| Literature DB >> 31249448 |
Wei-Dong Fan1, Tao Chen2, Peng-Jun Liu3.
Abstract
BACKGROUND: NIMA related kinase 2 (NEK2) is closely related to mitosis, and it is currently considered to be over-expressed frequently in many poorly prognostic cancers. However, the effect of the up-regulated NEK2 on cellular signaling in tumors, such as gastric cancer (GC), is con-fusing. AIM: To determine the role of the up-regulation of NEK2 in GC.Entities:
Keywords: Cell proliferation; Cyclin D1; ERK/MAPK signaling; Gastric cancer; NIMA related kinase 2
Year: 2019 PMID: 31249448 PMCID: PMC6589739 DOI: 10.3748/wjg.v25.i23.2898
Source DB: PubMed Journal: World J Gastroenterol ISSN: 1007-9327 Impact factor: 5.742
Primers used for quantitative real-time PCR
| TGCTTCGTGAACTGAAACATCC | |
| CCAGAGTCAACTGAGTCATCACT | |
| CGGGGCATCTTCGAGATCG | |
| CAGAACAACGCCGTTTCAGTT | |
| GTCCTCCATAAATGCCTGTTCC | |
| GATGCAACCCACTGACCAGAT | |
| ACGAAGGTCTGCGCGTGTT | |
| CCGCTGGCCATGAACTACCT | |
| GGAGCGAGATCCCTCCAAAAT | |
| GGCTGTTGTCATACTTCTCATGG |
Figure 1Expression of NIMA related kinase 2 in tissues and cells of gastric cancer. A: Relative mRNA expression level of NIMA related kinase 2 (NEK2) in gastric cancer and normal tissues (datasets from Oncomine). B: Relative mRNA expression level of NEK2 analyzed by quantitative real-time PCR in 30 pairs of human gastric cancer tissues (Cancer) and adjacent tissues (Normal). (Paired t-test, P < 0.001). C: The mRNA expression level of NEK2 in different grades of cancer samples. Data represents the mean ± SD of three replicates. D: Relative NEK2 mRNA expression level in four gastric cancer cell lines compared to gastric mucosal epithelial cell line (GES1). E: Relative NEK2 protein expression level in different gastric cancer cell lines. β-actin was used as the loading control. NEK2: NIMA related kinase 2.
Figure 2Combined NIMA related kinase 2 and ERK expression may predict overall survival in patients with gastric cancer. A: ERK co-expressed with NIMA related kinase 2 (NEK2) in gastric cancer (datasets from TCGA). B: Relative mRNA expression level of ERK analyzed by quantitative real-time PCR in 30 pairs of human gastric cancer tissues. C: ERK expression is significantly correlated to NEK2 expression in human gastric cancer tissues. D: Immunohistochemistry analysis of NEK2 and ERK expression in serial gastric cancer samples. E: Correlation between NEK2 and ERK expression. F: Overall survival of patients with gastric cancer calculated using Kaplan–Meier analysis according to the staining level. NEK2: NIMA related kinase 2.
Figure 3NIMA related kinase 2 mediates the activation of ERK/MAPK signaling. A and B: Relative mRNA expression of ERK/MAPK signaling key factors analyzed by quantitative real-time PCR in NIMA related kinase 2 (NEK2) silenced BGC823 and SGC7901 cell lines and negative controls. C: Western blot analysis of ERK/MAPK signaling key factors (ERK, c-JUN, and cyclin D1) and their phosphorylated forms (p-ERK and p-c-JUN) in NEK2 silenced BGC823 and SGC7901 cell lines and negative controls. D: Relative phosphorylation levels of ERK and c-JUN in C were calculated. β-actin was used as the internal control. Values are presented as the mean ± SEM. NEK2: NIMA related kinase 2.
Figure 4NIMA related kinase 2 promotes gastric cancer cell viability, proliferation, and cell cycle progression via ERK/MAPK signaling. A and B: Relative mRNA and protein expression of cyclin D1 in cell lines with ERK silencing and NEK2 overexpression. C and D: CCK8 assay showing cell viability in BGC823 and SGC7901 cell lines and negative controls. E: Flow cytometry analysis of cell cycle distribution in BGC823 and SGC7901 cell lines. F: Quantification of the data shown in E (n = 3). G: EdU incorporation assay showing the percentage of cells in S-phase. H: Quantification of the data shown in G (n = 3). NEK2: NIMA related kinase 2.