Literature DB >> 31223497

Antimicrobial Resistance, Virulence Genes, and Genetic Diversity of Salmonella enterica Isolated from Sausages.

Abdelaziz Ed-Dra1, Fouzia Rhazi Filali1, Slimane Khayi2, Said Oulghazi3, Brahim Bouchrif4, Abdellah El Allaoui1, Bouchra Ouhmidou5, Mohieddine Moumni3.   

Abstract

Salmonella is a major cause of morbidity and mortality in humans worldwide, and the infection with multidrug-resistant strains can cause severe diseases. This study was designed to evaluate the antimicrobial resistance, to detect the virulence genes, and to study the genetic diversity of isolated Salmonella strains using 16S rRNA sequences. For this, 34 Salmonella strains isolated from sausages were identified using biochemical and serological methods. Molecular tools were used to evaluate the presence of virulence genes (orgA, sitC, sipB, spiA, iroN, and sifA) using simplex and multiplex polymerase chain reaction (PCR) and to sequence 16S rRNA genes for phylogenetic analysis. The susceptibility to 24 selected antibiotics was also studied. The results of this study showed that all isolated Salmonella were positive for targeted virulence genes and were resistant to at least one antibiotic. However, the multidrug resistance was observed in 44% of isolated strains. The phylogenetic analysis of 16S rRNA sequences highlighted that Salmonella isolates were divided into 3 clusters and 3 sub-clusters, with a ≥98% similarity to Salmonella enterica species. From this study, we conclude that sausages are considered as a potential source of Salmonella, which could be a major risk to public health.

Entities:  

Keywords:  16S rRNA gene; Salmonella; phylogenetic tree; sausages; virulence genes

Year:  2019        PMID: 31223497      PMCID: PMC6563686          DOI: 10.1556/1886.2018.00035

Source DB:  PubMed          Journal:  Eur J Microbiol Immunol (Bp)        ISSN: 2062-509X


Introduction

Salmonella species were discovered more than a century ago by Salmon, an American scientist. They are Gram-negative, motile, facultative anaerobic bacteria and classified within the Enterobacteriaceae family [1]. Salmonella are regarded as a major food-borne pathogen that causes an economic burden for health care systems worldwide [2]. The consumption of animal products contaminated with Salmonella is the leading cause of human Salmonellosis [3]. Globally, 94 million cases of gastroenteritis were caused by Salmonella with 155,000 deaths each year, knowing that 85% of them were related to food [4]. In the United States, a study estimated that nontyphoidal Salmonella were responsible for 1,027,000 cases of food-borne illness each year, with 19,586 hospitalizations and 378 deaths [5]. In Morocco, Salmonella are responsible for 42.8% of food-borne diseases [6]. The pathogenicity of Salmonella is influenced by a variety of virulence factors that play an important role in a wide range of pathogenic mechanisms, such as adhesion, invasion, intracellular survival, toxin production, and iron acquisition [7]. However, the presence of virulence genes in multidrug-resistant strains of Salmonella is associated with a severe infection and is a major public health concern [8]. The identification of Salmonella is subjected to various constraints due to the greater diversity of its species and serovars. The Salmonella genus contains two species, Salmonella bongori and Salmonella enterica, which is divided into six subspecies with the presence of more than 2600 serotypes [9]. Nowadays, it is agreed that the identification of Salmonella by biochemical and serological techniques requires about a week [10]. Hence, molecular methods based on DNA sequences represent the best alternatives for accurate and rapid bacterial identifications. In the last years, the use of DNA sequencing has increased in the determination of the evolutionary relationships of different bacteria [11, 12]. In relation to Salmonella, phylogenetic studies includes sequencing of 16S rRNA, 23S rRNA, housekeeping genes, virulence genes, and inv-spa invasion gene complex [12]. It has been shown that genetic analysis of 16S rRNA gene increases the resolution between genus and species of Salmonella enterica and has a major role in bacterial phylogeny and taxonomic studies [13]. In Africa, specifically in Morocco, we noticed a lack of information for Salmonella pathogenicity and molecular identification. Thus, in this context, the objectives of this study were (i) to analyze the 16S rRNA sequences of 34 Salmonella strains isolated from sausages and determine their phylogenetic relationship, (ii) to study the distribution of 6 virulence genes among the isolated strains, and (iii) to assess their antimicrobial resistance using 26 antibiotics.

Materials and Methods

Isolation, Identification and Antimicrobial Susceptibility Testing

Thirty four Salmonella enterica belonging to 12 serotypes were isolated from sausages (beef sausages, turkey sausages, and artisanal sausages “merguez”) sold in Meknes city in Morocco and confirmed by biochemical, serological, and molecular tests [10]. The disc diffusion method on Mueller–Hinton agar was used to study the antimicrobial susceptibility profiles of isolated Salmonella against 26 antibiotics (Table 1). Results were interpreted according to the recommendation of the Clinical and Laboratory Standards Institute [14]. E. coli ATCC 25922 was used as a positive control of this study, and the isolated Salmonella strains showing a decrease in susceptibility (intermediate) were considered as resistant.
Table 1.

The antimicrobial agents used in this study

Antimicrobial agentsCodeDisk Content
AmpicillinAMP10 μg
AmoxicillinAML25 μg
Amoxicillin–clavulanic acidAMC20 μg/10 μg
ImipenemIPM10 μg
CeftriaxoneCRO30 μg
Cefuroxime sodiumCXM30 μg
CeftazidimeCAZ30 μg
CefamandoleMA30 μg
CefotaximeCTX30 μg
CefoxitinFOX30 μg
AztreonamATM30 μg
SulfamethoxazoleSMX200 μg
AmikacinAK30 μg
Colistin sulfateCT50 μg
KanamycinK30 μg
OfloxacinOFX5 μg
EnrofloxacinENR5 μg
CiprofloxacinCIP5 μg
Nalidixic acidNA30 μg
FlumequineUB30 μg
SulfonamideSSS200 μg
GentamicinCN30 μg
ChloramphenicolC30 μg
TetracyclineTE30 μg
StreptomycinS10 μg
Trimethoprim–sulfamethoxazoleSXT1.25 μg/23.75 μg

Amplification of the Virulence Genes Using Multiplex Polymerase Chain Reaction (PCR)

Simplex and multiplex PCR methods were used to examine the presence of 6 virulence genes in the isolated Salmonella (Table 2), using their gene specific primers as described in Table 3. The simplex PCR method was used to amplify the genes spiA, iroN, and sifA as described previously by Mezal et al. [15]. Meanwhile, the multiplex PCR method was used to amplify the genes orgA, sipB, and sitC as described by Skyberg et al. [7]. The amplification was done in a Mastercycler gradient (Perkin-Elmer, Boston, MA) under the following conditions: 5 min at 95 °C, 30 cycles of 30 s at 94 °C, 30 s at 66.5°C, and 2 min at 72 °C, with a final cycle of 10 min at 72 °C. The isolated strains were considered positive for the tested virulence genes if they produce an amplicon with the expected size (Table 3). Salmonella enterica serovar typhimurium DT104 was used as positive control.
Table 2.

Description of genes functions used in this study

GenesVirulence-related functionReferences
orgAHost recognition/invasion[35]
sipBEntry into nonphagocytic cells, killing of macrophages[36]
sitCIron acquisition[37]
spiASurvival within macrophage[30]
iroNIron acquisition[27]
sifAFilamentous structure formation[29]
Table 3.

Primers sequences used to amplify the virulence genes of isolated Salmonella

Virulence genesPrimer sequence (5′-3′)aSize (bp)GenBank no.References
orgAF: TTTTTGGCAATGCATCAGGGAR: GGCGAAAGCGGGGACGGTATT255NC003197[7]
sitCF: CAGTATATGCTCAACGCGATGTGGGTCTCCR: CGGGGCGAAAATAAAGGCTGTGATGAAC768NC003197[7]
sipBF: GGACGCCGCCCGGGAAAAACTCTCR: ACACTCCCGTCGCCGCCTTCACAA875NC003197[7]
spiAF: CCAGGGGTCGTTAGTGTATTGCGTGAGATGR: CGCGTAACAAAGAACCCGTAGTGATGGATT550NC003197[7]
iroNF: ACTGGCACGGCTCGCTGTCGCTCTATR: CGCTTTACCGCCGTTCTGCCACTGC1205NC003197[7]
sifAF: TTTGCCGAACGCGCCCCCACACGR: GTTGCCTTTTCTTGCGCTTTCCACCCATCT449NC003197[7]

F = forward; R = reverse.

Amplification and Sequencing of the 16S rRNA Genes

DNA was extracted from a culture on liquid medium using DNA Isolation Kit (Gen Elute Bacterial Genomic DNA kit, Sigma) according to the manufacturer's instructions. The amplification of 16S rRNA gene was performed in a reaction mixture of 25 μL, with 12.5 μL of ddH2O, 2.5 μL of 10x PCR buffer, 3.0 μL of 50 mM MgCl2, 0.5 μL of 10mM dNTPs (KAPA Biosystems, USA), 2 μL of template DNA (70 ng/μL), 0.2 μL of Taq DNA polymerase enzyme (5 U/μL; KAPA Biosystems, USA), and 1.25 μL of 10 μM from each primer: fD1 (AGAGTTTGATCCTGGCTCAG) and rP2 (ACGGCTACCTTGTTACGACTT) [16]. The amplification was performed in “Veriti” thermal cycler (Applied Biosystems, USA) under the following conditions: 10 min at 94 °C, 36 cycles of 1 min at 94 °C, 30 s at 52 °C, 2 min at 72 °C, and a final cycle of 10 min at 72 °C. Electrophoresis migration was done in 1% agarose (Sigma) for 1 h at 100 V. Then, gel was stained in ethidium bromide with a concentration of 0 .5 μg/mL for 20 min, rinsed, and visualized using «G Box» system (Applied Biosystems, USA). The obtained PCR products were purified by QIAquick PCR purification kit (ExoSAP-IT Affymetrix, USA), and sequenced bi-directionally using Big Dye Terminator Kit version 3.1 (Applied Biosystems) to prepare sequencing reactions. The sequencing procedure was conducted by 3130 XL Genetic Analyzer according to the manufacturer's instructions (Applied Biosystems, USA). Then, the collected data were analyzed by data collection software version 3.0 and sequencing analysis software version 5.3.1 (Applied Biosystems, USA). The sequences were manually trimmed and analyzed with the Basic Local Alignment Search Tool (BLAST).

Phylogenetic Analysis

The sequences were aligned with ClustalW, the evolutionary history was inferred using the neighbor-joining method, and the evolutionary distances were computed using the maximum composite likelihood method (Mega7 software) with 1000 bootstrap replications. Salmonella enterica str. 08-00436, Salmonella Mbandaka str. SA20026234, Salmonella Agona str. 460004 2-1, and Salmonella Typhi str. CT18 were used as in-group strains, and Escherichia coli ATCC 8739 was used as an out-group strain to root the phylogenetic tree.

Ethics

Ethical approval was not required in this study since no live animals or humans samples were used in the experiments.

Results

Among the 34 isolated Salmonella, 12 serotypes were identified (Table 4). In addition, the antimicrobial resistance analysis has shown a high rate of resistance to several antibiotics, with presence of 13 different phenotypic profiles (Table 4). Moreover, multidrug resistance (more than two antibiotics) was detected in 15 strains (44%). From them, one Salmonella typhimurium strain was considered as the highest by exerting resistance against 18 different antimicrobial compounds (Table 4).
Table 4.

Virulence genes and antimicrobial resistance profile of Salmonella serovars isolated from sausages

CodeSerotypesAccession NumberResistant profilesVirulence genes
orgAsipBsitCspiAiroNsifA
8DAgonaKX355299AMP++++++
63 DMuensterKX355305AMP++++++
55 MALivingstoneKX355303AMP++++++
57 BAnatumKX355304AMP, S, CT++++++
3MAGiveKX355298AMP, S++++++
42MAGiveMG869141AMP, S++++++
58MAGiveMG869142AMP, S++++++
29MAGiveMG869140AMP, S++++++
2BBovismorbificansKX355297AMP, S++++++
12BBovismorbificansMG869128AMP, S++++++
51BMbandakaMG869131AMP++++++
31BMbandakaMG869129AMP++++++
80BMbandakaKX355306AMP, S, CT++++++
9MAMbandakaMG869136AMP, S, CT++++++
17DMontevideoKX355301AMP, S, CT++++++
108DMontevideoMG869146AMP, S, CT++++++
72DMontevideoMG869143AMP, S, CT++++++
100MACorvallisMG869133AMP, S++++++
97MACorvallisKX355307AMP, S++++++
25BCorvallisMG869139AMP, S++++++
95DCorvallisMG869134AMP, S++++++
94MACorvallisMG869144AMP, CT++++++
18BCorvallisMG869137AMP, CT++++++
19MACorvallisMG869138AMP, AML, SMX, SSS++++++
113MACorvallisKX355309AMP, S, AML, CXM,++++++
130 DSaintpaulKX355311AMP, S, CT, SMX, SSS, SXT++++++
104DKentuckyMG869145AMP, S++++++
143DKentuckyMG869135AMP, S++++++
30DKentuckyKX355302AMP, S, TE, ENR, OFX, CIP, NA, UB++++++
116BKentuckyKX355310AMP, AML, MA, SMX, NA, ENR, UB, OFX, CIP, TE, S, SSS++++++
1DKentuckyMG869130AMP, AML, AMC, SMX, NA, ENR, UB, OFX, CIP, TE, S, SSS++++++
14DKentuckyKX355300AMP, AML, AMC, MA, SMX, NA, ENR, UB, OFX, CIP, TE, S, SSS++++++
102DTyphimuriumMG869132AMP, AML, AMC, CRO, MA, CXM, CTX, SXT, SMX, K, AK, CT, TE, S, C, SSS++++++
105DTyphimuriumKX355308AMP, AML, AMC, CRO, MA, CXM, CTX, SXT, SMX, NA, UB, K, AK, CT, TE, S, C, SSS++++++

Amplification of Virulence Genes Using Multiplex PCR

In order to evaluate the pathogenicity of Salmonella strains and to have an idea about its capacity to survive in host environments, simplex and multiplex PCR methods were used to detect 6 virulence genes, namely, orgA, sipB, sitC, spiA, iroN, and sifA (Figures 1 and 2), involved in its virulence system. The results showed that all isolated strains contain the 6 virulence genes (Table 4).
Figure 1.

PCR products amplified with the universal virulence gene primers (orgA, sipB, and sitC). Lanes: (M) DNA ladder (GeneRuler 1Kb Plus), (1) negative control, (2) positive control, and (3–12) Salmonella tested.

Figure 2.

PCR products in agarose gel electrophoresis 1% with the expected molecular size of 550 bp for SpiA gene (A), 1205 bp for IroN gene (B), and 449 bp for SifA gene (C). Lanes: (1–10) Salmonella tested, (M) DNA ladder (Hyper Ladder 500 bp), (–) negative control, and (+) positive control

Amplification of 16S rRNA genes was performed on extracted genomic DNA of isolated Salmonella strains. The results showed that all examined strains generate an amplicon of 1500 bp (Figure 3). Then, PCR products were sequenced and analyzed by the online software “BLAST” (https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch), and the obtained sequences were deposited in GenBank under the corresponding accession numbers (Table 4).
Figure 3.

The amplification results of 16S rRNA genes using universal primers. Lanes: (1) S. Typhimirium, (2) S. Mbandaka, (3) S. Livingstone, (4), S. Muenster, (5) S. Give, (6) S. Bovismorbificans, (7–9) S. Kentucky, (10–11) S. Corvallis, (12) S. Montevideo, (13) S. Agona, (14) S. Anatum, (15) S. Saintpaul, and (M) 1Kb DNA ladder

Phylogenetic Analysis and Identification Criteria

The phylogenetic analysis of 16S rRNA genes organized all the strains into 3 clusters (I, II, and III), and cluster I is divided into 3 sub-clusters (Ia, Ib, and Ic) (Figure 4). The analysis of 16S rRNA genes groups the serotypes Corvallis, Kentucky, Typhimurium, Anatum, Mbandaka, Livingstone, and Saintpau in cluster I, and cluster II is constituted by S. Montevideo, S. Bovismorbificans, S. Give, and S. Agona. However, cluster III is constituted by 2 strains, namely, S. Muenster and S. Kentucky, which are placed separately on side branches from the strains. Moreover, 16S rRNA based analysis showed that all 16S rRNA sequences possessed a ≥98% similarity to those of Salmonella enterica species.
Figure 4.

Phylogenetic tree of isolated Salmonella enterica strains based on 16S rRNA sequences analysis using MEGA7

Discussion

Worldwide, Salmonella are recognized as a major gastrointestinal pathogen for humans and animals, whereas, Salmonella typhimurium and Salmonella enteritidis were considered as the major serovars that can be infecting human after eating food of animal origin, but this data may be different over the years and countries. In this study, the antimicrobial resistance analysis revealed the presence of Salmonella Kentucky resistant to quinolones and Salmonella Typhimurium resistant to multiple antibiotics including 3rd generation cephalosporins. Other studies showed that the resistance to quinolones, fluoroquinolones, and 3rd generation cephalosporins in Salmonella has recently increased [17-20]. This resistance may be due to the intensive use of antibiotics in the veterinary and human fields by contributing to the acquisition of resistance genes and exerting a selective pressure for the development of resistant bacteria [21] and may change depending on serotype, time, source of microorganism, and geographic region of isolate [22]. The pathogenicity of Salmonella is influenced by various factors encoded by different virulence genes that play an important role in different steps of pathogenicity, such as adhesion, invasion, intracellular survival, systemic infection, toxin production, and iron acquisition [7]. In this study, the amplification of virulence genes by PCR showed that all isolated strains contain the 6 tested virulence genes (orgA, sitC, sipB, spiA, iroN, and sifA). The host cell invasion and intracellular survival of Salmonella depend on several genes that are clustered on pathogenicity islands (PIs), and these effector proteins are transferred by 2 type III secretion systems, namely, T3SS1 and T3SS2 [23]. Moreover, Salmonella strains expresses several invasion genes located on the Salmonella pathogenicity islands 1 and 2 (SPI-1 and SPI-2), which promote bacterial uptake and invasion of non-phagocytic cells to cross the epithelial barrier [24]. Among these genes, orgA is required for invasion and secretion system [25]. Thus, the sipB gene is responsible for the entry into non-phagocytic cells and the killing of macrophages. It has been shown that the targeting of sipB by the inv-Spa type III secretion apparatus is necessary and sufficient for the induction of macrophage apoptosis [26]. The iroN gene is implicated in iron acquisition [27]. However, the sitC gene encodes an important transporter of iron. Also, a study carried out by Boyer et al. on Salmonella Typhimurium showed that sitABCD is required for replication of Salmonella inside macrophages and for the creation of virulence in susceptible animals [28]. On the other hand, the sifA gene is required for the formation of filamentous structures in the lysosome vacuoles of infected epithelial cells [29]. A previous study conducted on Salmonella typhimurium showed that spiA gene codes for an outer membrane component that is essential for virulence in host cells [30]. Another study carried out by Dong et al. revealed that spiA gene is associated with biofilm formation mechanism [31]. It has been demonstrated that biofilm formation improves the ability of microorganisms to withstand stresses, such as desiccation, temperature extremes, antibiotics, and antiseptics [32], which allowed these bacteria to survive longer in animal farms and to contaminate meats and eggs, which remain the main vehicles of Salmonella transmission to humans. In Morocco, it is a challenge for laboratories to systematically identify Salmonella isolates on the basis of biochemical and serological identification using Kaufmann White scheme because of the cost of reagents and the time needed to get the results. In this study, we conducted a rapid and cost-effective method to identify the isolated Salmonella strains using DNA sequencing tools. Furthermore, the sequence analysis of the 16S rRNA genes is being regularly used to identify bacterial species and to perform the taxonomic studies in clinical and scientific investigations [33]. However, the phylogenetic analyses can be used to understand the emergence of pathogenic bacteria and to study the relationship between isolated strains and other reference strains, implicated in animal or human diseases [12, 19, 34]. In this study, the analysis of phylogenetic tree showed the presence of different 16S rRNA profiles among the isolated Salmonella serovars, which are grouped into 3 clusters and 3 sub-clusters, suggesting the presence of different contamination sources due to the diversity of raw materials and manufacturing processes used for each type of sausages.

Conclusion

The results obtained in this study showed that the sequencing of 16S rRNA genes was a suitable tool for identification of Salmonella strains at the genus and species level. In addition, the phylogenic analysis showed a high diversity in all clusters of this bacterium. Furthermore, the antimicrobial resistance and the virulence gene analysis suggest that sausages are contaminated with Salmonella strains and present a major risk to public health.
  2 in total

1.  Occurrence of oxytetracycline residues in milk samples from Palakkad, Kerala, India.

Authors:  M Asif Hebbal; C Latha; K Vrinda Menon; Jolly Deepa
Journal:  Vet World       Date:  2020-06-11

2.  Antibiotic Resistance Development in Animal Production: A Cross-Sectional Study.

Authors:  Daniel Teshome Gebeyehu
Journal:  Vet Med (Auckl)       Date:  2021-05-18
  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.