2312
TETM-1GAACTCGAACAAGAGGAAAGCS. pyogenes
TETM-2ATGGAAGCCCAGAAAGG TtetM4067020
TETK-1TCGATAGGAACAGCAGTAE. faecium
TETK-2CAGCAGATCCTACTCCTTtetK155ET18(13)
TETL-1TGGTGGAATGATAGCCCATT
TETL-1CAGGAATGACAGCACGCTAAtetL229
TETO-1AACTTAGGCATTCTGGCTCACE. faecalis
TETO-2TCCCACTGTTCCATATCGTCAtetO515JH2-2TET
ERMA-1CCCGAAAAATACGCAAAATTTCATS. haemolyticus
ERMA-2CCCTGTTTACCCATTTATAAACGermA590955
ERMB-1TGGTATTCCAAATGCGTAATGE. faecium(13, 14)
ERMB-2CTGTGGTATGGCGGGTAAGTermB745PE1
MSRA/B-1GCAAATGGTGTAGGTAAGACAACTS. aureus
MSRA/B-2ATCATGTGATGTAAACAAAATmsrA/B399RN4220(26)
ACC-1CAGGAATTTATCGAAAATGGTAGAAAAGacc(6’)-le-E. faecium
ACC-2CACAATCGACTAAAGAGTACCAATCaph(2”)-la348M48(27, 28)
CFR-1TGAAGTATAAAGCAGGTTGGGAGTCA
CFR-2ACCATATAATTGACCACAAGCAGCcfr746(11)
ESA1ACGATCAATTTTTACAGCS. aureus
ESA2TGCATGTTTTCAGAGTTAATCsea144FRI913(1)
ESB1GAATGATATTAATTCGCATCATCC13566
ESB2TCTTTGTCGTAAGATAAACTTCseb416(5)
ESC1GACATAAAAGCTAGGAATTTS. aureus
ESC2AAATCGGATTAACATTATCCAsec257FRI913(1)
ESD1TTACTAGTTTGGTAATATCTCCTTS. aureus
ESD2CCACCATAACAATTAATGCsed334FRI151m(3)
ESE1ATAGATAAAGTTAAAACAAGCAAS. aureus
ESE2TAACTTACCGTGGACCCsee170FRI913(3)

* The sets of primers were synthesised by Genomed S.A., Poland.

** The concentration of primers was 0.04 μmol

Nucleotide sequences and sizes of PCR products of antibiotic resistance genes and enterotoxins (A–E) * The sets of primers were synthesised by Genomed S.A., Poland. ** The concentration of primers was 0.04 μmol Prevalence of toxin genes in . Strains were assayed in a multiplex PCR for detection of genes to staphylococcal enterotoxins A to E (sea, seb, sec, sed, and see) using five pairs of primers (Table 1). The conditions for multiplex PCR were previously described by Bystroń et al. (3).

Results

Bacterial strains. A total of 237 bacterial strains belonging to the genus Staphylococcus and representing 23 species were isolated from test material. The percentages of strains belonging to each species were as follows: S. aureus 30.0%, S. cohnii 14%, S. saprophyticus 8.4%, S. epidermidis 7.2%, S. xylosus 6.3%, S. pseudintermedius 5.1%, S. sciuri 4.2%, S. lentus 4.2%, S. chromogenes 3.4%, S. arlettae 3.4%, S. equorum 3%, S. simulans 2.1%, S. hominis 1.7%, S. haemolyticus 1.7%, S. schleiferi subsp. schleiferi 1.3%, S. intermedius 0.8%, S. warneri 0.8%, S. alactolyticus 0.4%, S. capitis 0.4%, S. condimenti 0.4%, S. felis 0.4%, S. vitulinus 0.4%, and S. pasteuri 0.4%. Staphylococcus strains belonging to 10 species were selected for further analysis. These were S. cohnii (n = 33), S. saprophyticus (n = 20), S. epidermidis (n = 17), S. xylosus (n = 15), S. lentus (n = 10), S. sciuri (n = 10), S. chromogenes (n = 9), S. simulans (n = 5), S. haemolyticus (n = 4), and S. hominis (n = 4). Phenotypic susceptibility of the isolated bacteria to selected antimicrobial agents. The susceptibility testing of the isolated strains to 11 selected antimicrobial agents showed 100% susceptibility in in vitro conditions to amoxicillin + clavulanic acid of 20 strains of S. saprophyticus and 10 strains of S. sciuri. Cefoxitin susceptibility of 100% was observed in 10 strains of S. sciuri and 9 strains of S. chromogenes. A relatively high percentage of CNS strains were found to be susceptible to chloramphenicol (96.9%), clindamycin (94.5%), trimethoprim- 53.3% of S. xylosus) and tetL (in 77.8% of sulphamethoxazole (92.9%), erythromycin (85.8%), S. chromogenes and 75% of S. haemolyticus). The and amoxicillin (78.7%). Considerably more isolates presence of the tetM gene was demonstrated in 60% exhibited resistance to gentamycin (25.2%). Almost strains of S. lentus and 60% of S. simulans. The half of the CNS strains were resistant to ampicillin presence of the tetO gene was noted in 2 out of 9 (49.6%), and over half to other antimicrobial agents, isolates of S. chromogenes, 2 out of 10 S. sciuri with 54.3% of strains resistant to penicillin G and isolates, and in 1 out of 17 S. epidermidis isolates. In 59.1% resistant to tetracycline. Detailed data are the case of the two erythromycin ribosomal methylase presented in Table 2. The antimicrobial resistance genes tested, 4.72% strains of CNS contained ermA patterns of the isolates are shown in Table 3. (2/33 S. cohnii, 1/4 S. haemolyticus, 1/10 S. sciuri and
Table 2

Phenotypic* antimicrobial resistance of Staphylococcus strains isolated from broiler chickens and turkeys

AntibioticS. epidermidisS. hominisS. saprophyticusS. lentusS. xylosusS. haemolyticusS. sciuriS. simulansS. chromogenesS. cohniiTotal2

n = 17n = 4n = 20n = 10n = 15n = 4n = 10n = 5n = 9n = 33n = 127

R1I1RIRIRIRIRIRIRIRIRINumber%
Amoxicillin323-2-113-211--121312721.3
Amoxicillin + clavulanic acid2-1---1-2-1----11-1-107.9
Ampicillin9-4-816-7-223-113-16-6349.6
Penicillin G1014-8-7-9-4-2-314-1516954.3
Cefoxitin7-1-1-2-3-1---1---5-2116.5
Clindamycin2--1--1-1-1-------1-75.5
Chloramphenicol1---1-------------2-43.1
Erythromycin4-1---3-2-1-2-----5-1814.1
Gentamycin511-4-417---4---2-3-3225.2
Tetracycline8-2-154619-223-3-6-1317559.1
Trimethoprim -sulphamethoxazole2---3-1---------1-2-97.1

* The susceptibility of 11 antibiotics was tested using a standard disc diffusion method on Mueller–Hinton agar plates

1R - resistant, I - intermediate

2The resistance rate was calculated as the number of intermediate and resistant isolates divided by the total number of isolates

Table 3

Multidrug resistance profiles of CNS from broiler chickens and turkeys

Staphylococcus spp.Phenotypic resistance combination pattern1,2n = number of classes antimicrobial agents3number of strains
P, AMP12
P, AMP, TE27
S. cohniiP, AMP, TE, SXT32
P, AMP, TE, AML, FOX, E32
P, AMP, TE, AML, FOX, E, CN, C52
P, AMP, TE, AMC, FOX, E, CN, DA51

TE110
TE, AMP21
S. saprophyticusTE, P, AMP23
TE, P, AMP, AML, FOX21
TE, P, AMP, CN, SXT43
TE, P, AMP, CN, AML, C41

P12
P, AMP, CN21
P, AMP, TE21
S. epidermidisP, AMP, FOX, TE, SXT31
P, AMP, FOX, TE, SXT, C41
P, AMP, FOX, TE, CN, AML31
P, AMP, FOX, TE, CN, AML, E, DA52
P, AMP, FOX, TE, CN, AML, E, AMC42

P, TE22
P, AMP, TE, CN32
S. xylosusP, AMP, TE, CN, E42
P, AMP, TE,CN, AMC, AML, FOX32
P, AMP, TE, CN, AML, FOX, DA41

E, CN22
S. sciuriAMP, TE, CN31
AMP, TE, P21
AMP, TE, P, CN, AML31

P, TE21
P, AMP, TE, SXT31
S. lentusP, AMP, TE, CN, E43
P, AMP, TE, CN, AML, FOX31
P, AMP, TE, CN, AMC, AML, FOX, DA41

TE11
TE, P, CN32
S. chromogenesTE, AMP, AML21
TE, P, AMP, AML, SXT31
TE, P, AMP, AML, AMC31

P, TE22
S. simulansP, AMP, TE21
P, AMP, AML, AMC, FOX21

P, AMP, CN, E31
S. hominisP, AMP, AML, TE22
P, AMP, AML, AMC, FOX, DA21

P, AMP, AML, TE23
S. haemolyticusP, AMP, AMC, DA, E, FOX, TE41

AMC – amoxicillin + clavulanic acid; AML – amoxicillin; AMP – ampicillin; C – chloramphenicol; CN – gentamicin; DA – clindamycin; E – erythromycin; FOX – cefoxitin; P – penicillin; SXT – sulfamethoxazole/trimethoprim; TE – tetracycline

2The resistance rate was calculated as the number of intermediate and resistant isolates divided by the total number of isolates

3Applied classes of antimicrobial agents: aminoglycosides, penicillins + b-lactamase inhibitors, lincosamides, macrolides, phenicols, tetracyclines, and folate pathway inhibitors

Phenotypic* antimicrobial resistance of Staphylococcus strains isolated from broiler chickens and turkeys * The susceptibility of 11 antibiotics was tested using a standard disc diffusion method on Mueller–Hinton agar plates 1R - resistant, I - intermediate 2The resistance rate was calculated as the number of intermediate and resistant isolates divided by the total number of isolates Multidrug resistance profiles of CNS from broiler chickens and turkeys AMC – amoxicillin + clavulanic acid; AML – amoxicillin; AMP – ampicillin; C – chloramphenicol; CN – gentamicin; DA – clindamycin; E – erythromycin; FOX – cefoxitin; P – penicillin; SXT – sulfamethoxazole/trimethoprim; TE – tetracycline 2The resistance rate was calculated as the number of intermediate and resistant isolates divided by the total number of isolates 3Applied classes of antimicrobial agents: aminoglycosides, penicillins + b-lactamase inhibitors, lincosamides, macrolides, phenicols, tetracyclines, and folate pathway inhibitors Antimicrobial resistance genes. All isolates were 2/9 S. chromogenes), and 4.72% contained the ermB investigated for the presence of genes encoding gene (1/17 S. epidermidis, 3/10 S. lentus, and 2/15 resistance to methicillin, beta-lactamase, tetracycline, S. xylosus). The msrA/B gene encoding an ATP-macrolide-lincosamide-streptogramin B (MLSB), dependent efflux pump was shown in 7.9% of the CNS macrolides and streptogramin B (MSB type resistance), strains (3/33 strains of S. cohnii, 3/17 S. epidermidis, aminoglycoside, and florfenicol/chloramphenicol. The 1/4 S. hominis, 1/15 S. xylosus, and 2/10 S. sciuri). The results are summarised in Table 4. aac(6’)-Ie-aph(2”)-Ia gene was determined present in
Table 4

PCR for the presence of genes of antimicrobial resistance in Staphylococcus strains isolated from broiler chickens and turkeys

SpeciesNumber of positive samples
tetKtetLtetMtetOermAermBaac (6′)-Ie aph (2″)-Iamsr A/BcfrblaZmecA
S. cohnii (33)1341-2-131266
S. epidermidis (17)82-1-1631159
S. hominis (4)-11----1-42
S. saprophyticus (20)1152---1-181
S. lentus (10)216--3---61
S. xylosus (15)821--2-1-65
S. haemolyticus (4)13--1----33
S. sciuri (10)23221-12-24
S. simulans (5)123------11
S. chromogenes (9)-7122-2--33
total: 127463017566111037435
PCR for the presence of genes of antimicrobial resistance in Staphylococcus strains isolated from broiler chickens and turkeys Of the 127 CNS strains, 35 had the mecA gene: 11 isolates (1/33 S. cohnii, 6/17 S. epidermidis, 9/17 S. epidermidis, 6/33 S. cohnii, 5/15 S. xylosus, 1/20 S. saprophyticus, 1/10 S. sciuri, and 2/9 4/10 S. sciuri, 3/9 S. chromogenes, 3/4 S. haemolyticus, S. chromogenes). The genomes of three CNS strains 2/4 S. hominis, 1/20 S. saprophyticus, 1/10 S. lentus, contained the florfenicol/chloramphenicol resistance and 1/5 S. simulans. The presence of the blaZ gene gene (cfr), those strains belonging to the species determining resistance to β-lactam antibiotics was S. cohnii, S. epidermidis, and S. saprophyticus. demonstrated in 74 strains of coagulase-negative Prevalence of toxin genes in staphylococci. This gene was detected in 100% of isolates. The results of a multiplex PCR for the five strains belonging to the species S. hominis, 88.2% of classical enterotoxins A–E showed that the genome of S. epidermidis, 78.8% of S. cohnii, 75% of two S. hominis strains contained the gene see, S. haemolyticus, and 60% of S. lentus. However, fewer responsible for the production of enterotoxin E. The than half of the strains belonging to other species gene responsible for the production of enterotoxin B revealed the presence of the blaZ gene. Tetracycline (seb) was found in one strain of S. epidermidis. None of resistance in the results was indicated most frequently the CNS strains had genes responsible for the by the genes tetK (in 55% of S. saprophyticus and production of enterotoxins A, C or D.

Discussion

In the present study, 237 Staphylococcus strains were isolated from samples taken from birds in chicken and turkey flocks. Of these, 35.9% isolates were identified as coagulase-positive Staphylococcus species and 64.1% as CNS by MALDI-TOF mass spectrometry. The high number of CNS isolated in this study could be due to the fact that CNS are abundant in the normal skin flora and mucosa of animals and some are free-living in the environment (21). Although normally present, several of these commensal and non-pathogenic staphylococci have been implicated in infections (16). CNS has been isolated from clinically infected chickens with cellulitis, granulomas in the liver and lungs, gangrenous dermatitis, or subcutaneous abscesses. S. xylosus and S. simulans have been recovered from infected bones and in the course of endocarditis (15, 16, 26). These staphylococcal species can also induce subclinical disease with histopathological lesions in the liver, spleen, and intestines of infected chickens (17, 19). The predominant CNS species found in this study were S. cohnii and S. saprophyticus, which are included among commonly reported skin microbiota in chickens (24). In studies published by various authors, the percentage of coagulase-negative Staphylococcus species isolated from poultry samples varies significantly. For example, in a study by Boamah et al. (2), the levels of coagulase-negative strains of staphylococci isolated from samples taken from poultry were as follows: S. sciuri 42.97%, S. lentus 35.94%, S. xylosus 4.30%, S. haemolyticus 3.91%, S. saprophyticus 1.95%, and S. cohnii 0.39%. In a report by Simjee et al. (25), 38% of the coagulase negative Staphylococcus spp. were S. sciuri, while S. lentus and S. xylosus constituted 21% and 14%, respectively. El-Nagar et al. (6) in Egypt found the CNS isolate prevalences from poultry samples to be 34.49% for S. xylosus, 17.25% for S. warneri, 10.34% for S. epidermidis, S. saprophyticus, S. simulans, and S. hominis, and 6.9% for S. capitis. Coagulase-negative Staphylococcus species such as S. sciuri, S. xylosus or S. cohnii are considered important poultry pathogens, particularly because they carry genes encoding antimicrobial resistance. The use of antibiotics in poultry production has increased in recent years (24). This extensive use of antibiotics in poultry stimulates bacteria to produce mechanisms of antibiotic resistance, both in the resident bacterial population present in birds as saprophytes and in common pathogens. It is estimated that about 70% of pathogenic microorganisms leading to nosocomial infections are resistant to at least one antimicrobial drug which was previously effective (2). Contaminated poultry products may disseminate resistant pathogenic microorganisms to people as food or via direct human-animal contact, and a resulting infection brings high treatment costs (29). In our study, each of the ten CNS Staphylococcus phenotypically exhibited some level of resistance to tetracycline, penicillin G, and ampicillin. All the species were most resistant to tetracycline (59.1%) and penicillin G (54.3%). Moreover, 39 (30.7%) of the CNS isolates exhibited simultaneous resistance to three or more classes of antimicrobial agents as Table 3 shows, which is referred to as multi-drug resistance (MDR) (13). It is noteworthy that 15.7% of the tested CNS strains showed resistance to four or even five of the classes of antimicrobial agents used. Methicillin resistance in this study was confirmed by detection of the mecA gene, because according to CLSI, oxacillin MIC criteria may have limit values for some CNS, so testing for mecA or PBP2a is recommended for some strains (4). The results of this test, shown in Table 4, indicate that the presence of the mecA gene was confirmed in 35 of 127 CNS isolates, which is 27.5% of the strains. Poultry farms and henhouses have been described as sources of antimicrobial resistance, as they are highly contaminated by dust containing endotoxins and aerosolised bacteria, including Staphylococcus (9). However, the reason methicillin-resistant staphylococci are found among chickens as yet remains unclear. Methicillin-resistant strains of Staphylococcus are still a growing therapeutic problem. The presence of the regulon mec promotes the reorganisation of bacterial genomes and to a large extent accelerates the evolution of genomic regions responsible for resistance to antibiotics and disinfectants (8). Methicillin-resistant S. aureus (MRSA) strains have a wide variety of resistance genes located in the chromosome as well as in plasmids and transposons (6). Literature data indicate that most strains harbouring the mecA gene also contained the tet and aac (6’)- Ie-aph (2”) genes, which might be located on the same or an associated genetic element (8). The mechanisms responsible for antimicrobial resistance in CNS are identical to those occurring in S. aureus (9). Our study also indicates that all CNS strains in which the aac (6’)- Ie-aph (2”) gene was detected additionally possessed the mecA gene and tetK or tetL genes; the two genes which, in the current study, mediate the most common tetracycline resistance mechanism. The tet genes are contained within conjugative transposons that can be transferred horizontally and expressed in Gram-positive and Gram-negative bacteria (14). Resistance to erythromycin in staphylococci is usually associated with resistance to other macrolides. The genes ermA and ermB encoding methyltransferases responsible for resistance to macrolides, lincosamides, and type B streptogramins (MLSB phenotype) through modification of the ribosomal target site have been found in staphylococci (22). The msrA/B gene displays another mechanism of inducible resistance to erythromycin by encoding an ATP-dependent efflux pump (23). In our study, the presence of the ermA gene was detected in six strains belonging to three species (2/33 S. cohnii, 1/4 S. haemolyticus, 1/10 S. sciuri, and 2/9 S. chromogenes). The ermB gene was shown in six strains belonging to three Staphylococcus species (1/17 S. epidermidis, 3/10 S. lentus, and 2/15 S. xylosus). In addition, the presence of the msrA/B gene was detected in 10 out of 127 CNS strains (3/33 S. cohnii, 3/17 S. epidermidis, 1/4 S. hominis, 1/15 S. xylosus, and 2/10 S. sciuri). Literature data indicate that the frequent use of macrolide and lincosamide antibiotics, especially in human medicine, have caused a significant increase in resistance to this group of drugs among various bacterial species around the world (31). In our study, phenotypic assessment of the sensitivity of CNS strains to erythromycin and clindamycin showed a relatively small percentage of resistant strains, 14.1% and 5.5%, respectively. This may be due to the fact that these two antibiotics are less commonly used in the treatment of bacterial infections in poultry. Aminoglycosides are one of the classes of antibiotics that are key in the treatment of staphylococcal infections. Inactivation of aminoglycoside antibiotics by aminoglycoside modifying enzymes (AME), such as aminoglycoside phosphotransferase (APH), acetyltransferases (AAC), and nucleotidyl-transferase (ANT), is the most common mechanism of aminoglycoside resistance (10). The most common AME-encoding gene among Staphylococcus species is aac (6’)-Ie-aph (2”), which can be harboured on a plasmid or chromosome and is often included on transposable elements. The bifunctional enzyme AAC (6’)-APH (2”) encoded by this gene can inactivate a broad range of aminoglycosides and confers concomitant resistance to gentamycin and most aminoglycosides commonly used in medical practice (12). In our study, the presence of the aac (6’)-Ie-aph (2”) gene was detected in strains belonging to five species (1/33 S. cohnii, 6/17 S. epidermidis, 1/20 S. saprophyticus, 1/10 S. sciuri, and 2/9 S. chromogenes). The phenotypic resistance rate to gentamycin in our study was 25.2%. This is a relatively high percentage of resistant strains, especially given that gentamycin is currently not used in the treatment of bacterial infections in poultry. The cfr gene encodes resistance to five different classes of antimicrobials: phenicols, lincosamides, oxazolidinones, pleuromutilins, and streptogramin A (12). It is located on a plasmid, although it can also be embedded in a bacterial chromosome. Coagulase-negative staphylococci are considered to be the most common bacteria to carry cfr (12). In a study by Wang et al. (30), 20 out of 21 cfr-positive CNS isolates from chickens, ducks, and pigs identified in China in 2012 were methicillin-resistant. In our study, the presence of the cfr gene was demonstrated in 3 out of 127 CNS strains (1/33 S. cohnii, 1/17 S. epidermidis, and 1/20 S. saprophyticus). The increasing drug resistance of staphylococci in animals can be a real threat to people due to the proven transmission of animal strains to humans. Horizontal gene transfer has been demonstrated between S. aureus and S. intermedius and between S. aureus and CNS staphylococci (8). The transmission of genes encoding resistance to antibiotics is facilitated by their localisation in mobile DNA fragments, and the cfr gene is an example of a gene with such a location (11). Staphylococcal enterotoxins (SE) constitute a family of biologically and structurally related toxins. The ingestion of these toxins results in gastrointestinal effects such as nausea, vomiting, diarrhoea, and abdominal pain. They are produced mainly by coagulase-positive staphylococci. CNS have been reported as a conveying vector for virulence genes and have also been implicated in some cases of food poisoning. In the study by El-Nagar et al. (6) on material collected from the poultry production chain, enterotoxin genes (seb, sec and see) were found in five strains (23.8%) of S. aureus, with a percentage of 9.5% for seb and sec and 4.8% for see, while sec and see were found in six (20.6%) CNS isolates, with a percentage of 10.3% for each. The sec gene was detected in two isolates of S. xylosus and one isolate of S. simulans, while see was detected in S. xylosus, S. warneri, and S. simulans. In our study, only 3 out of 127 strains tested had genes responsible for the production of one of the five classical staphylococcal enterotoxins. Two S. hominis strains contained the gene see, responsible for the production of enterotoxin E. The presence of the gene responsible for the production of enterotoxin B (seb) was found in one strain of S. epidermidis. Enterotoxin B (SEB) is the toxin most commonly associated with classic food poisoning. Staphylococcal enterotoxin B has been studied as a potential biological warfare agent, because it can be easily aerosolised, is very stable and can cause widespread systemic damage, multi-organ system failure, and even shock and death when inhaled at very high dosages (3). There are also reports of staphylococcal food poisoning in France where enterotoxin E (SEE) was the aetiological agent (20). In conclusion, the data reported above indicate that coagulase-negative strains of Staphylococcus spp. isolated from poultry can be a reservoir of antibiotic resistance genes, in particular the mecA gene and determinants of resistance to tetracyclines. The isolates were either phenotypically or genotypically multidrug resistant. CNS are recognised as very important bacteria in food production and preservation, and their presence in food animals is clearly significant for public health due to the possibility of antimicrobial resistant genes in those staphylococci. This appears to be linked to the frequent use of certain groups of antibiotics in particular animal species. Nevertheless, multi-resistant strains can also be isolated from animals that have not been treated with antibiotics. Testing for the presence of the five classic enterotoxin genes showed that only a small percentage of CNS strains from slaughter poultry had the seb and see genes. The fact that some strains of the isolates investigated in the present study can produce enterotoxins may, however, be important for public health.
  29 in total

Review 1.  Antibiotic resistance in gram-positive bacteria: epidemiological aspects.

Authors:  W Witte
Journal:  J Antimicrob Chemother       Date:  1999-09       Impact factor: 5.790

Review 2.  Nomenclature for macrolide and macrolide-lincosamide-streptogramin B resistance determinants.

Authors:  M C Roberts; J Sutcliffe; P Courvalin; L B Jensen; J Rood; H Seppala
Journal:  Antimicrob Agents Chemother       Date:  1999-12       Impact factor: 5.191

3.  Detection of the high-level aminoglycoside resistance gene aph(2")-Ib in Enterococcus faecium.

Authors:  S J Kao; I You; D B Clewell; S M Donabedian; M J Zervos; J Petrin; K J Shaw; J W Chow
Journal:  Antimicrob Agents Chemother       Date:  2000-10       Impact factor: 5.191

4.  Multiplex PCR for detection of aminoglycoside resistance genes in enterococci.

Authors:  Sergei B Vakulenko; Susan M Donabedian; Anatoliy M Voskresenskiy; Marcus J Zervos; Stephen A Lerner; Joseph W Chow
Journal:  Antimicrob Agents Chemother       Date:  2003-04       Impact factor: 5.191

5.  Distribution of Staphylococcus species on animal skin.

Authors:  A Shimizu; J Ozaki; J Kawano; Y Saitoh; S Kimura
Journal:  J Vet Med Sci       Date:  1992-04       Impact factor: 1.267

Review 6.  SCCmec in staphylococci: genes on the move.

Authors:  Anne-Merethe Hanssen; Johanna U Ericson Sollid
Journal:  FEMS Immunol Med Microbiol       Date:  2006-02

Review 7.  Pathogenesis of infections due to coagulase-negative staphylococci.

Authors:  Christof von Eiff; Georg Peters; Christine Heilmann
Journal:  Lancet Infect Dis       Date:  2002-11       Impact factor: 25.071

8.  Multiplex PCR for simultaneous detection of macrolide and tetracycline resistance determinants in streptococci.

Authors:  Surbhi Malhotra-Kumar; Christine Lammens; Jasper Piessens; Herman Goossens
Journal:  Antimicrob Agents Chemother       Date:  2005-11       Impact factor: 5.191

9.  Occurrence of enterotoxigenic strains of Staphylococcus aureus in raw poultry meat.

Authors:  J Bystroń; J Molenda; J Bania; K Kosek-Paszkowska; M Czerw
Journal:  Pol J Vet Sci       Date:  2005       Impact factor: 0.821

10.  Distribution of florfenicol resistance genes fexA and cfr among chloramphenicol-resistant Staphylococcus isolates.

Authors:  Corinna Kehrenberg; Stefan Schwarz
Journal:  Antimicrob Agents Chemother       Date:  2006-04       Impact factor: 5.191

View more
  9 in total

1.  First Report of the Presence of Enterotoxin Gene in Coagulase-negative Staphylococci Recovered from Meat of Snails (Achatina Achatina).

Authors:  Arthur C Okafor; Frank C Ogbo; Fred C Akharaiyi; Henry B Oladeinde
Journal:  J Vet Res       Date:  2022-06-07       Impact factor: 2.058

2.  Exploring Coagulase-Negative Staphylococci Diversity from Artisanal Llama Sausages: Assessment of Technological and Safety Traits.

Authors:  Annalisa Rebecchi; Francesco Miragoli; Constanza Lopez; Daniela Bassi; Cecilia Fontana
Journal:  Microorganisms       Date:  2020-04-27

Review 3.  Virulence Factors in Coagulase-Negative Staphylococci.

Authors:  Angela França; Vânia Gaio; Nathalie Lopes; Luís D R Melo
Journal:  Pathogens       Date:  2021-02-04

4.  Profiles of coagulase-positive and -negative staphylococci in retail pork: prevalence, antimicrobial resistance, enterotoxigenicity, and virulence factors.

Authors:  Gi Yong Lee; Soo-Jin Yang
Journal:  Anim Biosci       Date:  2021-01-01

5.  The presence of pathogens and heavy metals in urban peregrine falcons (Falco peregrinus).

Authors:  Ewelina Pyzik; Marta Dec; Dagmara Stępień-Pyśniak; Agnieszka Marek; Jose Louis Valverde Piedra; Agnieszka Chałabis-Mazurek; Klaudiusz Szczepaniak; Renata Urban-Chmiel
Journal:  Vet World       Date:  2021-07-03

Review 6.  Review on skeletal disorders caused by Staphylococcus spp. in poultry.

Authors:  Gustaw M Szafraniec; Piotr Szeleszczuk; Beata Dolka
Journal:  Vet Q       Date:  2022-12       Impact factor: 3.320

7.  Biofilm-Formation Ability and the Presence of Adhesion Genes in Coagulase-Negative Staphylococci Isolates from Chicken Broilers.

Authors:  Agnieszka Marek; Ewelina Pyzik; Dagmara Stępień-Pyśniak; Marta Dec; Łukasz S Jarosz; Anna Nowaczek; Magdalena Sulikowska
Journal:  Animals (Basel)       Date:  2021-03-07       Impact factor: 2.752

8.  First Case of Staphylococci Carrying Linezolid Resistance Genes from Laryngological Infections in Poland.

Authors:  Michał Michalik; Maja Kosecka-Strojek; Mariola Wolska; Alfred Samet; Adrianna Podbielska-Kubera; Jacek Międzobrodzki
Journal:  Pathogens       Date:  2021-03-13

9.  Multidrug-Resistant Methicillin-Resistant Coagulase-Negative Staphylococci in Healthy Poultry Slaughtered for Human Consumption.

Authors:  Vanessa Silva; Manuela Caniça; Eugénia Ferreira; Madalena Vieira-Pinto; Cândido Saraiva; José Eduardo Pereira; José Luis Capelo; Gilberto Igrejas; Patrícia Poeta
Journal:  Antibiotics (Basel)       Date:  2022-03-09
  9 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.