Eirin Sai1, Yoshiyuki Miwa2, Reina Takeyama3,4, Shinya Kojima3,4, Toshihide Ueno3,4, Masakazu Yashiro5, Yasuyuki Seto2, Hiroyuki Mano3,4. 1. Department of Medical Genomics, Graduate School of Medicine, The University of Tokyo, Tokyo, Japan. 2. Department of Gastrointestinal Surgery, Graduate School of Medicine, The University of Tokyo, Tokyo, Japan. 3. Department of Cellular Signaling, Graduate School of Medicine, The University of Tokyo, Tokyo, Japan. 4. Division of Cellular Signaling, National Cancer Center Research Institute, Chuo-ku, Tokyo, Japan. 5. Department of Molecular Oncology and Therapeutics, Osaka City University Graduate School of Medicine, Osaka, Japan.
Abstract
Scirrhous-type gastric cancer (SGC) is one of the most intractable cancer subtypes in humans, and its therapeutic targets have been rarely identified to date. Exploration of somatic mutations in the SGC genome with the next-generation sequencers has been hampered by markedly increased fibrous tissues. Thus, SGC cell lines may be useful resources for searching for novel oncogenes. Here we have conducted whole exome sequencing and RNA sequencing on 2 SGC cell lines, OCUM-8 and OCUM-9. Interestingly, most of the mutations thus identified have not been reported. In OCUM-8 cells, a novel CD44-IGF1R fusion gene is discovered, the protein product of which ligates the amino-terminus of CD44 to the transmembrane and tyrosine-kinase domains of IGF1R. Furthermore, both CD44 and IGF1R are markedly amplified in the OCUM-8 genome and abundantly expressed. CD44-IGF1R has a transforming ability, and the suppression of its kinase activity leads to rapid cell death of OCUM-8. To the best of our knowledge, this is the first report describing the transforming activity of IGF1R fusion genes. However, OCUM-9 seems to possess multiple oncogenic events in its genome. In particular, a novel BORCS5-ETV6 fusion gene is identified in the OCUM-9 genome. BORCS5-ETV6 possesses oncogenic activity, and suppression of its message partially inhibits cell growth. Prevalence of these novel fusion genes among SGC awaits further investigation, but we validate the significance of cell lines as appropriate reagents for detailed genomic analyses of SGC.
Scirrhous-type gastric cancer (SGC) is one of the most intractable cancer subtypes in humans, and its therapeutic targets have been rarely identified to date. Exploration of somatic mutations in the SGC genome with the next-generation sequencers has been hampered by markedly increased fibrous tissues. Thus, SGC cell lines may be useful resources for searching for novel oncogenes. Here we have conducted whole exome sequencing and RNA sequencing on 2 SGC cell lines, OCUM-8 and OCUM-9. Interestingly, most of the mutations thus identified have not been reported. In OCUM-8 cells, a novel CD44-IGF1R fusion gene is discovered, the protein product of which ligates the amino-terminus of CD44 to the transmembrane and tyrosine-kinase domains of IGF1R. Furthermore, both CD44 and IGF1R are markedly amplified in the OCUM-8 genome and abundantly expressed. CD44-IGF1R has a transforming ability, and the suppression of its kinase activity leads to rapid cell death of OCUM-8. To the best of our knowledge, this is the first report describing the transforming activity of IGF1R fusion genes. However, OCUM-9 seems to possess multiple oncogenic events in its genome. In particular, a novel BORCS5-ETV6 fusion gene is identified in the OCUM-9 genome. BORCS5-ETV6 possesses oncogenic activity, and suppression of its message partially inhibits cell growth. Prevalence of these novel fusion genes among SGC awaits further investigation, but we validate the significance of cell lines as appropriate reagents for detailed genomic analyses of SGC.
Despite the advent of screening technologies for the upper digest tract, gastric cancer remains the third leading cause of cancer‐related deaths, and almost 1 million people die of this disease worldwide every year.1, 2 In particular, scirrhous‐type of gastric cancer (SGC) is one of most intractable cancer subtypes, with a 5‐year survival rate of only 11%‐16%.3, 4 SGC is characterized by rapid growth and infiltration of poorly differentiated or signet‐ring cell‐type cancer cells with marked surrounding fibrosis.5, 6, 7 SGC often lacks apparent mucosal lesions, making it difficult to detect in the early stages.A wide range of genomic/epigenomic analyses has been conducted to identify therapeutic targets for gastric cancer. By combining whole exome sequencing (WES) and RNA‐sequencing (RNA‐seq) datasets, for instance, The Cancer Genome Atlas team proposed to divide gastric cancer into 4 subtypes: (i) Epstein‐Barr virus‐positive type, with a CpG island methylator phenotype and frequent PIK3CA nonsynonymous mutations; (ii) microsatellite instability‐positive type, with a high mutation burden; (iii) chromosomal instability‐positive type with TP53 alterations and amplification of tyrosine kinase genes; and (iv) genomically stable (GS)‐type with frequent mutations within CDH1, RHOA and ARID1A.8 The GS type is often associated with diffuse‐type gastric cancer that significantly overlaps with SGC.Somatic mutations within RHOA were also reported in 14%‐25% of diffuse‐type gastric cancer.9, 10 Such RHOA mutants are presumed to act in a dominant‐negative manner to the wild‐type protein, and, thereby, promote cell survival.11 It is, however, unclear if these RHOA mutations are enriched in SGC.Genome‐wide mutation screening with next‐generation sequencers (NGS) for SGC is severely hampered by low tumor contents by the markedly increased fibrous tissues in a given specimen. SGC cell lines have been, therefore, useful resources to identify their transforming genes. FGFR2 gene was, for instance, shown to become amplified and oncogenic in an SGC cell line, KATO‐III.12
MET amplification is also reported to be present in some SGC cell lines.13 To identify potential therapeutic targets in SGC, here we have conducted WES and RNA‐seq for 2 SGC cell lines, OCUM‐814 and OCUM‐9. Interestingly, we revealed novel transforming fusion genes, CD44‐IGF1R from the former cell line and BORCS5‐ETV6 from the latter.
MATERIALS AND METHODS
Cell lines
Humanembryonic kidney (HEK) 293T cells and mouse 3T3 fibroblasts were obtained from the ATCC (https://www.atcc.org). SGC cell lines, KATO‐III and NUGC4, were purchased from Japanese Collection of Research Bioresources (http://cellbank.nibiohn.go.jp/english/). OCUM‐1, ‐2M, ‐8, ‐9 and ‐12 were established by M.Y. All cell lines were maintained in DMEM‐F12 medium supplemented with 10% FBS and 2 mmol/L glutamine (all from Invitrogen).
Next‐generation sequencer analyses
Genomic DNA was isolated from each cell line and subjected to enrichment of exonic fragments with a SureSelect Human All Exon Kit v5 (Agilent) followed by nucleotide sequencing with the HiSeq2500 platform (Illumina) using the paired‐end option. Bioinformatics analyses were conducted as reported previously.15 Nonsynonymous mutations were called only when ≥10% of reads corresponded to the mutations at the positions with a total coverage of ≥20.Total RNA was isolated from each cell line with the use of an RNeasy Mini Kit (Qiagen) and was subjected to RNA‐seq using a NEBNext Ultra Directional RNA Library Prep Kit (New England BioLabs). Relative expression level (fragments per kilobase of exon per million reads mapped, FPKM) of genes were calculated with the Cufflinks pipeline (http://cole-trapnell-lab.github.io/cufflinks/), and fusion genes were searched with deFuse.16
Cloning of fusion genes
A full‐length cDNA of CD44‐IGF1R was recovered from the RNA of OCUM‐8 cells by RT‐PCR with the following primers: 5′‐TTCGCTCCGGACACCATGGACAAG‐3′ and 5′‐GATCCAAGGATCAGCAGGTCGAAG‐3′. The PCR product was verified with Sanger sequencing. The genomic rearrangement for the CD44‐IGF1R fusion in OCUM‐8 was PCR‐amplified from the genomic DNA with the following primers: 5′‐TGGACAAGTTTTGGTGGCACGCAG‐3′ and 5′‐TCACTGGCCCAGGAATGTCATCTG‐3′. Genomic PCR or RT‐PCR for the CD44‐IGF1R fusion point was conducted with the genomic primers (5′‐ACCCAAGGTCAGGAGTTTGAGACC‐3′ and 5′‐CACGCTACAATGGACTTCAGTGCC‐3′) or the cDNA primers (5′‐TTCGCTCCGGACACCATGGACAAG‐3′ and 5′‐GGCAGAGCGATGATCAGATGGATG‐3′), respectively. Similarly, genomic PCR or RT‐PCR for GAPDH was conducted with the genomic primers (5′‐GTCATGGGTGTGAACCATGAGAAG‐3′ and 5′‐TCTCATACCATGAGTCCTTCCACG‐3′) or the cDNA primers (5′‐GTCAGTGGTGGACCTGACCT‐3′ and 5′‐TGAGCTTGACAAAGTGGTCG‐3′), respectively. The cDNA of the kinase‐dead mutant for CD44‐IGF1R was generated with a Site‐Directed Mutagenesis Kit (Invitrogen).Full‐length cDNAs of BORCS5‐ETV6 and the wild‐type ETV6 were PCR‐amplified using the following primers: 5′‐CGTTTCTGTTCCCCAAATAGGGCC‐3′ and 5′‐GGACTGTTGGTTCCTTCAGCATTC‐3′ for the former gene, and 5′‐CTCGCTGTGAGACATGTCTGAGAC‐3′ and 5′‐GGACTGTTGGTTCCTTCAGCATTC‐3′ for the latter. The genomic rearrangement for the BORCS5‐ETV6 fusion in OCUM‐9 was PCR‐amplified with a long‐range PCR enzyme (Takara LA Taq, Takara Bio) from the genomic DNA with the following primers: 5′‐GACCCAACGATCTGAACTCCTCAG‐3′ and 5′‐TTTTCAGCCCACTTGAGCCACTGG‐3′. Genomic PCR or RT‐PCR for the BORCS5‐ETV6 fusion point was conducted with the genomic primers (5′‐AAGTCACCATCTGTCCTGGCCTC‐3′ and 5′‐GAGGGAGCTAAAGCTGGCACAAC‐3′) or the cDNA primers (5′‐ACGCGTCAGCCCCACACATTAG‐3′ and 5′‐TTTTCAGCCCACTTGAGCCACTGG‐3′), respectively.
Functional assay
The cDNA of each gene was ligated into the pMX retroviral vector (Cell Biolabs), and the recombinant vectors were introduced together with an ecotropic packaging plasmid (Takara Bio) into HEK293T cells to obtain infectious virus particles. For the focus formation assay, 3T3 cells (2 × 106) were infected with ecotropic recombinant retroviruses and cultured for 2 weeks in DMEM‐F12 supplemented with 5% calf serum (Invitrogen). For the in vivo tumorigenicity assay, 3T3 cells (5 × 105) expressing each gene were inoculated subcutaneously into nude mice.To quantitate the copy number of IGF1R or MET, a part of IGF1R or MET gene was PCR‐amplified with the IGF1R‐specific primers (5′‐GTTCCTGATGAGTGGGAGGT‐3′ and 5′‐CCCTTGGCAACTCCTTCATA‐3′) or the MET‐specific primers (5′‐GCAGAACAAGCTCTCA‐3′ and 5′‐CCCAGGTGAGTATTTCTC‐3′), respectively, by using a droplet digital PCR system (ddPCR; QX200, Bio‐rad) with the internal control of RPP30 gene amplified with the following primers: 5′‐GATTTGGACCTGCGAGCG‐3′ and 5′‐GCGGCTGTCTCCACAAGT‐3′.For immunoblot analyses, cell lysates were obtained from each cell line with the lysis buffer (1% NP‐40, 50 mmol/L Tris‐HCl, 150 mmol/L NaCl, 1 mmol/L NaF and 1 mmol/L Na3VO4). Fifteen micrograms of cell lysates were separated through SDS‐PAGE, and probed with antibodies to IGF1R (#9750), phosphorylated IGF1R (#3918), MET (#8198S) or phosphorylated MET (#3077, all from Cell Signaling Technology).Viable cells were counted with CellTiter‐Blue Cell Viability Assay (Promega).
Knockdown experiments with shRNA
Nucleotides corresponding to a shRNA against ETV6 were synthesized based on the shRNA (#sh‐9528) from DECIPHER project (http://www.decipherproject.net), and inserted into the pMKO.1‐GFP vector, which was a gift from Dr William Hahn (Addgene plasmid #10676; http://n2t.net/addgene:10676; RRID:Addgene_10676). The resultant pMKO.1‐shETV6‐GFP allows the simultaneous expression of shETV6 and GFP. The control shRNA sequence is 5′‐UGGUUUGCAUGUUGUGUGGCUCGAGUCACACAACAUGUAAACCA‐3′.The pMKO.1‐shETV6‐GFP plasmid together with packaging plasmids (Retrovirus Packaging Kit Ampho, Takara Bio) was transiently transfected into HEK293 cells, and the culture supernatant containing the recombinant retrovirus was used to infect OCUM‐9 cells for 2 days. Real‐time RT‐PCR was conducted with a primer set (5′‐TATGAGAAAATGTCCAGAGCCCTG‐3′ and 5′‐TTCATCCAGCTCCTGGGACTCTAG‐3′) for ETV6, and with another primer set (5′‐GTCAGTGGTGGACCTGACCT‐3′ and 5′‐TGAGCTTGACAAAGTGGTCG‐3′) for GAPDH.
Accession code
The raw sequencing data have been deposited in the Japanese Genotype‐Phenotype Archive (JGA, http://trace.ddbj.nig.ac.jp/jga), which is hosted by DDBJ, under the accession number JGAS00000000179.
RESULTS
Genomic analyses of OCUM‐8
Whole exome sequencing of the genome of OCUM‐8 and ‐9 was conducted with the mean coverage of 154× and 137×, respectively. More than 96% of exome regions were sequenced at >20× coverage in both cell lines. Messenger RNA was also extensively sequenced with NGS for OCUM‐8 and ‐9, yielding the total nucleotides of 38 and 41 gigabases, respectively.As shown in Table S1, after excluding nucleotide changes present in our in‐house database for normal variations of human genome, we identified a total of 72 nonsynonymous mutations that are present in both exome and RNA‐seq datasets of OCUM‐8 (with a threshold of total coverage of ≥50× and of the mutation ratio of ≥25% in both datasets). Many of them have not been associated with gastric cancer nor recurrently reported in the COSMIC database version 87 (https://cancer.sanger.ac.uk/cosmic). An exception was the mutation for TP53(E271K) found 37 times in the COSMIC database. The clinical relevance of this mutation is, however, obscure because it is assessed as “Uncertain significance” in the ClinVar database (https://www.ncbi.nlm.nih.gov/clinvar/) as of March 2019.
Discovery of a novel fusion gene, CD44‐IGF1R
Because amplification of FGFR2 gene and augmentation of tyrosine kinase activity in its protein product plays an essential role in the proliferation of a SGC cell line, KATO‐III,12 we next analyzed chromosome copy number alterations (CNA) in OCUM‐8. The high coverage of our WES analysis enabled us to infer detailed CNV, revealing focal amplification of 11p13 and 15q26 loci encompassing CD44 and IGF1R genes, respectively (Figure 1A). We then examined, by quantitative real‐time PCR, the copy number of the IGF1R gene among control human peripheral blood mononuclear cells and various SGC cell lines, including KATO‐III, NUGC4 and OCUM‐1, ‐2M, ‐8, ‐9 and ‐12. As shown in Figure 1B, only OCUM‐8 shows a marked amplification of the IGF1R gene (copy number = 60) compared to the other samples (mean ± SD = 2.55 ± 0.53). In concordance with this genetic alteration, the expression level of IGF1R message is markedly increased in OCUM‐8 as well (Figure 1C).
Figure 1
Genomic analyses of OCUM‐8. A, Chromosome copy number of OCUM‐8. From the WES data, the logR ratio (LRR) is calculated and demonstrated. A locus of amplification corresponding to or is indicated. B, The copy number of the gene compared to that of is examined by using ddPCR among mononuclear cells from peripheral blood of a healthy volunteer (46XX) and scirrhous‐type of gastric cancer (SGC) cell lines including KATO‐III, NUGC4, OCUM‐1, ‐2M, ‐8, ‐9 and ‐12. The copy number of in mononuclear cells is set to 2.0. C, Expression level (FPKM) of is calculated from RNA‐seq data of KATO‐III, NUGC4, OCUM‐1, ‐8, ‐9 and ‐12. D, Genomic PCR with primers placed at exon (e) 1 of and at exon 12 of revealed that is disrupted at the position 1499 bp‐downstream to exon 1, and ligated to the position 917 bp‐upstream to exon 12 of
Genomic analyses of OCUM‐8. A, Chromosome copy number of OCUM‐8. From the WES data, the logR ratio (LRR) is calculated and demonstrated. A locus of amplification corresponding to or is indicated. B, The copy number of the gene compared to that of is examined by using ddPCR among mononuclear cells from peripheral blood of a healthy volunteer (46XX) and scirrhous‐type of gastric cancer (SGC) cell lines including KATO‐III, NUGC4, OCUM‐1, ‐2M, ‐8, ‐9 and ‐12. The copy number of in mononuclear cells is set to 2.0. C, Expression level (FPKM) of is calculated from RNA‐seq data of KATO‐III, NUGC4, OCUM‐1, ‐8, ‐9 and ‐12. D, Genomic PCR with primers placed at exon (e) 1 of and at exon 12 of revealed that is disrupted at the position 1499 bp‐downstream to exon 1, and ligated to the position 917 bp‐upstream to exon 12 ofTo examine if this genomic alteration produces fusion proteins, we searched for fusion mRNAs among the RNA‐seq dataset of OCUM‐8. Interestingly, in‐frame fusion transcripts were, indeed, found between CD44 and IGF1R and between IRS2 and EHF in OCUM‐8 (Table S2). By using RT‐PCR, we obtained a full‐length CD44‐IGF1R fusion cDNA from OCUM‐8. Nucleotide sequencing of the PCR product revealed that exon 1 of CD44 becomes fused to exon 12 of IGF1R (Figures S1, S2A). Analyses on OCUM‐8 genomic DNA further confirmed that chromosome 11 is disrupted at a position 1499 bp‐downstream to CD44 exon 1, and further ligated to a nucleotide at 917 bp‐upstream to exon 12 of IGF1R in chromosome 15 (Figures 1D, S2B, S3). Importantly, the expression of CD44‐IGF1R gene is driven by the promoter of CD44 that is known to be abundantly expressed in cancer stem cell fractions.17
CD44‐IGF1R is a transforming kinase and therapeutic target in OCUM‐8
The CD44‐IGF1R transcript can encode a chimeric protein of 561 amino acid residues with a predicted molecular weight of 63 386, consisting of the signal peptide of CD44 and the transmembrane and the intracellular domains of IGF1R (Figure 2A). Because fusion proteins of the IGF1Rtyrosine kinase domain have rarely been reported, we assessed its transforming activity by using mouse 3T3 fibroblasts.
Figure 2
Oncogenic activity of CD44‐IGF1R fusion kinase. A, The
cDNA is predicted to encode a protein with the amino‐terminal 22 amino acids of CD44 and the carboxyl‐terminal 539 amino acids of IGF1R. The LINK, fibronectin type III (FN3) and tyrosine kinase domains are schematically shown. B, Mouse 3T3 fibroblasts were infected with recombinant retrovirus expressing ,,, or , or with empty virus (Mock), and cultured for 9 d with 5% calf serum. Scale bar, 100 μm. C, Nude mice were inoculated subcutaneously with the same set of 3T3 cells as in (B), and tumor formation was examined at after 13 d for and 16 d for the others. The number of tumors at the injection sites (n = 4) is indicated. D, Total cell lysates (15 μg) were prepared from OCUM‐1, KATO‐III, OCUM‐8 and OCUM‐9 cells, separated through SDS‐PAGE, and subjected to immunoblot analysis with anti–IGF1R antibodies (left panel). The positions of molecular size standards (in kilodaltons) are indicated at the left of the panel. In the right panel, OCUM‐8 cells were treated with different concentrations of linsitinib for 15 min, and their lysates were probed with antibodies to phosphorylated IGF1R (p‐IGF1R) or IGF1R. E, OCUM‐8, OCUM‐9 and KATO‐III cells were incubated with different concentrations (shown at the bottom) of linsitinib for 4 h. The elative number of viable cells was calculated with CellTiter‐Blue assay, and normalized to that of untreated cells. Data are mean value ± SD of 3 independent experiments
Oncogenic activity of CD44‐IGF1R fusion kinase. A, The
cDNA is predicted to encode a protein with the amino‐terminal 22 amino acids of CD44 and the carboxyl‐terminal 539 amino acids of IGF1R. The LINK, fibronectin type III (FN3) and tyrosine kinase domains are schematically shown. B, Mouse 3T3 fibroblasts were infected with recombinant retrovirus expressing ,,, or , or with empty virus (Mock), and cultured for 9 d with 5% calf serum. Scale bar, 100 μm. C, Nude mice were inoculated subcutaneously with the same set of 3T3 cells as in (B), and tumor formation was examined at after 13 d for and 16 d for the others. The number of tumors at the injection sites (n = 4) is indicated. D, Total cell lysates (15 μg) were prepared from OCUM‐1, KATO‐III, OCUM‐8 and OCUM‐9 cells, separated through SDS‐PAGE, and subjected to immunoblot analysis with anti–IGF1R antibodies (left panel). The positions of molecular size standards (in kilodaltons) are indicated at the left of the panel. In the right panel, OCUM‐8 cells were treated with different concentrations of linsitinib for 15 min, and their lysates were probed with antibodies to phosphorylated IGF1R (p‐IGF1R) or IGF1R. E, OCUM‐8, OCUM‐9 and KATO‐III cells were incubated with different concentrations (shown at the bottom) of linsitinib for 4 h. The elative number of viable cells was calculated with CellTiter‐Blue assay, and normalized to that of untreated cells. Data are mean value ± SD of 3 independent experimentsIn the focus formation assay, as demonstrated in Figure 2B, expression of human wild‐type CD44 did not induce transformed foci. Forced expression of the wild‐type IGF1R induced some phenotypic changes in 3T3 cells but did not yield fully transformed, piled up foci. In contrast, however, induction of CD44‐IGF1R resulted in marked transformation in 3T3, as did that of EML4‐ALK. In contrast, the kinase‐dead mutant of CD44‐IGF1R, CD44‐IGF1R(KM) in which the lysine residue at amino acid position 227 is replaced with a methionine, failed to produce such transformation, indicating that CD44‐IGF1R exerts its oncogenic potential through its elevated tyrosine kinase activity.The transforming potential of CD44‐IGF1R was further confirmed by the nude mouse tumorigenicity assay (Figure 2C). Mouse 3T3 cells expressing each gene were inoculated subcutaneously into nude mice. The cells expressing CD44‐IGF1R but not CD44‐IGF1R(KM) produced subcutaneous tumors in all injection sites, confirming the oncogenic potential of CD44‐IGF1R in vivo.We further examined if CD44‐IGF1R is a therapeutic target for OCUM‐8. First, overexpression of the CD44‐IGF1R protein in OCUM‐8 was confirmed by an immunoblot analysis. Total cell lysates prepared from OCUM‐1, KATO‐III, OCUM‐8 and OCUM‐9 were examined with antibodies to the IGF1R protein, revealing that broad bands of 65‐90 kDa were detected with the antibody only in OCUM‐8 (Figure 2D, left panel). OCUM‐8 cells were then incubated with linsitinib, a selective inhibitor against IGF1Rtyrosine kinase activity.18 As shown in the right panel of Figure 2D, immunoblot examination with antibodies to tyrosine‐phosphorylated IGF1R revealed that phosphorylation of CD44‐IGF1R became decreased with linsitinib in a dose‐dependent manner, while the protein amount of CD44‐IGF1R was stable with the treatment.We next investigated whether the enzymatic activity of CD44‐IGF1R was essential for the survival of OCUM‐8 cells. As demonstrated in Figure 2E, linsitinib strongly and rapidly inhibited the viability of OCUM‐8 but did not affect that of CD44‐IGF1R‐negative OCUM‐9 and KATO‐III cells.
MET amplification in OCUM‐9
Genome profiles of OCUM‐9 were also investigated. As depicted in Table S3, a total of 73 nonsynonymous mutations were detected in OCUM‐9 with the same threshold from our WES and RNA‐seq data. Interestingly, RHOA(L57V) found in OCUM‐9 has been already shown to be associated with gastric cancer.9 While the Leu‐to‐Val substitution at amino acid position 57 was demonstrated to be loss‐of‐function, its relevance to gastric cancer remains elusive.As in the case of OCUM‐8, we assessed CNV in the genome of OCUM‐9. Focal amplification was detected in chromosomes 2p, 7q and 12p (Figure 3A). Because the 7q locus contains the MET gene, we further evaluated the copy number of MET with ddPCR among the control cells, KATO‐III, NUGC4 and OCUM‐1, ‐2M, ‐8, ‐9 and ‐12 cell lines (Figure 3B). MET is highly amplified in OCUM‐9 (copy number = 31.4), whereas its amplification (copy number ≥ 4) was not observed in the other samples. The expression level of MET was further evaluated by the RNA‐seq dataset, revealing its overexpression in OCUM‐9 cells (Figure 3C).
Figure 3
Genomic analyses of OCUM‐9. A, From the WES data of OCUM‐9, the logR ratio (LRR) is calculated as in Figure 1A. An amplification locus corresponding to , or plus is indicated. The copy number (B) and the expression level (C) of are examined as in Figure 1B,C, respectively. D, Total cell lysates (15 μg) of OCUM‐1, KATO‐III, OCUM‐8 and OCUM‐9 were separated through SDS‐PAGE, and subjected to immunoblot analysis with anti–MET antibodies (left panel). The positions of molecular size standards (in kilodaltons) are indicated at the left of the panel and that of MET is shown at the right. In the right panel, OCUM‐9 cells were treated with different concentrations of crizotinib for 15 min, and their lysates were probed with antibodies to phosphorylated MET (p‐MET) or MET. E, OCUM‐8, OCUM‐9 and KATO‐III cells were incubated with different concentrations (shown at the bottom) of crizotinib for 4 h. Relative number of viable cells was calculated with CellTiter‐Blue assay, and normalized to that of untreated cells. Data are mean value ± SD of 3 independent experiments
Genomic analyses of OCUM‐9. A, From the WES data of OCUM‐9, the logR ratio (LRR) is calculated as in Figure 1A. An amplification locus corresponding to , or plus is indicated. The copy number (B) and the expression level (C) of are examined as in Figure 1B,C, respectively. D, Total cell lysates (15 μg) of OCUM‐1, KATO‐III, OCUM‐8 and OCUM‐9 were separated through SDS‐PAGE, and subjected to immunoblot analysis with anti–MET antibodies (left panel). The positions of molecular size standards (in kilodaltons) are indicated at the left of the panel and that of MET is shown at the right. In the right panel, OCUM‐9 cells were treated with different concentrations of crizotinib for 15 min, and their lysates were probed with antibodies to phosphorylated MET (p‐MET) or MET. E, OCUM‐8, OCUM‐9 and KATO‐III cells were incubated with different concentrations (shown at the bottom) of crizotinib for 4 h. Relative number of viable cells was calculated with CellTiter‐Blue assay, and normalized to that of untreated cells. Data are mean value ± SD of 3 independent experimentsImmunoblot analyses with antibodies to MET among OCUM‐1, KATO‐III, OCUM‐8 and OCUM‐9 confirmed the overexpression of MET protein (Figure 3D, left panel). In OCUM‐9 cells, MET is highly tyrosine‐phosphorylated, but such phosphorylation becomes suppressed by the treatment with crizotinib,19 an inhibitor for MET tyrosine kinase activity (Figure 3D, right panel). Next, OCUM‐9 cells were cultured in the presence of crizotinib, showing that crizotinib rapidly inhibited cell viability in a dose‐dependent manner (Figure 3E). Crizotinib, in contrast, did not affect that of OCUM‐8 and KATO‐III. In OCUM‐9, MET protein‐tyrosine kinase is, thus, a suitable therapeutic target.
Other oncogenic alterations in OCUM‐9
As shown in Table S2, OCUM‐9 has an in‐frame fusion gene between BORCS5 (also known as LOH12CR1) and ETV6 (Table S2), both of which are localized in the focal amplification locus at chromosome 12p13 (Figure 3A). Based on the estimated copy number gain, this amplicon likely contains ETV6, BCL2L14, LRP6, MANSC1 and BORCS5 (Figure 4A). In accordance with the copy number gain, RNA‐seq revealed that these genes are abundantly expressed in OCUM‐9 cells but not in the other SGC cell lines. It should be noted that genes outside this amplicon are not aberrantly expressed in OCUM‐9. Furthermore, the BORCS5‐ETV6 fusion transcript was detected only in OCUM‐9 (Figure S4A), and the genomic rearrangement leading to this fusion was further confirmed by genomic analyses (Figure S4B,C).
Figure 4
Other oncogenic events of OCUM‐9. A, Genes at chromosome 12p13.2 to 12p13.1 are schematically demonstrated, and the genes amplified in OCUM‐9 are shown in magenta. The table further demonstrates the expression level (in FPKM) of these genes in KATO‐III, NUGC4, OCUM‐1, OCUM‐8, OCUM‐9 and OCUM‐12. B, The fusion cDNA can encode a protein with the amino‐terminal 20 amino acids of BORCS5 and the carboxyl‐terminal 397 amino acids of ETV6. The coiled‐coil, Pointed and ETS DNA‐binding domains are indicated. C, Mouse 3T3 cells were infected with an empty virus (Mock) or recombinant retrovirus expressing wild‐type or fusion gene, and cultured for 7 d. Scale bar, 100 μm. D, Genes at chromosome 2p24.3 to 2p24.2 are schematically shown, and the genes amplified in OCUM‐9 are shown in magenta. The expression level of these genes is demonstrated as in (A)
Other oncogenic events of OCUM‐9. A, Genes at chromosome 12p13.2 to 12p13.1 are schematically demonstrated, and the genes amplified in OCUM‐9 are shown in magenta. The table further demonstrates the expression level (in FPKM) of these genes in KATO‐III, NUGC4, OCUM‐1, OCUM‐8, OCUM‐9 and OCUM‐12. B, The fusion cDNA can encode a protein with the amino‐terminal 20 amino acids of BORCS5 and the carboxyl‐terminal 397 amino acids of ETV6. The coiled‐coil, Pointed and ETS DNA‐binding domains are indicated. C, Mouse 3T3 cells were infected with an empty virus (Mock) or recombinant retrovirus expressing wild‐type or fusion gene, and cultured for 7 d. Scale bar, 100 μm. D, Genes at chromosome 2p24.3 to 2p24.2 are schematically shown, and the genes amplified in OCUM‐9 are shown in magenta. The expression level of these genes is demonstrated as in (A)The predicted BORCS5‐ETV6 message ligates the amino‐terminal 20 amino acids of BORCS5 to the majority of ETV6 protein (Figures 4B, S5). To assess the transforming ability of the BORCS5‐ETV6 fusion gene, we conducted the 3T3 focus formation assay. As shown in Figure 4C, both the wild‐type ETV6 and BORCS5‐ETV6 carry an oncogenic ability when abundantly expressed. Given the high expression of BORCS5‐ETV6 in OCUM‐9, this fusion gene likely contributes to OCUM‐9 scirrhous cancer development. Indeed, shRNA‐mediated knockdown of ETV6 message partially suppressed the growth of OCUM‐9 cells (Figure S6).Because the focal amplification in chromosome 2p contains the MYCN gene, a well‐known oncogene, we further examined this amplicon in detail. Copy number estimation reveals that the amplicon contains NBAS, DDX1, MYCN and MYCNOS (Figure 4D). Our RNA‐seq data, indeed, revealed that these genes are overexpressed only in OCUM‐9 cells.
DISCUSSION
Here we have examined oncogenic genomic events in 2 scirrhous‐type cancer cell lines, OCUM‐8 and OCUM‐9, and found CD44‐IGF1R fusion‐type oncogene in the former. IGF1R codes for a receptor for type I insulin‐like growth factor, which is a transmembrane‐type tyrosine kinase. Both IGF1 and IGF2 can bind to and activate the enzymatic potential of IGF1R, and thereby induce a plethora of intracellular signalings. Stimulation of IGF1R can lead to, for instance, activation of PI3K‐AKT‐mTOR, RAS‐MAPK and IRS2 pathways.20 IGF1R also has anti–apoptotic ability, and, therefore, is considered to be an appropriate therapeutic target in cancer.21 Furthermore, IGF1R may play an essential role in acquiring resistance to anti–cancer agents.22, 23, 24Although IGF1R overexpression was reported to be a biomarker for drug response or poor outcome, rearrangements of IGF1R gene have rarely been reported. Kekeeva et al25 discovered a fusion transcript of IGF1R‐TTC23 in bladder cancer that encodes the amino‐terminal extracellular region of IGF1R fused to TTC23 whose function is yet unknown. Piarulli et al26 reported on a patient with an ALK‐negative inflammatory myofibroblastic tumor carrying FN1‐IGF1R fusion transcript. Both groups identified IGF1R fusion candidates from RNA‐seq data but did not confirm the corresponding genomic rearrangements nor examine the transforming ability of the protein products. It should be noted, however, that while the predicted protein product of IGF1R‐TTC23 seems not to carry any enzymatic activities, FN1‐IGF1R should retain the intracellular tyrosine kinase domain of IGF1R.In this manuscript, we have validated the genomic rearrangement that fuses the CD44 and IGF1R loci. Because the copy number of both genes are markedly increased (Figure 1A), complex rearrangements involving an amplicon containing CD44‐IGF1R may take place in the OCUM‐8 genome. CD44 is a cell‐surface marker for cancer stem cells,27 and is, indeed, highly expressed in our SGC cell lines (data not shown). In addition, CD44 is involved in the invasion process of SGC cells through the CD44‐RAC1 pathway.28 The promoter of CD44 should be, therefore, highly active in SGC cells, and may be an ideal partner for IGF1R to be in‐frame fused. CD44‐IGF1R exerts a marked transforming ability in 3T3 cells both in vitro and in vivo, and suppression of its activity in OCUM‐8 induces rapid cell death, implying that CD44‐IGF1R is an essential growth driver for this cell line. To search for CD44‐IGF1R in SGC specimens, we further conducted RNA‐seq and RT‐PCR analyses on formalin‐fixed paraffin‐embedded tissues from 75 patients with SGC but failed to detect any IGF1R fusions among the clinical specimens (data not shown).In the Tumor Fusion Gene Data Portal (https://tumorfusions.org) where gene fusions can be searched among the data of The Cancer Genome Atlas project, 9 IGF1R fusion transcripts are reported as of June 2019 (3 of them are in‐frame). Similarly, the cBioPortal database (http://www.cbioportal.org) contains 7 fusion transcripts involving IGF1R, and 1 of them is found in stomach adenocarcinoma. Neither database contains the CD44‐IGF1R fusions. IGF1R may, therefore, directly participate in carcinogenesis at a low frequency.ETV6 belongs to the ETS family of transcription factors and is known to be fused to potential oncogenes, such as RUNX1 and NTRK3.29, 30
ETV6 fusion to BORCS5 has not been reported yet. The focus formation assay revealed that BORCS5‐ETV6 has a transforming ability as the wild‐type ETV6, although the shape of foci generated by the former seems to be distinct from the latter (Figure 4C). BORCS5 is a component of the BLOC1‐related complex, and functions to regulate lysosome localization.31 Because BORCS5 contains an amino‐terminal myristoylation signal,32 the predicted BORCS5‐ETV6 may have an ability to anchor to lipid layer and, thereby, exert oncogenic roles partially different from the wild‐type ETV6. The dependency of OCUM9 to BORCS5‐ETV6 for growth further supports the important role of this novel fusion gene in carcinogenesis (Figure S6). Although no fusion transcripts for BORCS5 are present in the Tumor Fusion Gene Data Portal, 8 BORCS5 fusions are reported in the cBioPortal (none of them are BORCS5‐ETV6).In addition to BORCS5‐ETV6, however, there are other oncogenic genomic alterations in OCUM‐9. The MET tyrosine kinase gene is highly amplified in OCUM‐9, and suppression of its enzymatic activity led to rapid cell death (Figure 3A,B, E). Furthermore, MYCN is markedly amplified and expressed in the same cell line (Figures 3A and 4D). Importantly, amplification of MYCN is frequently found in neuroblastoma,33 and the forced expression of MYCN in dopamine β‐hydroxylase‐expressing cells in mice is sufficient to induce tumors resembling humanneuroblastoma.34 It is, therefore, likely that multiple oncogenic events contribute to the generation of OCUM‐9.We here reported novel oncogenic alterations in gastric cancer, IGF1R‐fusion and ETV6‐fusion genes, prevalence of which awaits further investigation. Detailed examination of other SGC cell lines may further decipher the molecular mechanisms underlying SGC and provide us therapeutic targets in this highly intractable malignancy.
CONFLICTS OF INTEREST
The authors declare no conflicts of interest for this article.Click here for additional data file.Click here for additional data file.
Authors: T Ueda; H Sasaki; Y Kuwahara; M Nezu; T Shibuya; H Sakamoto; H Ishii; K Yanagihara; K Mafune; M Makuuchi; M Terada Journal: Cancer Res Date: 1999-12-15 Impact factor: 12.701
Authors: M Schwab; H E Varmus; J M Bishop; K H Grzeschik; S L Naylor; A Y Sakaguchi; G Brodeur; J Trent Journal: Nature Date: 1984 Mar 15-21 Impact factor: 49.962
Authors: K Althoff; A Beckers; E Bell; M Nortmeyer; T Thor; A Sprüssel; S Lindner; K De Preter; A Florin; L C Heukamp; L Klein-Hitpass; K Astrahantseff; C Kumps; F Speleman; A Eggert; F Westermann; A Schramm; J H Schulte Journal: Oncogene Date: 2014-09-01 Impact factor: 9.867
Authors: Christine M Lovly; Nerina T McDonald; Heidi Chen; Sandra Ortiz-Cuaran; Lukas C Heukamp; Yingjun Yan; Alexandra Florin; Luka Ozretić; Diana Lim; Lu Wang; Zhao Chen; Xi Chen; Pengcheng Lu; Paul K Paik; Ronglai Shen; Hailing Jin; Reinhard Buettner; Sascha Ansén; Sven Perner; Michael Brockmann; Marc Bos; Jürgen Wolf; Masyar Gardizi; Gavin M Wright; Benjamin Solomon; Prudence A Russell; Toni-Maree Rogers; Yoshiyuki Suehara; Monica Red-Brewer; Rudy Tieu; Elisa de Stanchina; Qingguo Wang; Zhongming Zhao; David H Johnson; Leora Horn; Kwok-Kin Wong; Roman K Thomas; Marc Ladanyi; William Pao Journal: Nat Med Date: 2014-08-31 Impact factor: 53.440