Shan Zhu1, Yuan Wang1, Hongtao Liu2, Wen Wei1, Yi Tu1, Chuang Chen1, Junlong Song1, Zhiliang Xu1, Juanjuan Li1, Changhua Wang3, Shengrong Sun1. 1. Department of Thyroid Breast Surgery, Renmin Hospital of Wuhan University, Wuhan 430060, China. 2. Department of Cardiovascular Medicine, Shenzhen Longhua District Central Hospital, Longhua Central Hospital Affiliated Guangdong Medical University, Shenzhen, Guangdong Province 518110, China. 3. Basic Medical School of Wuhan University, Wuhan 430060, China.
Abstract
BACKGROUND: Numerous studies have demonstrated that the inflammatory response is involved in the progression of lipopolysaccharide- (LPS-) induced myocardial cell apoptosis. Accumulating evidence has shown that thyroxine participates in diseases by downregulating the inflammatory response. This study aimed at investigating whether thyroxine alleviates LPS-induced myocardial cell apoptosis. METHODS: Bone marrow-derived macrophages (Mø) were treated with LPS and thyroxine, and Mø differentiation and Mø-related cytokine expression were measured. The effect of Mø differentiation on mouse cardiomyocyte (MCM) apoptosis was also detected in vitro. In addition, C57BL/6 mice underwent thyroidectomy and were treated with LPS 35 days later; subsequently, Mø differentiation and myocardial cell apoptosis in hearts were analyzed. To determine whether the nuclear factor-kappa B (NF-κB) p65 pathway mediates the effect of thyroxine on Mø differentiation and myocardial cell apoptosis, the specific NF-κB p65 pathway inhibitor JSH-23 was administered to mice that underwent a thyroidectomy. RESULTS: Levothyroxine treatment significantly reduced the activation of the NF-κB p65 pathway, decreased M1 macrophage (Mø1) differentiation and Mø1-related cytokine mRNA levels in LPS-treated Mø, and increased M2 macrophage (Mø2) differentiation and Mø2-related cytokine mRNA expression. The protective effects of levothyroxine on MCM apoptosis mediated by LPS-treated Mø were alleviated by JSH-23. In mice, thyroidectomy aggravated LPS-induced cardiac injury and cardiac dysfunction, further promoted NF-κB p65 activation, and increased cardiac Mø1 expression and myocardial cell apoptosis but decreased cardiac Mø2 expression. JSH-23 treatment significantly ameliorated the thyroidectomy-induced increases in myocardial cell apoptosis and Mø differentiation. CONCLUSIONS: Thyroxine alleviated the Mø1/Mø2 imbalance, reduced the inflammatory response, decreased myocardial cell apoptosis, and protected against cardiac injury and cardiac dysfunction in LPS-treated mice. Thyroxine may be a novel therapeutic strategy to prevent and treat LPS-induced cardiac injury.
BACKGROUND: Numerous studies have demonstrated that the inflammatory response is involved in the progression of lipopolysaccharide- (LPS-) induced myocardial cell apoptosis. Accumulating evidence has shown that thyroxine participates in diseases by downregulating the inflammatory response. This study aimed at investigating whether thyroxine alleviates LPS-induced myocardial cell apoptosis. METHODS: Bone marrow-derived macrophages (Mø) were treated with LPS and thyroxine, and Mø differentiation and Mø-related cytokine expression were measured. The effect of Mø differentiation on mouse cardiomyocyte (MCM) apoptosis was also detected in vitro. In addition, C57BL/6 mice underwent thyroidectomy and were treated with LPS 35 days later; subsequently, Mø differentiation and myocardial cell apoptosis in hearts were analyzed. To determine whether the nuclear factor-kappa B (NF-κB) p65 pathway mediates the effect of thyroxine on Mø differentiation and myocardial cell apoptosis, the specific NF-κB p65 pathway inhibitor JSH-23 was administered to mice that underwent a thyroidectomy. RESULTS: Levothyroxine treatment significantly reduced the activation of the NF-κB p65 pathway, decreased M1 macrophage (Mø1) differentiation and Mø1-related cytokine mRNA levels in LPS-treated Mø, and increased M2 macrophage (Mø2) differentiation and Mø2-related cytokine mRNA expression. The protective effects of levothyroxine on MCM apoptosis mediated by LPS-treated Mø were alleviated by JSH-23. In mice, thyroidectomy aggravated LPS-induced cardiac injury and cardiac dysfunction, further promoted NF-κB p65 activation, and increased cardiac Mø1 expression and myocardial cell apoptosis but decreased cardiac Mø2 expression. JSH-23 treatment significantly ameliorated the thyroidectomy-induced increases in myocardial cell apoptosis and Mø differentiation. CONCLUSIONS: Thyroxine alleviated the Mø1/Mø2 imbalance, reduced the inflammatory response, decreased myocardial cell apoptosis, and protected against cardiac injury and cardiac dysfunction in LPS-treated mice. Thyroxine may be a novel therapeutic strategy to prevent and treat LPS-induced cardiac injury.
Sepsis is a complex systemic disease caused by a combination of factors. Sepsis, if not treated promptly and properly, can threaten a patient's life because it can rapidly develop into multiple organ dysfunction. Heart failure is the most serious complication because cardiac insufficiency is closely related to patient outcome and prognosis, and heart failure is the leading cause of death among all sepsis patients [1, 2]. In animal experiments, lipopolysaccharide (LPS) is often used to induce sepsis models, and various mechanisms have been demonstrated to be closely related to LPS-induced cardiac injury, including the inflammatory response, microcirculation disorder, and energy failure, with the inflammatory response being an especially major factor [3, 4].Thyroxine is an indispensable metabolic hormone in the body that has a variety of complex biological effects, including promoting the metabolism of substance and energy in the body, promoting physical and intellectual development, and improving the excitability of the nervous system, especially the sympathetic nervous system [5]. Subsequent data from clinical experiments and animal studies have demonstrated that the physiological effects of thyroxine go far beyond those listed above, as it was also reported to play a protective role in a variety of other biological effects, such as the inflammatory response, oxidative stress, apoptosis, and autophagy [6-9]. Thyroxine may naturally have direct and/or brief antagonistic effects on these pathological factors [6, 7].As we all know, thyroxine is closely related to the cardiovascular system and cardiovascular diseases. Decreased thyroxine levels in hypothyroidism can lead to cardiac decline and decreased myocardial contractility [10-12], while increased thyroxine levels in hyperthyroidism can lead to hyperthyroidism cardiomyopathy [13, 14]. In a recent study about ST-elevation myocardial infarction (STEMI) in Chinese, patients with low fT3 levels had a 3.6-fold increased rate of all-cause death, and fT3 levels may be a valuable and simple way to identify high-risk STEMI patients [15]. Thyroxine was also reported to protect against a variety of risk factors for cardiovascular diseases, including endothelial dysfunction, changes in blood pressure, myocardial systolic and diastolic dysfunction, and dyslipidemia [16]. Lower thyroxine levels were found in patients with sepsis [17], and LPS-induced sepsis leads to thyroid impairment and dysfunction in a rat model. [18]. However, whether thyroxine is involved in the LPS-induced inflammatory response and cardiac injury is still unknown. We hypothesize that thyroxine could regulate the differentiation of macrophages (Mø), which is closely related to inflammation and LPS-induced cardiac injury. In the present study, interventions of both thyroxine in vitro and thyroidectomy in vivo were used to investigate the effects of thyroxine on LPS-induced Mø differentiation and cardiac injury.
2. Materials and Methods
2.1. Cell Culture Studies
In brief, male C57BL/6 mice aged 9-10 weeks were anesthetized and euthanized, and the femur and tibia were separated and washed with phosphate-buffered saline (PBS) [19, 20]. After filtration and centrifugation, the bone marrow-derived Mø were obtained and plated in complete Dulbecco's modified Eagle's medium (DMEM, Sigma-Aldrich). To promote Mø differentiation, the Mø above received murine macrophage colony-stimulating factor (50 ng/ml, Sigma-Aldrich) and were cultured for 5 days [20]. Then, the Mø were treated with saline or levothyroxine (Thy, 1 μmol/ml, Sigma-Aldrich) for 1 hour before LPS (10 ng/ml, Sigma-Aldrich) was added [4, 21]. Six hours later, the Mø were collected, and signal transducer and activator of transcription 1 (STAT1) phosphorylation, nuclear factor-kappa B (NF-κB) p65 phosphorylation, and both M1 macrophage- (Mø1-) and M2 macrophage- (Mø2-) related cytokine mRNA levels were analyzed.Mouse cardiomyocytes (MCMs) were purchased from the American Type Culture Collection (ATCC) and cultured using the supernatants from the cultures described previously. In addition, the same group was given JSH-23 (15 μM, Sigma-Aldrich) before LPS treatment [22]. After treatment for 6 hours, the Bax and Bcl2 mRNA levels were investigated in the MCMs of each group.
2.2. Western Blot Analysis
The cell samples and heart samples were lysed, and total protein samples were collected. After each protein sample was quantified, 10% SDS polyacrylamide gels were used for electrophoresis and separation of proteins with different molecular weights, which were then transferred to Immobilon-FL PVDF membranes (Millipore). The membranes were blocked with 5% nonfat milk for 1 hour and incubated with primary antibodies at 4°C overnight, including anti-p-NF-κB p65, anti-NF-κB p65, anti-p-STAT1, anti-STAT1, anti-Bax, anti-Bcl2, anti-cleaved caspase-3 (Cle-cas3), and anti-GAPDH antibodies. Then, the membranes were incubated with a secondary antibody at room temperature for 1 hour, and the blots were scanned using an Odyssey system.
Both cells and heart tissue were lysed with TRIzol reagent W, and the total mRNA of each sample was collected. A reverse transcription kit was used to synthesize cDNA with 2 μg of total mRNA according to the manufacturer's instructions. Then, the LightCycler 480 SYBR Green Master Mix was used to perform the PCR amplifications. The inducible nitric oxide synthase (iNOS), arginine 1 (Arg-1), interleukin-1β (IL-1β), IL-4, IL-6, IL-10, IL-13, IL-17, TNF-α, IFN-γ, Bax, and Bcl2 mRNA levels were measured and normalized to GAPDH mRNA levels. All the reagents in this section were purchased from Roche, and the RT-qPCR primer sequences are shown in Table 1.
Table 1
RT-PCR primers used.
Gene
Forward primer
Forward primer
IL-1β
GGGCCTCAAAGGAAAGAATC
TACCAGTTGGGGAACTCTGC
IL-6
AGTTGCCTTCTTGGGACTGA
TCCACGATTTCCCAGAGAAC
IL-17
TCCAGAAGGCCCTCAGACTA
AGCATCTTCTCGACCCTGAA
TNF-α
CCCAGGGACCTCTCTCTAATC
ATGGGCTACAGGCTTGTCACT
IFN-γ
ACTGGCAAAAGGATGGTGAC
TGAGCTCATTGAATGCTTGG
IL-4
ACGAGGTCACAGGAGAAGGGA
AGCCCTACAGACGAGCTCACTC
IL-10
ATAACTGCACCCACTTCCCA
GGGCATCACTTCTACCAGGT
IL-13
CGCAAGGCCCCCACTAC
TGGCGAAACAGTTGCTTTGT
iNOS
TGACGCTCGGAACTGTAGCA
CAGTGATGGCCGACCTGAT
Arg-1
TGCTGATGGGAGGAGATGTCT
TTTCTTTCAGGGACAGCCTGTT
Bax
TTGCTGATGGCAACTTCAAC
GATCAGCTCGGGCACTTTAG
Bcl2
CAGAAGATCATGCCGTCCTT
CTTTCTGCTTTTTATTTCATGAGG
GAPDH
AACTTTGGCATTGTGGAAGG
CACATTGGGGGTAGGAACAC
2.4. Animal and Animal Models
Male C57BL/6 mice were provided by the Model Animal Research Center of Nanjing University (China) and housed in the specific-pathogen-free mouse room of Renmin Hospital of Wuhan University. After several weeks of feeding, 11- to 12-week-old mice underwent thyroidectomy as described in a previous study [23]. Briefly, after mice were anesthetized with 2% isoflurane, an incision was made in the neck at the anterior midline. Then, the skin of the neck was separated, and the fascia and muscles covering the thyroid gland were sequentially exposed. The thyroid gland, but not the pseudoparathyroid gland, was then removed with a white structure on the posterior wall of the thyroid gland (surgery group). Exposure without thyroid resection was performed on the sham group as a control (sham group). Five weeks later, the sham group and surgery group were treated with saline and LPS (10 mg/kg) for 12 hours [4]. In addition, before being treated with saline and LPS, some mice in the sham group and surgery group were also given DMSO or JSH-23 (3 mg/kg) [24].
2.5. Echocardiography
A total of 12 hours after LPS was administered, 2% isoflurane was used to anesthetize mice. Then, a MyLab 30CV ultrasound system (Biosound Esaote Inc.) with a 10-MHz linear array ultrasound transducer was used to perform the echocardiographic examination, and the cardiac structure and function parameters of each mouse were recorded, including the heat rate (HR), left ventricular end-diastolic dimension (LVEDD), left ventricular end-systolic dimension (LVEDS), left ventricular posterior wall end-diastolic dimension (LVPWD), left ventricular posterior wall end-systolic dimension (LVPWS), left ventricular end-diastolic volume (LVEDS), left ventricular end-systolic volume (LVEDV), left ventricular ejection fraction (LVED), and fraction shortening (FS).
2.6. Histological Analysis
Hearts were isolated and immediately put into 10% potassium chloride solution to stop the heartbeat, and then, 4% neutral paraformaldehyde was used to fix the heart samples. After being embedded in paraffin, the samples were cut into 5-6 mm sections and mounted onto slides. To detect Mø1 and Mø2 expression, anti-CD80 and anti-CD206 antibodies were used to perform immunohistochemical staining. To analyze the cleaved caspase-3 levels, an anti-cleaved caspase-3 antibody was used to perform immunofluorescence staining. In addition, apoptosis was detected using a terminal deoxynucleotidyl transferase-mediated dUTP nick end-labeling (TUNEL) staining kit (Millipore, USA) according to the manufacturer's instructions.
2.7. Statistical Analysis
All data are expressed as the mean ± standard deviation (SD). Student's t-test and one-way analysis of variance (ANOVA) with Tukey's post hoc analysis were respectively used to analyze the differences between two groups and more than two groups. P < 0.05 was considered statistically significant.
3. Results
3.1. Levothyroxine Treatment Inhibits LPS-Induced Mø1 Differentiation but Promotes Mø2 Differentiation In Vitro
Treatment with LPS significantly increased STAT1 and NF-κB p65 phosphorylation in Mø, while levothyroxine reversed NF-κB p65 phosphorylation but had no effect on STAT1 phosphorylation (Figure 1(a)). LPS also increased iNOS protein levels while decreasing Arg-1 protein levels in Mø, and these effects could be prevented by levothyroxine (Figure 1(a)). In addition, increased iNOS, IL-1β, IL-6, IL-17, TNF-α, and IFN-γ mRNA levels and decreased Arg-1, IL-4, IL-10, and IL-13 mRNA levels induced by LPS were also ameliorated by levothyroxine (Figure 1(b)).
Figure 1
Effects of levothyroxine on LPS-induced Mø differentiation. (a) STAT1 phosphorylation, p65 phosphorylation, iNOS, and Arg-1 levels were measured by western blot. (b) The iNOS, IL-1β, IL-6, IL-17, TNF-α, IFN-γ, Arg-1, IL-4, IL-10, and IL-13 mRNA levels in each group were detected by RT-qPCR. N = 5 in each group. ∗
P < 0.05 vs. the control group. #
P < 0.05 vs. the LPS group.
3.2. Levothyroxine Alleviated LPS-Induced MCM Apoptosis In Vitro
Supernatants collected from LPS-treated Mø significantly increased Bax mRNA levels while decreasing Bcl2 mRNA levels in LPS-treated MCMs, and these effects could be alleviated by levothyroxine. A reduction in Bax mRNA level and increase in Bcl2 mRNA level mediated by levothyroxine in LPS-treated MCMs were further alleviated by JSH-23 (Figure 2).
Figure 2
Effects of JSH-23 on LPS-induced MCM apoptosis. The Bax and Bcl2 mRNA levels in each group were detected. N = 5 in each group. ∗
P < 0.05 vs. the Mø+MCM group; #
P < 0.05 vs. the LPS+Mø+MCM group; §
P < 0.05 vs. the LPS+Mø+MCMs+Thy group.
3.3. Thyroidectomy Aggravates LPS-Induced Cardiac Dysfunction in Mice
Compared with those in the control group, HR, LVEF, and FS were slightly decreased in mice at 35 days after thyroidectomy, while other cardiac parameters showed no significant change. Both the LVEDS and LVEDV were significantly increased in the LPS-treated group and further enhanced by thyroidectomy. In addition, the LVPWS, LVEDV, LVEF, and FS were decreased in the LPS group and further decreased in the LPS+Surgery group. All the cardiac parameters of each group are shown in Table 2.
Table 2
Effects of thyroidectomy on cardiac function in LPS-treated mice.
Control
Surgery
LPS
LPS+Surgery
HR (bpm)
543 ± 41
494 ± 27∗
536 ± 47
487 ± 32#
LVEDD (mm)
4.21 ± 0.29
4.24 ± 0.27
4.16 ± 0.21
4.23 ± 0.32
LVEDS (mm)
2.31 ± 0.14
2.21 ± 0.11
2.87 ± 0.16∗
3.26 ± 0.22#
LVPWD (mm)
0.96 ± 0.08
0.93 ± 0.06
0.97 ± 0.09
0.95 ± 0.10
LVPWS (mm)
1.47 ± 0.11
1.52 ± 0.15
1.27 ± 0.12∗
1.09 ± 0.11#
LVEDV (μl)
77.7 ± 3.9
76.9 ± 4.1
68.4 ± 3.2∗
59.3 ± 2.9#
LVESV (μl)
18.3 ± 2.5
19.5 ± 2.7
29.3 ± 3.7∗
36.6 ± 4.1#
LVEF (%)
75.7 ± 3.2
68.4 ± 2.9∗
57.1 ± 3.1∗
45.7 ± 3.2#
FS (%)
41.8 ± 1.8
37.7 ± 1.6∗
31.5 ± 1.7∗
25.2 ± 1.8#
HR: heat rate; LVEDD: left ventricular end-diastolic dimension; LVEDS: left ventricular end-systolic dimension; LVPWD: left ventricular posterior wall end-diastolic dimension; LVPWS: left ventricular posterior wall end-systolic dimension; LVEDV: left ventricular end-diastolic volume; LVESV: left ventricular end-systolic volume; LVEF: left ventricular ejection fraction; FS: fraction shortening. N = 6 for each group; ∗
P < 0.05 vs. the control group; #
P < 0.05 vs. the LPS group.
3.4. Thyroidectomy Promotes Cardiac Mø1 Differentiation but Inhibits Mø2 Differentiation in LPS-Treated Mice
Phosphorylation of both STAT1 and NF-κB p65 pathways was first detected, and the results showed that LPS treatment significantly increased both STAT1 and NF-κB p65 phosphorylation. Thyroidectomy further increased NF-κB p65 phosphorylation but had no effect on STAT1 phosphorylation (Figure 3(a)). Similar trends of NF-κB p65 phosphorylation were observed both in liver and kidney (Figure S1). In addition, treatment with LPS resulted in increased levels of iNOS mRNA in the heart, and thyroidectomy further increased iNOS levels in LPS-treated mice (Figure 3(b)). Meanwhile, LPS induced a decrease in Arg-1 mRNA levels in the heart, and thyroidectomy further reduced Arg-1 mRNA levels in LPS-treated mice (Figure 3(b)). A trend similar to that of iNOS and Arg-1 was observed in cardiac CD80 and CD206 expression (Figure 3(c)). Furthermore, thyroidectomy increased the LPS-induced increase in IL-1β, IL-6, IL-17, TNF-α, and IFN-γ mRNA expression but further reduced the LPS-induced decrease in IL-4, IL-10, and IL-13 mRNA levels (Figures 3(d) and 3(e)).
Figure 3
Effects of thyroidectomy on LPS-induced Mø differentiation in mice. (a) STAT1 phosphorylation and p65 phosphorylation levels in the heart were measured. (b) The iNOS and Arg-1 mRNA levels in each heart sample were detected. (c) Heart CD80 and CD206 expression was analyzed by immunohistochemical staining (200x). (d and e) The iNOS, IL-1β, IL-6, IL-17, TNF-α, IFN-γ, Arg-1, IL-4, IL-10, and IL-13 mRNA levels in the heart were detected. N = 5 in each group. ∗
P < 0.05 vs. the control group. #
P < 0.05 vs. the LPS group.
3.5. Thyroidectomy Aggravates Myocardial Cell Apoptosis in LPS-Treated Mice
Apoptosis-related protein levels in cardiac tissue were first detected. The results showed that 12 hours after LPS treatment, there were higher levels of Bax and Cle-cas3 and lower levels of Bcl2 in the LPS group than in the control group. Meanwhile, thyroidectomy further increased Bax and Cle-cas3 levels and decreased Bcl2 levels in LPS-treated mice (Figure 4(a)). ALT levels and creatinine levels were observed to have similar trends of Bax mRNA levels (Figure S2). In addition, immunostaining revealed that thyroidectomy attenuated the cleaved caspase-3 protein levels in the heart of mice treated with LPS (Figure 4(b)). Furthermore, an increased number of TUNEL-positive cells were observed in LPS-treated mice, and thyroidectomy further increased the number of TUNEL-positive cells (Figure 4(c)).
Figure 4
Effects of thyroidectomy on LPS-induced myocardial cell apoptosis in mice. (a) The Bcl2, Bax, and Cle-cas3 levels in each group were measured by western blot. (b) Heart Cle-cas3 levels were detected by immunofluorescence staining (200x). (c) Representative images of TUNEL staining and the quantitative results in each group (200x). N = 5 in each group. ∗
P < 0.05 vs. the control group. #
P < 0.05 vs. the LPS group.
3.6. The NF-κB p65 Pathway Mediated the Effects of Thyroidectomy
JSH-23 treatment prevented thyroidectomy-induced increases in NF-κB p65 phosphorylation in LPS-treated mice (Figure 5(a)). In addition, increased iNOS, Bax, and Cle-cas3 levels and decreased Arg-1 and Bcl2 levels were reversed by JSH-23 (Figure 5(a)). Furthermore, increased IL-1β, IL-6, IL-17, TNF-α, and IFN-γ mRNA levels and decreased IL-4, IL-10, and IL-13 mRNA levels induced by thyroidectomy were prevented by JSH-23 treatment in LPS-treated mice (Figure 5(b)).
Figure 5
Effects of JSH-23 on LPS-induced cardiac injury. (a) p65 phosphorylation, iNOS, Arg-1, Bcl2, Bax, and Cle-cas3 levels were measured by western blot. (b) The IL-1β, IL-6, IL-17, TNF-α, IFN-γ, IL-4, IL-10, and IL-13 mRNA levels in each group were detected by RT-qPCR. N = 5 in each group. ∗
P < 0.05 vs. the LPS+Surgery group.
4. Discussion
In the present study, both cell culture experiments and animal studies were performed to investigate whether thyroxine participated in LPS-induced cardiac injury and to explore the mechanisms. We found that levothyroxine could reduce the LPS-induced Mø1/Mø2 imbalance and alleviate the inflammatory response in vitro. The increase in LPS-induced MCM apoptosis induced by Mø was significantly reversed by either JSH-23 or levothyroxine alone and further reversed by levothyroxine+JSH-23. Thyroidectomy aggravated the deterioration of cardiac function, further increased Mø1 differentiation while reducing Mø2 differentiation, and enhanced myocardial cell apoptosis in LPS-treated mice. These effects of thyroidectomy could be prevented by JSH-23, a special inhibitor of the NF-κB p65 pathway. Our study suggested that thyroxine could alleviate the Mø1/Mø2 imbalance by reducing NF-κB p65 pathway phosphorylation, thereby decreasing the inflammatory response and apoptosis of myocardial cells and relieving LPS-induced cardiac dysfunction.A variety of pathological mechanisms have been demonstrated to participate in the development of LPS-induced cardiac injury, such as the inflammatory response, oxidative stress, myocardial cell apoptosis, microcirculation disorder, and cardiac energy failure [3, 4, 25, 26]. Among these factors, inflammation plays the most important role because LPS has been found to promote the infiltration of a variety of immune cells and inflammatory factors into the heart [3, 4]. Myocardial cells have poor tolerance to strong inflammatory effects and are prone to myocardial cell apoptosis [27, 28]. Mø are one of the most important immune cells and can regulate the release of many cytokines. Activated Mø can be divided into proinflammatory Mø1 and anti-inflammatory Mø2, which can cause an intense inflammatory response and play protective roles in the inflammatory response, respectively [29, 30]. In fact, LPS can promote Mø1 differentiation and is often used to induce Mø1 differentiation [28, 30]. The STAT1 and NF-κB p65 pathways have been indicated to be the most important pathways that are closely related to Mø differentiation [31]. Overactivation of both the STAT1 and NF-κB p65 pathways in the inflammatory response can promote the Mø1 response, while inhibition of their phosphorylation will increase the Mø2 response [20]. To determine whether levothyroxine could regulate LPS-induced Mø differentiation, we first detected STAT1 and NF-κB p65 phosphorylation in vitro, and the results showed that levothyroxine reversed NF-κB p65 phosphorylation but had no effect on STAT1 phosphorylation in LPS-treated Mø. In addition, the protein levels of iNOS and Arg-1, the soluble mediators of Mø1 and Mø2, respectively, were respectively decreased and increased by levothyroxine treatment. In addition, LPS-induced increases in Mø1-related inflammatory cytokine mRNA levels and reductions in Mø2-related inflammatory cytokine mRNA levels were prevented by levothyroxine treatment. These results may suggest that levothyroxine inhibits the differentiation of Mø into Mø1 and promotes the differentiation of Mø into Mø2 by reversing NF-κB p65 pathway activation in LPS-treated Mø.In a LPS-induced cardiac injury and dysfunction animal model, a large number of apoptotic myocardial cells can often be observed; therefore, the basis of LPS-induced cardiac injury is that many factors directly or indirectly lead to the excessive apoptosis of myocardial cells, which leads to a change in cardiac structure and a decline in cardiac function [3, 4, 32, 33]. JSH-23 is a small molecular compound that specifically inhibits NF-κB p65 phosphorylation [24]. To investigate whether levothyroxine protects against LPS-induced myocardial cell apoptosis by preventing Mø1 differentiation, JSH-23 was used to inhibit the NF-κB p65 pathway in Mø. The results showed that supernatant collected from LPS-treated Mø increased Bax mRNA levels while decreasing Bcl2 mRNA levels in MCMs. These effects were alleviated by levothyroxine and further alleviated by JSH-23 treatment. These data may suggest that inhibition of NF-κB p65 pathway activation in Mø by JSH-23 can significantly reduce MCM apoptosis. Taken together, the results of the two cell culture experiments showed that thyroxine reversed the Mø1/Mø2 imbalance and alleviated the inflammatory response via the NF-κB p65 pathway, which protected myocardial cell apoptosis in vitro.The thyroid gland is an important endocrine organ and the main source of thyroxine. Failure to supplement thyroxine after thyroidectomy can lead to hypothyroidism and decreased circulating thyroxine levels. Adult male mice underwent thyroidectomy as described in a previous study. We also detected thyroid function 35 days after thyroidectomy and found that the level of thyroid-stimulating hormone (TSH) increased approximately 1.28-fold (Supplementary material, Figure S3A), while the levels of free triiodothyronine (FT3) and free thyroxine (FT4) were decreased approximately 0.21- and 0.42-fold, respectively (Supplementary material, Figures S3B and S3C). To further confirm the above speculation, adult male mice underwent thyroidectomy as described in a previous study [23]. To further confirm the speculation of our cell culture experiments, both sham mice and thyroidectomy mice were given LPS for 6 hours. Our results showed that thyroidectomy further activated the NF-κB p65 pathway, but not the STAT1 pathway, in LPS-induced mice. In addition, both cardiac iNOS and CD80 levels were further increased, and both Arg-1 and CD206 were further decreased by thyroidectomy in LPS-induced mice. The results showed that thyroidectomy could promote Mø1 differentiation and inhibit Mø2 differentiation in LPS-treated mice, and these effects may be mediated by further activation of the NF-κB p65 pathway. Furthermore, heart apoptosis-related protein expression and TUNEL-positive cell numbers were also increased by thyroidectomy. The results of the animal experiments are consistent with those of the cell experiments, indicating that thyroxine regulated LPS-induced Mø differentiation and myocardial cell apoptosis both in vivo and in vitro.To investigate whether the effects of thyroidectomy on Mø differentiation and myocardial cell apoptosis in mice were mediated by the NF-κB p65 pathway, some thyroidectomy mice were treated with JSH-23 before LPS was given, and the results showed that the promotion effect of thyroidectomy on Mø1 and myocardial cell apoptosis was significantly reversed by JSH-23 treatment. These results suggested that the regulatory role of thyroidectomy in cardiac Mø differentiation and myocardial cell apoptosis was also mediated by the NF-κB p65 signaling pathway.In summary, we found for the first time that thyroxine reduced the inflammatory response caused by macrophage imbalance by blocking the NF-κB p65 pathway to alleviate myocardial cell apoptosis in vivo and in vitro. Thyroxine may be an important means to protect against sepsis-induced organ failure in the clinic.
Authors: Yanti Octavia; Carlo G Tocchetti; Kathleen L Gabrielson; Stefan Janssens; Harry J Crijns; An L Moens Journal: J Mol Cell Cardiol Date: 2012-03-21 Impact factor: 5.000
Authors: Konstantinos Drosatos; Raffay S Khan; Chad M Trent; Hongfeng Jiang; Ni-Huiping Son; William S Blaner; Shunichi Homma; P Christian Schulze; Ira J Goldberg Journal: Circ Heart Fail Date: 2013-04-09 Impact factor: 8.790
Authors: Irene López-Mateo; Diego Rodríguez-Muñoz; Juan Vladimir de La Rosa; Antonio Castrillo; Susana Alemany; Ana Aranda Journal: Front Immunol Date: 2022-07-22 Impact factor: 8.786