| Literature DB >> 31235767 |
Laura Marino-Puertas1, Laura Del Amo-Maestro1, Marta Taulés2, F Xavier Gomis-Rüth3, Theodoros Goulas4.
Abstract
α2-Macroglobulins (α2Ms) regulate peptidases, hormones and cytokines. Mediated by peptidase cleavage, they transit between native, intact forms and activated, induced forms. α2Ms have been studied over decades using authentic material from primary sources, which was limited by sample heterogeneity and contaminants. Here, we developed high-yield expression systems based on transient transfection in <span class="Species">Drosophila <class="Chemical">span class="CellLine">Schneider 2 and human Expi293F cells, which produced pure human α2M (hα2M) at ~1.0 and ~0.4 mg per liter of cell culture, respectively. In both cases, hα2M was mainly found in the induced form. Shorter hα2M variants encompassing N-/C-terminal parts were also expressed and yielded pure material at ~1.6/~1.3 and ~3.2/~4.6 mg per liter of insect or mammalian cell culture, respectively. We then analyzed the binding of recombinant and authentic hα2M to recombinant latent human transforming growth factor-β2 (pro-TGF-β2) and bacterial G-related α2M binding protein (GRAB) by surface plasmon resonance, multiple-angle laser light scattering, size-exclusion chromatography, fluorogenic labelling, gel electrophoresis and Western-blot analysis. Two GRAB molecules formed stable complexes of high affinity with native and induced authentic hα2M tetramers. The shorter recombinant hα2M variants interacted after preincubation only. In contrast, pro-TGF-β2 did not interact, probably owing to hindrance by the N-terminal latency-associated protein of the cytokine.Entities:
Mesh:
Substances:
Year: 2019 PMID: 31235767 PMCID: PMC6591361 DOI: 10.1038/s41598-019-45712-z
Source DB: PubMed Journal: Sci Rep ISSN: 2045-2322 Impact factor: 4.379
Figure 1Overview of studied proteins. (A) Scheme depicting the domain structure of hα2M (i) and the constructs studied (ii). The residue numbers correspond to UP P01023. (i) Functional regions and domains are the signal peptide (SP); macroglobulin domains 1-to-7 (MG1-MG7); the bait-region domain (BRD); the CUB domain; the thioester domain (TED); and the receptor-binding domain (RBD). Disulfide bonds are shown in black and linked cysteines are labelled. An interchain disulfide is pinpointed with an asterisk and N-linked glycosylation sites are highlighted with a sugar chain. (ii) hα2M fusion proteins produced with plasmids pIEx and pCMV-Sport6. The AKH signal peptide sequence, the mouse Ig κ-chain leader sequence, His6×-tags and restriction sites are graphically represented. (B) Same as (A) for GRAB (UP Q7DAL7). (i) Functional regions and domains are the SP; domain A, with the binding regions of hα2M hatched and in the inset; repeat regions R1 and R2; the cell-wall attachment site (W), with the cell-wall anchor motif shown in magnification; and the membrane anchor (M). Critical arginine residues for hα2M-binding are indicated by a star (R42 and R64). (ii) GRAB fusion proteins in pCri8a with His6-tag, TEV site and Strep-tag. (C) Same as (A) for pro-TGF-β2 (UP P61812). (i) Functional domains and regions are the SP; the latency associated peptide (LAP); and the mature growth factor moiety (TGF-β2). Critical residues in LAP are C24, which is involved in the binding of LTBP, and R302, required for furin cleavage. Mature TGF-β2 segment A343-Y367 is involved in hα2M binding, important and critical residues are indicated by a grey (A347 and A349) and a black star (W354), respectively. (ii) Human pro-TGF-β2 fusion proteins produced with plasmids pIEx and pCMV-Sport6. The AKH signal peptide sequence, the Kozac (Koz), the mouse Igκ-chain leader sequence, affinity tags (His6 and Strep) and restriction sites are graphically represented.
Constructs, primers, plasmids and proteins.
| Plasmid name | Protein | Parental DNA | Forward -primer* | Reverse-primer* | Protein sequence** | Tags*** | Comments |
|---|---|---|---|---|---|---|---|
|
| hα2M | Human c-DNA pIEx vector | CATT | CATT | S24-N1473 + | C-t H6× | Full-length hα2M in S2 cells. The gene was inserted by directional cloning (between |
|
| N-hα2M | pIE-hα2M-H6 | GATCTTGGAAATCCT | CAAT | S24-E908 + | C-t H6× | As above for the N-terminal half of hα2M. |
|
| C-hα2M | pIE-hα2M-H6 | CAAT | CAAT | Q790- N1473 + | C-t H6× | As above for the C-terminal half of hα2M. |
|
| hα2M | pIE-hα2M-H6 pCMV-Sport 6 vector | S24-S1468 + | C-t H6× | Full-length hα2M in Expi293F cells. The gene was inserted by restriction-free cloning into the pCMV-Sport 6 vector in frame with the Ig κ leader sequence. | ||
|
| N-hα2M | pIE-N-hα2M-H6 pCMV-Sport 6 vector | S24-A788 + | C-t H6× | As above for the N-terminal half of hα2M. | ||
|
| C-hα2M | pIE-hα2M-H6 pCMV-Sport 6 vector | F789-S1468 + | C-t H6× | As above for the C-terminal half of hα2M. | ||
|
| GRAB | Synthetic DNA pCri8a vector | CAAT | CAAT | N-t H6× +TEV | Synthetic gene of GRAB optimized for expression in | |
|
| GRAB | pCri-H6-TEV-GRAB | ATGC | CGAATTGTGGATGGCTCCAACCTCCATTAACGTTCTGACGTTC; CTTCCACCTCCAGAACCTCCACCCTTTTCGAATTGTGGATGGCTCC; GTGGATGGCTCCATGCGCTACCTCCACTTCCACCTCCAGAACC; GCAT | N-t H6× +TEV-(protein)-Strep | This construct was obtained from pCri-H6-TEV-GRAB by four consecutive PCR reactions to introduce a C-terminal Strep-tag. | |
|
| pro-TGF-β2 | Human c-DNA pIEx vector | CAAT | CAAT | L21-S414 + | C-t H6× | Pro-TGF-β2 in S2 cells. The gene was inserted by directional cloning (between |
|
| TGF-β2 | Human c-DNA pIEx vector | CAAT | CAAT | A303-S414 + | C-t H6× | As above for mature TGF-β2. |
|
| pro-TGF-β2 | pIE-TGFB2-H6 pCMV-Sport 6 vector | TCACCACCACCATCATCTCAGCCTGTCTACCTGCAGCA; GGTTCCACTGGTGACCACCACCATCACCACCACCATC; GGGTACTGCTGCTCTGGGTTCCAGGTTCCACTGGTGAC; GACAGACACACTCCTGCTATGGGTACTGCTGCTC; CAAT | CAAT | N-t H8× | Pro-TGF-β2 in Expi293F cells. See[ | |
|
| pro-TGF-β2 | pS6-TGFB2-H8 | GGTGGAGGTTCTGGAGGTGGAAGTGGAGGTAGCGCATGGAGCCATCCACAATTCGAAAAGCTCAGCCTGTCTACCTGC | CTTTTCGAATTGTGGATGGCTCCAGTCACCAGTGGAACCTGGAACCCAGAGCAG | N-t Strep | Pro-TGF-β2 in Expi293F cells. The parental plasmid was modified by opposite primers to replace the N-terminal histidine-tag with a Strep-tag. See[ | |
|
| TGF-β2 | pIE-mTGFB2-H6 pCMV-Sport 6 vector | A303-S414 + | C-t H6× | Mature TGF-β2 in Expi293F cells. The coding gene extracted from the parental plasmid was inserted into the pCMV-Sport 6 vector by restriction-free cloning between the Ig κ leader sequence and the C-terminal histidine-tag. |
All constructs are for extracellular expression of the respective proteins.
*Restriction-site sequences and overhangs for restriction-free cloning are underlined.
**Peptide sequence of the expressed protein after fusion-tag removal. Amino acids derived from the construct are in bold. See also Fig. 1.
***Fused tags at the carboxy-terminus (C-t) or the amino-terminus (N-t).
AKH, adipokinetic hormone; TEV, tobacco-etch virus peptidase; Ig κ, immunoglobulin κ.
Figure 2Recombinant protein production and purification. (A) SDS-PAGE analysis of wild-type and recombinant proteins. Lanes: 1, native authentic hα2M; 2, recombinant hα2M from S2 cells; 3, recombinant hα2M from Expi293F cells; 4, N-terminal half of hα2M (N-hα2M); 5, C-terminal half of hα2M (C-hα2Μ); 6, pro-TGF-β2 produced in Expi293F cells according to[8]. Arrows indicate pro-TGF-β2 (black), LAP (grey) and mature TGF-β2 (white); 7, pro-TGF-β2 digested by furin; 8, GRAB. (B) Native-PAGE analysis of wild-type and recombinant proteins. Lanes: 1 and 3, native and methylamine-induced authentic hα2M; 2 and 4, native and methylamine-induced recombinant hα2M from S2 cells; 5 and 6, native authentic hα2M and recombinant hα2M from Expi293F cells; 7 and 8, native and induced recombinant C-α2M expressed from Expi293F cells.
Molecular masses determined by SEC-MALLS.
| Protein sample | Molecular mass (kDa) |
|---|---|
| Native hα2M | 680.6 ± 1.8 |
| Native hα2M + GRAB | 707.8 ± 3.4 |
| Induced hα2M | 684.1 ± 2.7 |
| Induced hα2M + GRAB | 710.6 ± 1.5 |
| GRAB | 15.5 ± 0.0 |
| pro-TGF-β2 | 105.4 ± 0.6 |
Values are represented as means and standard deviations of three replicates.
Figure 3Interaction of GRAB and pro-TGF-β2 with hα2M variants. (A,B) Surface-plasmon resonance sensorgrams of the interaction of native or induced authentic hα2M with GRAB. Multi-cycle run for native hα2M with GRAB (A) and corresponding plot of the steady-state response (B, i and ii, for native and induced hα2M, respectively). Different hα2M concentrations were assayed to determine the rate constants that describe the kinetics and the equilibrium constants for complex strength (see also Tables 3 and 4). The vertical line in the plots of steady-state response indicates the value of the calculated equilibrium dissociation constant KD. (C) Sensorgrams of the interaction of N-hα2M (i) and C-hα2M (ii) with GRAB. Proteins were premixed, incubated at 37 °C for 1 h, injected over the chip, and the response was measured. (D) SEC-MALLS analysis of complex formation between GRAB and native (left) and induced (right) authentic hα2M showing the measured molecular mass distribution. Inserted figures within graphs show the SDS-PAGE analysis of the respective purified complexes.
Kinetic rates and equilibrium constants of the interaction between native authentic hα2M and GRAB.
| Protein sample |
| ||||
|---|---|---|---|---|---|
| Native hα2M + GRAB | 1.32 × 10+5 | 1.90 × 10−3 | 1.43 × 10−8 | 18.51 | 1.23 |
Constants were calculated from the corresponding plot assuming a 1:1 interaction model (two GRAB molecules per hα2M dimer), see Fig. 3A; ka, association rate constant; kd, dissociation rate constant; KD, equilibrium dissociation constant.
Equilibrium constants of the interaction between native or induced authentic hα2M and GRAB.
| Protein sample |
| ||
|---|---|---|---|
| Native hα2M + GRAB | 3.45 × 10−8 | 18.94 | 1.17 |
| Induced hα2M + GRAB | 9.46 × 10−8 | 6.82 | 0.01 |
Values were derived from the corresponding plot of steady state response against concentration assuming a 1:1 model (one GRAB molecule per hα2M dimer), see Fig. 3B.
Figure 4Analysis of complex formation between hα2M variants and GRAB or pro-TGF-β2. Complexes were separated by native-PAGE. GRAB or TGF-β2 labelled with fluorogenic Sulfo-NHS-AMCA were visualized in a gel reader (lower panels) and then stained with Coomassie Brilliant Blue (upper panels).