Mechanisms underlying the protective effect of tannic acid against arsenic trioxide‑induced cardiotoxicity in rats: Potential involvement of mitochondrial apoptosis.

Arsenic trioxide (ATO) is a frontline chemotherapy drug used in the therapy of acute promyelocytic leukemia. However, the clinical use of ATO is hindered by its cardiotoxicity. The present study aimed to observe the potential effects and underlying mechanisms of tannic acid (TA) against ATO‑induced cardiotoxicity. Male rats were intraperitoneally injected with ATO (5 mg/kg/day) to induce cardiotoxicity. TA (20 and 40 mg/kg/day) was administered to evaluate its cardioprotective efficacy against ATO‑induced heart injury in rats. Administration of ATO resulted in pathological damage in the heart and increased oxidative stress as well as levels of serum cardiac biomarkers creatine kinase and lactate dehydrogenase and the inflammatory marker NF‑κB (p65). Conversely, TA markedly reversed this phenomenon. Additionally, TA treatment caused a notable decrease in the expression levels of cleaved caspase‑3/caspase‑3, Bax, p53 and Bad, while increasing Bcl‑2 expression levels. Notably, the application of TA decreased the expression levels of cytochrome c, second mitochondria‑derived activator of caspases and high‑temperature requirement A2, which are apoptosis mitochondrial‑associated proteins. The present findings indicated that TA protected against ATO‑induced cardiotoxicity, which may be associated with oxidative stress, inflammation and mitochondrial apoptosis.

Introduction

Arsenic, a naturally prevalent element, is found in the environment and certain foods. Arsenic has two forms in the environment: Organic and inorganic. Inorganic arsenic has two valences: Arsenite (III) and arsenate (V) (1). Generally, inorganic arsenic is more toxic than organic arsenic, and trivalent arsenic is more toxic than pentavalent arsenic (2). Arsenic trioxide (ATO) is the primary effective ingredient of white arsenic, which is inorganic arsenic. It has been used in the therapy of acute promyelocytic leukemia since the early 1990s. ATO is a safe and effective anticancer drug and is not prone to drug resistance (3). Researchers have attempted to use ATO in the treatment of other types of tumor: ATO has also been reported to achieve a favorable therapeutic effect in the treatment of malignant tumors such as lymphoma, gastric (4), esophageal (5), liver and lung cancer, neuroblastoma (6) and breast cancer (7).

However, in the treatment of solid tumors, high concentrations of ATO can cause serious side effects, such as cardiotoxicity (8), hepatotoxicity (9), fluid retention (10), alimentary symptoms (11) and rash (12). ATO induces serious cardiotoxicity and potential cardiovascular side effects, including sudden death due to acute toxic myocardial damage (13,14). ATO also has a toxic effect on the liver, kidney and nervous system (15–17). These factors limit the clinical application of ATO. Potential mechanisms of ATO-induced cardiotoxicity include oxidative stress, mitochondrial DNA injury, apoptosis and functional disruption of ion channels (18). Several studies have indicated that mitochondrial damage, caspase activation and p53 signaling are the pathways underlying arsenic-induced apoptosis (1,18).

Mitochondria, intracellular double membrane organelles, are considered the ‘power plant’ of eukaryotic cells (19). Mitochondria are the primary site of intracellular oxidative phosphorylation and synthesis of adenosine triphosphate, which provides energy for cell activity (20). Mitochondria also participate in cell signaling, differentiation, proliferation and apoptosis (21). The heart, the most energy consuming organ, has the highest content of mitochondria of all types of tissue (22). The heart requires efficient oxidative metabolism and derives almost all of its energy from mitochondrial oxidative phosphorylation (23). Therefore, mitochondria are important for myocardial development as well as healthy function. Beyond their role as a cellular powerhouse, mitochondria produce reactive oxygen species (ROS) (24), which lead to oxidative injury and regulate cardiomyocyte apoptosis. Hence, mitochondrial dysfunction and ROS production are considered key factors in cardiac disease. Creatine kinase (CK) and lactate dehydrogenase (LDH) are vital biomarkers for the diagnosis of myocardial injury (25). Studies have shown that ATO increases LDH content and consequently results in cardiomyocyte necrosis (26,27).

There are two major antioxidant systems in the body: The enzyme antioxidant system [involving superoxide dismutase (SOD) and catalase (CAT)] and the non-enzyme antioxidant system (involving vitamins C and E, glutathione, carotenoid, copper and zinc) (28). When oxidative stress occurs, these two systems are out of balance, which leads to tissue damage (29). Studies have shown that excessive ROS during ATO treatment leads to destruction in the endogenous antioxidant system (30,31). In addition, studies have suggested that high doses of ATO can cause oxidative stress, increased ROS and inhibit enzyme and mitochondrial activity (32,33). Mitochondrial impairment leads to the release of mitochondrial-associated proteins cytochrome c, second mitochondria-derived activator of caspases (Smac) and high-temperature requirement A2 (HtrA2); the release of cytochrome c can activate caspase-3 (34). Moreover, the Bcl-2 family, which serves a crucial role in the regulation of cardiomyocyte apoptosis, is a primary regulator of cytochrome c release and caspase-3 activation (34). Arsenic exposure increases the levels of pro-apoptotic proteins Bax (35) and Bad (36) and decreases the expression levels of anti-apoptotic protein Bcl-2 (37). Furthermore, one study reported that arsenic exposure activates phosphorylation of the NF-κB pathway (36). The NF-κB pathway participates in the inflammatory response, which results in apoptosis (38). Thus, we hypothesized that the potential mechanism of ATO-induced cardiotoxicity may be associated with oxidative stress, inflammation and mitochondrial apoptosis.

Tannic acid (TA) is found in plants and foods, such as apples, pears, beans, tea and red wine. TA is a water-soluble polyphenol compound with a complex chemical structure (C76H52O46; Fig. 1), containing a glucose core covalently linked to 3–5 gallic acid residues through the hydrolysis of ester bonds (39). TA has been revealed to exert antioxidant, anti-inflammatory, anticarcinogenic, antimutagenic and antiatherogenic properties (40). It is also capable of protecting against drug toxicity (41).

Figure 1.

Structure of tannic acid.

Our previous studies have indicated that TA has beneficial effects on cardiovascular disease (42–44); moreover, we found that TA ameliorates ATO-induced nephrotoxicity (45). However, the effects of TA on ATO-induced cardiotoxicity have not yet been reported. The aim of the present study was to evaluate whether TA can protect against ATO-induced heart injury in rats.

Materials and methods

Chemicals and materials

TA (>98% purity) was acquired from Sigma-Aldrich (Merck KGaA). ATO was purchased from Beijing SL Pharmaceutical Co., Ltd. Kits for determining total CK and LDH, as well as catalase (CAT), malondialdehyde (MDA) and superoxide dismutase (SOD) activity were obtained from Nanjing Jiancheng Bioengineering Institute. All solvents were analytical grade and commercially available.

Animals and experimental protocol

A total of 50 adult male Sprague-Dawley rats (age, 6–8 weeks; weight, 180–220 g) were obtained from Hebei Medical University. Male rats were raised under standard conditions (22-25°C and 45–55% relative humidity with a 12-h light/dark cycle), with ad libitum access to pellet food and water. Animal experiments were performed in accordance with the Animal Care and Ethics Committee of Hebei University of Chinese Medicine (Shijiazhuang, China). The Animal Care and Ethics Committee of Hebei University of Chinese Medicine approved all animal protocols (approval no. DWLL2018038).

Male rats were stochastically separated into five groups: i) Control (Control, 0.1 ml/kg/day); ii) ATO-alone (ATO, 5 mg/kg/day); iii) ATO + low-dose TA (ATO + L-TA, 20 mg/kg/day); iv) ATO + high-dose TA (ATO + H-TA, 40 mg/kg/day); and v) TA-alone (TA, 40 mg/kg/day). Rats were intraperitoneally (i.p.) injected with ATO (5 mg/kg) to establish an ATO-induced cardiotoxicity model. Dose selection was determined according to previous literature (46,47). Studies have reported that the median lethal dose of ATO is 14.98 mg/kg body weight in rats (48,49). The Control group received isovolumic normal saline. The ATO + L-TA and ATO + H-TA groups underwent intragastric administration of TA (20 and 40 mg/kg/day, respectively) every morning and were intraperitoneally injected with ATO (5 mg/kg/day) every afternoon (40,42,45). After 7 days, sodium pentobarbital (40 mg/kg, i.p.; Sigma-Aldrich; Merck KGaA) was used to anesthetize rats, and the heart was removed and measured.

Histopathological examination

Cardiac specimens were fixed in 4% paraformaldehyde at room temperature for 48 h. Following fixation, all paraffin-embedded samples were sectioned at 4 µm and stained at room temperature with 0.1% hematoxylin (Hebei Bohai Biological Engineering Development Co., Ltd.) for 5 min and 0.5% eosin for 3 min (50). Finally, pathological changes in myocardial tissue structure were examined under a light microscope at ×400 magnification (Leica DM4000B; Leica Microsystems GmbH).

Measurement of cardiac marker enzymes

Rat serum was separated by centrifugation at 1,500 × g for 10 min at 4°C and the activity of CK and LDH were detected using CK (cat. no. A032) and LDH (cat. no. A020-1) assay kits (both Nanjing Jiancheng Bioengineering Institute), respectively. For CK assay, serum samples (20 µl) and mixed reagent were added into tubes according to the manufacturer's protocol, then vortex mixed and incubated at 37°C for 20 min. Then, R6 solution from the kit was added and the mixed solution was centrifuged at 3,500 × g for 10 min at room temperature. Next, the tubes were heated in a water bath at 45°C for 15 min and the absorbance was detected at 660 nm using a microplate reader (Varioskan LUX; Thermo Fisher Scientific, Inc.). The activity of CK was calculated according to the formula provided in the manufacturer's protocol.

For the LDH assay, serum samples (20 µl; 1:50), buffer solution and coenzyme I solution were added into tubes, vortex mixed and incubated at 37°C for 15 min, according to the manufacturer's protocol. Then, 2,4-dinitrophenylhydrazine solution was added before being vortex mixed and incubated at 37°C for 15 min. Next, NaOH solution was added and incubated at room temperature for 3 min, and the absorbance was detected at 440 nm using a microplate reader (as aforementioned). The amount of LDH was assessed by measuring the levels of pyruvic acid.

Measurement of ROS

The fluorescent probe dihydroethidine (DHE) was used to measure the content of ROS in fresh heart tissue samples using an ROS detection kit (cat. no. KGAF019; Nanjing KeyGen Biotech Co., Ltd.). The specimens were embedded at optimum cutting temperature and flash-frozen in liquid nitrogen and sectioned (thickness, 5 µm) using a freezing microtome (Leica CM1950; Leica Microsystems GmbH). Then, 50 µM DHE solution was added, and sections were incubated at room temperature in a darkened incubator for 30 min. Next, sections were washed three times with PBS (5 min/wash). Finally, the sections were sealed using a water-soluble encapsulant and examined using a fluorescence microscope at ×200 magnification (Leica DM4000B; Leica Microsystems GmbH). The stained area of ROS was quantitatively analyzed using Image Pro Plus 6.0 software (Media Cybernetics, Inc.).

Measurement of serum levels of SOD, CAT and MDA

Rat serum was separated by centrifugation at 1,500 × g for 10 min at 4°C and the serum levels of SOD, CAT and MDA were detected using assay kits (cat. nos. A001-3, A007-1 and A003-1, respectively; all Nanjing Jiancheng Bioengineering Institute). According to the manufacturer's instruction, serum samples and relevant solutions of the SOD assay kit were mixed and incubated at 37°C for 20 min, then the absorbance was measured at 450 nm using a microplate reader (as aforementioned). The activity of SOD was calculated as U/ml. Similarly, the activity of CAT and MDA were analyzed following the manufacturer's instructions. The absorbance of CAT at 405 nm and the absorbance of MDA at 532 nm were measured using a microplate reader (as aforementioned). The activity of CAT was calculated as U/ml and the contents of MDA were calculated as nmol/ml.

Immunohistochemistry

Tissue sections were subjected to conventional dewaxing to water, rehydrated in a descending series of ethanol (100, 95, 90 and 80%), and then incubated with 3% H2O2 for 20 min at 37°C. Sections were incubated overnight at 4°C with primary antibodies against Bax protein (1:80; cat. no. 50599-2-Ig), cytochrome c (1:70; cat. no. 10993-1-AP), HtrA2 (1:80; cat. no. 15775-1-AP) and Smac (1:70; cat. no. 10434-1-AP) (all ProteinTech Group, Inc.). Next, sections were washed three times using PBS solution. The sections were incubated with horseradish peroxidase-conjugated secondary antibody (1:2,000, cat. no. PV-6001; OriGene Technologies, Inc.) for 20 min at room temperature, and then stained using the 3,3′diaminobenzidine (DAB) substrate kit (cat. no. ZLI-9019; OriGene Technologies, Inc.). Color development was induced with 0.5% DAB for 20 min at room temperature. Lastly, the heart tissue samples were re-stained with 0.5% hematoxylin for 2 min at room temperature and observed under a light microscope (magnification, ×400). Protein expression levels were measured using Image Pro Plus 6.0 software (Media Cybernetics, Inc.).

Western blotting

Frozen samples were weighed separately and homogenized in RIPA lysis buffer (Beijing Solarbio Science & Technology Co., Ltd.), then lysed overnight at 4°C. The heart tissue samples were centrifuged at 12,000 × g for 10 min at 4°C, then supernatant (total protein extract) was transferred to an EP tube and the protein level was quantified via the bicinchoninic acid method. Then, the protein samples (50 µg) were transferred onto PVDF membranes using 10% SDS-PAGE gels (EMD Millipore). The membranes were gently removed and placed in a TBST blocking buffer (5% skimmed milk in TBS-0.1% Tween-20) for 2 h at 37°C. Next, the proteins were incubated with anti-NF-κB (p65) (1:2,000; cat. no. 10745-1-AP; ProteinTech Group, Inc.), anti-caspase 3 (1:600; cat. no. 19677-1-AP; ProteinTech Group, Inc.), anti-cleaved caspase-3 (1:800; cat. no. AF7022; Affinity Biosciences), anti-Bcl-2 (1:600; cat. no. 26593-1-AP; ProteinTech Group, Inc.) and anti-β-actin (1:1,000; cat. no. TA-09; OriGene Technologies, Inc.) overnight at 4°C. Then, proteins were incubated with the horseradish peroxidase-labeled secondary antibody (1:3,000; cat. no. ZB-2301; OriGene Technologies, Inc.) for 90 min at room temperature. Membranes were washed three times and proteins were visualized using the ECL Detection system (TransGen Biotech Co., Ltd.). After scanning the film with a Tanon1600, the gray value of the band was measured by Tanon Gis 1D software (Tanon Science and Technology Co., Ltd.).

Reverse transcription-quantitative (RT-q)PCR

Total RNA was extracted from heart tissue samples using TRIzol (cat. no. 15596-026; Invitrogen; Thermo Fisher Scientific, Inc.). RT was performed with TIANScript RT kit (cat. no. KR104-02; Tiangen Biotech Co., Ltd.) according to the manufacturer's instructions. The gene expression levels of p53 and Bad in heart tissue were assessed via RT-qPCR using SYBR Green (cat. no. FP205; Tiangen Biotech Co., Ltd.). β-actin was used as the internal control. The PCR thermocycling conditions were: Initial denaturation (95°C for 15 min), then 40 cycles of denaturation (95°C for 10 sec), annealing (58°C for 30 sec) and extension (72°C for 30 sec). The data was analyzed with the 2−ΔΔCq method (51). The primers used are listed in Table I.

Table I.

Primer sequences of p53, Bad and β-actin.

Gene	Primer sequence (5′→3′)	Fragment size, bp
p53	Forward: CCCCAGGATGTTGCAGAGTTG	150
	Reverse: TTGAGAAGGGACGGAAGATGAC
Bad	Forward: GAGTCGCCACAGTTCGTACC	156
	Reverse: TCAAATTCATCGCTCATTCTTC
β-actin	Forward: CCTAGACTTCGAGCAAGAGA	140
	Reverse: GGAAGGAAGGCTGGAAGA

Data analysis

Data are presented as the mean ± SEM of three independent repeats. Statistical comparisons between groups were measured using one-way ANOVA followed by Bonferroni's test. The Bonferroni correction was used as a post hoc test to eliminate false positives in multiple comparisons. Origin 7.5 (OriginLab) and SPSS 15.0 (SPSS, Inc.) statistical analysis software were used. P<0.05 was considered to indicate a statistically significant difference.

Results

Effects of TA on heart histopathology

Histological changes of rat heart samples were investigated by H&E staining. Heart tissue exhibited a normal myocardium structure and regular myocardial cell distribution in the Control group (Fig. 2). However, in the ATO group, notable myocardial tissue injury, disordered arrangement of cardiomyocytes, cell nucleus pyknosis and degeneration, increased eosinophils and focal inflammatory cell infiltration were observed. The ATO + L-TA and ATO + H-TA groups retained an almost normal myocardial tissue structure (myocardial cells arranged closely, rich cytoplasm, regular nucleus and normal cardiac muscle bundles). In addition, there was no difference in myocardial structure between the TA and Control groups.

Figure 2.

Effects of TA on cardiac histopathology. Representative sections were obtained from the myocardial tissue of Control, ATO, ATO + L-TA, ATO + H-TA and TA groups. Magnification, ×400; scale bar, 50 µm. TA, tannic acid; ATO, arsenic trioxide; L, low dose; H, high dose.

Effects of TA on cardiotoxicity indices

CK and LDH levels in the ATO group were significantly improved compared with the Control group (Fig. 3), revealing that the experimental model was successfully established. The CK and LDH levels in the ATO + L-TA and ATO + H-TA groups were significantly decreased compared with the ATO group.

Figure 3.

Effects of TA on the activity of CK and LDH. Activity of (A) CK and (B) LDH was measured in serum using commercial detection kits. Serum was collected from the Control, ATO, ATO + L-TA, ATO + H-TA, and TA groups. Data are presented as the mean ± SEM (n=6). **P<0.01 vs. Control; #P<0.05 and ##P<0.01 vs. ATO. CK, creatine kinase; LDH, lactate dehydrogenase; TA, tannic acid; ATO, arsenic trioxide; L, low dose; H, high dose.

Effects of TA on oxidative stress markers

Fluorescence intensity was significantly enhanced in the ATO group, suggesting that the level of ROS was higher in the heart tissue compared with the Control group (Fig. 4). Following TA treatment, fluorescence intensity significantly weakened. These results indicated that TA protection against ATO-induced heart damage may be associated with decreasing oxidative stress and ROS production.

Figure 4.

Effects of TA on the level of ROS in myocardial tissue. Production of ROS was measured in heart tissues with a dihydroethidium probe. The fluorescence intensity and ROS levels area percentages are shown. Magnification, ×200; scale bar, 100 µm. **P<0.05 vs. Control; #P<0.05 and ##P<0.01 vs. ATO. TA, tannic acid; ROS, reactive oxygen species; ATO, arsenic trioxide; L, low dose; H, high dose.

Effects of TA on levels of SOD, CAT, and MDA

Serum analysis revealed that SOD (Fig. 5A) and CAT (Fig. 5B) levels in the ATO group were significantly decreased compared with the Control group. Compared with the ATO group, SOD and CAT activity were increased in the ATO + L-TA and ATO + H-TA groups. Moreover, MDA (Fig. 5C) levels increased following ATO exposure compared with the Control group. Following, TA administration, the levels of MDA were lower in the ATO + L-TA and ATO + H-TA groups.

Figure 5.

Effects of TA on SOD, CAT activities and MDA content in serum. Levels of (A) SOD, (B) CAT and (C) MDA were evaluated in rat heart serum using commercial detection kits. Data are presented as the mean ± SEM (n=6). *P<0.05 and **P<0.01 vs. Control; #P<0.05 and ##P<0.01 vs. ATO. TA, tannic acid; SOD, superoxide dismutase; CAT, catalase; MDA, malondialdehyde; ATO, arsenic trioxide; L, low dose; H, high dose.

Effects of TA on cytochrome c, Smac, HtrA2 and Bax expression levels

Immunohistochemistry was used to measure the expression levels of cytochrome c, Smac, HtrA2 and Bax in the heart tissue samples. Cytochrome c, Smac, HtrA2 and Bax expression levels were significantly increased in the ATO group compared with the Control (Fig. 6). Administration of 20 or 40 mg/kg/day TA decreased the expression levels of cytochrome c, Smac, HtrA2 and Bax, indicating that the cardiac protection of TA is a result of its anti-mitochondrial apoptosis effect.

Figure 6.

Effects of TA on the expression levels of cytochrome c, Smac, HtrA2 and Bax. Morphological orientation of the expression levels of (A) cytochrome c, (B) Smac, (C) HtrA2 and (D) Bax in myocardial tissue, as measured by immunohistochemistry. Magnification, ×200; scale bar, 50 µm. Area percentage content of (E) cytochrome c, (F) Smac, (G) HtrA2 and (H) Bax was calculated in the Control, ATO, ATO + L-TA, ATO + H-TA and TA groups. Data are presented as the mean ± SEM (n=6). **P<0.01 vs. Control; ##P<0.01 vs. ATO. Smac, second mitochondria-derived activator of caspases; HtrA2, high-temperature requirement A2; TA, tannic acid; ATO, arsenic trioxide; L, low dose; H, high dose.

Effects of TA on the expression levels of caspase-3, cleaved caspase-3, Bcl-2 and NF-κB (p65)

Expression levels of caspase-3, cleaved caspase-3 and NF-κB (p65) were markedly increased in the ATO group (Fig. 7A and E). However, the expression levels of Bcl-2 significantly decreased (Fig. 7C). The ratio of cleaved caspase-3/caspase-3 and NF-κB (p65) was significantly upregulated in the ATO group compared with the Control (Fig. 7B and F). However, compared with the Control group, the Bcl-2 (Fig. 7D) expression levels were significantly lower in the ATO group. Following TA treatment, the ratio of cleaved caspase-3/caspase-3 was significantly decreased, and the expression levels of NF-κB (p65) were downregulated, whereas Bcl-2 expression levels were significantly increased.

Figure 7.

Effects of TA on caspase-3, cleaved caspase-3, Bcl-2 and NF-κB (p65) expression levels in rat heart. (A) Protein expression levels of caspase-3 and cleaved caspase-3 were measured by western blot analysis and (B) intensity was normalized to β-actin. (C) Protein expression levels of Bcl-2 were measured by western blot analysis and (D) intensity was normalized to β-actin. (E) Protein expression levels of NF-κB (p65) were measured by western blot analysis and (F) intensity of was normalized to β-actin. Data are presented as the mean ± SEM (n=3). *P<0.05 and **P<0.01 vs. Control; #P<0.05 and ##P<0.01 vs. ATO. TA, tannic acid; ATO, arsenic trioxide; L, low dose; H, high dose.

Effects of TA on the expression levels of p53 and Bad

The expression levels of p53 and Bad in the ATO group were significantly increased compared with the Control group (Fig. 8). Subsequent TA administration caused a significant decrease in p53 and Bad expression levels.

Figure 8.

Effects of TA on p53 and Bad expression levels. Gene expression levels of (A) p53 and (B) Bad were examined by reverse transcription-quantitative PCR. Cardiac samples were obtained from the Control, ATO, ATO + L-TA, ATO + H-TA and TA groups. Data are presented as the mean ± SEM (n=3). *P<0.05 and **P<0.01 vs. Control; ##P<0.01 vs. ATO. TA, tannic acid; ATO, arsenic trioxide; L, low dose; H, high dose.

Discussion

There are an increasing number of studies on the cardiotoxicity of ATO, which limits its wide clinical application (13,14). The present study established a cardiotoxicity model in rats by intraperitoneal injection with ATO (5 mg/kg). In addition, high-dose TA-alone was administered to evaluate whether it has a toxic effect on the heart. The results demonstrated that the cardiotoxicity induced by ATO was primarily characterized by histopathological changes. In the ATO group, myocardial cells were swollen, the cytoplasm exhibited vacuolation and myocardial fiber was abnormal (swelling of myocardial fiber, interstitial oedema and myofibrillar loss. Serum increase of CK and LDH enzymes was also detected. These findings demonstrated that ATO had a toxic effect on the myocardium. Administration of TA significantly ameliorated ATO-induced pathological changes in myocardial tissue. In addition, there was no difference in myocardial structure between the TA and Control groups. Compared with the Control group, the levels of CK and LDH in the TA group were not significantly different. These results indicated that high-dose TA alone hardly induced cardiotoxicity.

Candidate mechanisms for the cardiotoxicity induced by ATO include changes of cardiac ion channels, oxidative stress injury and cardiomyocyte apoptosis (51). Compared with other cells, cardiomyocytes are more susceptible to oxidative stress due to weak antioxidant defenses (52) and enrichment of mitochondria (30).

Oxidative stress is considered to be an imbalance between generation of ROS and the activity of antioxidant defenses. Oxidative stress is a negative consequence of the in vivo production of radicals, and it is considered to be an important factor leading to apoptosis (34). Multiple studies have reported that high a concentration of arsenic can cause oxidative stress and increase ROS (53,54). Excessive ROS cause injury to numerous types of macromolecules, including DNA, lipid and protein (34,55). ROS alters cell signaling processes, such as gene expression level changes, transcription factor activation and apoptosis (56). ATO has a high affinity with sulfhydryl groups (57). ATO can penetrate the cell membrane and reach the cytoplasm via diffusion, resulting in cytotoxicity by increasing ROS (58). ROS are eliminated by the catalytic deactivation of SOD and CAT in vivo. Therefore, these enzymes can protect the body from radicals (59). In myocardial cells, the electron transport chain, situated in the internal membrane of the mitochondria, is the primary source of ROS (60). Myocardial cells provide energy essential for cellular survival and function. In addition, CK and LDH serve important roles in energy metabolism in vivo. CK and LDH are also important parameters for the diagnosis of myocardial injury (25). In the present study, following ATO administration, CAT and SOD activity markedly decreased, and the MDA levels markedly increased in serum. This result suggested that the cardiotoxicity of ATO was associated with oxidative stress injury and that TA significantly improved this phenomenon.

Mitochondria have long been considered to serve a considerable role in cell growth. However, the important function of mitochondria in programmed cell death was not recognized until the mid-1990s (61). Mitochondria are not only an important site generating cellular energy, but also the primary source of ROS and free radicals (23). Concurrently, the mitochondria are the target of multiple apoptotic signals, which contribute to apoptosis (62). Studies have shown that polyphenols affect mitochondrial function and structure by modulating biosynthesis (mitogenesis), dynamics (fission, fusion), transport and autophagic cleavage of damaged mitochondria (mitophagy) (63,64). Wang et al (65) revealed that curcumin downregulated PI3K/AKT/mTOR and mTOR/p70S6K signaling pathways and activated autophagy, thus demonstrating neuroprotection in APP/presenilin 1 double transgenic mice. Apoptosis or programmed death is the mechanism of cell evolutionary conservation, which selectively removes aged, damaged and other unnecessary cells. This is a crucial part of numerous normal physiological processes, such as embryonic development, normal tissue growth and immunoreaction (66). Apoptosis is mediated by caspase activation (67). Caspase is the effector of apoptosis; it can bind to multiple types of substrate, resulting in specific biochemical and morphological changes in apoptotic cells, including changes in mitochondrial membrane permeability, cytoskeleton reorganization, exposure of phosphatidylserine and DNA fragmentation (68). Endogenous apoptosis is caused by mitochondrial activation of oxidative stress. Certain mitochondrial proteins, such as pro-apoptotic factor, cytochrome c apoptosis-inducing factor, Smac, HtrA2 and endonuclease G, serve a regulatory role in apoptosis (63). The first released proteins are cytochrome c, Htr2A and Smac in the mitochondrial apoptosis pathway, and cytochrome c, released into the cytoplasm, is combined with apoptotic protease-activating factor to form associated apoptotic bodies. This promotes the self-activation of the caspase-9 precursor, then initiates the caspase-3 precursor and cleaves caspase-3, resulting in apoptosis (69). In the present study, the ratio of cleaved caspase-3/caspase-3 was increased, which suggested activation of the caspase apoptosis pathway. Moreover, Du et al (70) revealed that Smac/DIABLO enhances cytochrome c-mediated caspase-3 activity. The present results demonstrated an increase in expression levels of cytochrome c, Smac and Htr2A, as well as the ratio of cleaved caspase-3/caspase-3, in the ATO group, confirming that ATO induced apoptotic events. The present study showed that TA treatment markedly downregulated the expression levels of the aforementioned apoptosis-associated genes and decreased the number of apoptotic cells in the ATO + L-TA and ATO + H-TA groups. In addition, the TA group exhibited no significant difference in these protein expression levels.

Bcl-2 family proteins include anti-apoptotic genes Bcl-2 and apoptosis stimulating proteins, such as Bad and Bax (71). These regulate the release of cytochrome c and the activation of caspase-3, which play an essential role in the control of mitochondrial apoptosis (72). The p53 protein is a tumor suppressor and serves a crucial role in the regulation of mitochondrial apoptosis, cell cycle and senescence (69). p53 signaling activates the transcription of Bad and Bax (73,74) and suppresses the transcription of Bcl-2 (75,76). A previous study demonstrated that low levels of p53 contribute to maintaining mitochondrial activity and function (77). Additionally, studies have reported that arsenic exposure causes the phosphorylation of the NF-κB (p65) pathway (36,78). Activation of the NF-κB pathway triggers an inflammatory response, which induces apoptosis. NF-κB exhibits pro-inflammatory properties (79), and apoptosis is an indispensable mechanism that inhibits prolonged inflammation (80). In accordance with published studies, we observed that ATO exposure increased the expression levels of p53 protein, Bax, Bad and NF-κB (p65) and decreased those of Bcl-2 in rat heart. These results demonstrated that ATO induced myocardial apoptosis via mitochondria dysfunction and inflammation. Furthermore, following administration of TA, the expression levels of p53 protein, Bax, Bad and NF-κB (p65) were suppressed and Bcl-2 protein expression levels were promoted.

Based on the findings obtained from the present study, we hypothesize that the beneficial protective effect of TA may be achieved via ameliorating ATO-induced injury of cardiomyocytes and inhibiting the release of cardiac marker enzymes from the myocardium. In the present study, TA significantly improved ATO-induced oxidative stress injury and mitochondrial function due to ROS scavenging properties. As such, TA ameliorates ATO-induced cardiomyocyte apoptosis via decreasing the release of mitochondrial-associated proteins cytochrome c, Smac and Htr2A and inhibition of caspase-3 activation. In addition, the present study indicated that TA plays an anti-inflammatory role by inhibiting the activation of the NF-κB pathway; similarly, TA has a significant suppression of ATO-induced activation of the p53 pathway resulting in decreased release of Bax and increasing the release of Bcl-2. This protected the cardiomyocytes from ATO-induced cell death.

The present study investigated the potential effects and mechanisms of TA against ATO-induced cardiotoxicity. It has recently been reported that combination of TA and antitumor agent cisplatin may exert synergistic anticancer effects and may be a novel adjuvant treatment for liver cancer (81). Our next study will investigate whether TA has synergistic or antagonistic effects when combined with ATO to treat malignant tumors.

In conclusion, the present data suggested that mitochondrial dysfunction contributed to the cardiotoxicity of ATO, as well as to an oxidative stress reaction and inflammatory response. The present study demonstrated that TA administration effectively improved ATO-induced cardiotoxicity. The protective functions of TA may be associated with suppression of activation of the mitochondrial apoptosis pathway. Collectively, the present findings revealed that TA provided effective protection against ATO-induced cardiotoxicity. Based on these results, TA may have a potential defense mechanism in ATO clinical therapy and diminish its cardiotoxic effects. However, further investigation is required before its clinical application.