| Literature DB >> 31216043 |
Deeksha Munnur1, Edward Bartlett1, Petra Mikolčević2, Ilsa T Kirby3, Johannes Gregor Matthias Rack1, Andreja Mikoč2, Michael S Cohen3, Ivan Ahel1.
Abstract
ADP-ribosylation is a reversible chemical modification catalysed by ADP-ribosyltransferases such as PARPs that utilize nicotinamide adenine dinucleotide (NAD+) as a cofactor to transfer monomer or polymers of ADP-ribose nucleotide onto macromolecular targets such as proteins and DNA. ADP-ribosylation plays an important role in several biological processes such as DNA repair, transcription, chromatin remodelling, host-virus interactions, cellular stress response and many more. Using biochemical methods we identify RNA as a novel target of reversible mono-ADP-ribosylation. We demonstrate that the human PARPs - PARP10, PARP11 and PARP15 as well as a highly diverged PARP homologue TRPT1, ADP-ribosylate phosphorylated ends of RNA. We further reveal that ADP-ribosylation of RNA mediated by PARP10 and TRPT1 can be efficiently reversed by several cellular ADP-ribosylhydrolases (PARG, TARG1, MACROD1, MACROD2 and ARH3), as well as by MACROD-like hydrolases from VEEV and SARS viruses. Finally, we show that TRPT1 and MACROD homologues in bacteria possess activities equivalent to the human proteins. Our data suggest that RNA ADP-ribosylation may represent a widespread and physiologically relevant form of reversible ADP-ribosylation signalling.Entities:
Mesh:
Substances:
Year: 2019 PMID: 31216043 PMCID: PMC6582358 DOI: 10.1093/nar/gkz305
Source DB: PubMed Journal: Nucleic Acids Res ISSN: 0305-1048 Impact factor: 16.971
Sequence of oligonucleotides used in this study
| Name | Sequence (5′→3′) |
|---|---|
| 5P ssRNA | [Phos] GUGGCGCGGAGACUUAGAGAA |
| 3P ssRNA | GUGGCGCGGAGACUUAGAGAA [Phos] |
| noP ssRNA | GUGGCGCGGAGACUUAGAGAA |
| 3P ssRNA 5Cy3 | [Cy3] GUGGCGCGGAGACUUAGAGAA [Phos] |
| noP ssRNA 5Cy3 | [Cy3] GUGGCGCGGAGACUUAGAGAA |
| 5P ssRNA 3Cy3 | [Phos] GUGGCGCGGAGACUUAGAGAA [Cy3] |
| noP ssRNA 3Cy3 | GUGGCGCGGAGACUUAGAGAA [Cy3] |
| 5P ssDNA | [Phos] GTGGCGCGGAGACTTAGAGAA |
| 3P ssDNA | GTGGCGCGGAGACTTAGAGAA [Phos] |
| noP ssDNA | GTGGCGCGGAGACTTAGAGAA |
| RexT DNA | GGAATTCCCCGCGCCAAATTTCTCTAAGTCTCCGCGCCAC |
| 7mer | [Phos] GUGGCGC [Cy3] |
| 12mer | [Phos] GUGGCGCGGAGA [Cy3] |
Figure 1.ADP-ribosylation of RNA mediated by PARP10. (A) ADP-ribosylation of phosphorylated or non-phosphorylated single-stranded (ss) RNA substrate in the presence of PARP3 or PARP10 cat. 32P labelled ssRNA was used as a marker in lane 2 and PARP3 mediated DNA ADP-ribosylation was used as a positive control for nucleic acid ADP-ribosylation in lane 1. (B) ADP-ribosylation by PARP3 and PARP10 of recessed double-stranded (ds) or ssDNA. (C) Specific ADP-ribosylation of ss DNA or RNA with or without phosphate group at 5′ or 3′ end of the oligo by PARP10. (D) PARP10 catalysed RNA ADP-ribosylated substrate treated with: Proteinase K & SDS, Benzonase alone or Benzonase followed by Proteinase K (Bnz + ProtK). (E) ssRNA with phosphate group at 5′ end and labelled with Cyanine3 tag at 3′ end (5P ssRNA 3Cy3) and (F) ssRNA with phosphate group at 3′ end and labelled with Cyanine3 tag at 5′ end (3P ssRNA 5Cy3) modified in the presence of PARP10 and further treated with CIP. Gels in (E) and (F) are visualized using Cyanine3 label and PharosFX imager. (G) RNA ADP-ribosylation catalysed by PARP10 full length and PARP10 catalytic domain WT and G888W mutant.
Figure 2.Reversal of PARP10 mediated RNA ADP-ribosylation by human hydrolases at (A) 5′ phosphorylated and (B) 3′ phosphorylated end of ssRNA. (C) ADP-ribosylhydrolase activity of WT or mutant MACROD1 and ARH3 on 5P ADP-ribosylated PARP10 substrate. (D) PARP10 mediated RNA ADP-ribosylation at 5′ and 3′ ends can be reversed by macrodomain proteins from viral origin such as VEEV and SARS using human MACROD1 as a positive control for ADP-ribosylhydrolase activity. (E) Viral macrodomains of VEEV and SARS can also reverse dsDNA, ssDNA and ssRNA ADP-ribosylation. ADP-ribosylation of dsDNA, ssRNA and ssDNA were catalysed by PARP3, PARP10 cat and TRPT1, respectively.
Figure 3.RNA and DNA ADP-ribosylation catalysed by TRPT1. (A) ADP-ribosylation of 5′ phosphorylated RNA end by several members of PARP superfamily. (B) ADP-ribosylation of ssDNA and ssRNA with or without phosphate at 5′ or 3′ end. TRPT1 specifically modifies 5′ phosphorylated oligo ends. (C) The Arg-His-Arg-Arg tetrad is essential for ADP-ribosylation of RNA by TRPT1. Point mutation of any tetrad amino acid residue to alanine leads to complete loss of TRPT1 activity. (D) TRPT1 mediated RNA ADP-ribosylation is further treated with: Proteinase K & SDS, Benzonase alone or Benzonase followed by Proteinase K treatment (Bnz + ProtK). (E) ssRNA with phosphate group at 5′ end and labelled with Cyanine3 tag at 3′ end (5P ssRNA 3Cy3) modified in the presence of TRPT1 and further treated with CIP. To visualize Cyanine3 label fluorescence gels were imaged using PharosFX imager. (F) TRPT1 mediated modification of different length of RNA oligos (7, 12 and 21mer length). (G) RNA ADP-ribosylation by TRPT1 can be reversed by human ADP-ribosylhydrolases – PARG, TARG1, MACROD1, MACROD2 and ARH3. (H) Enzymatically dead mutants of MACROD1 and ARH3 are unable to reverse RNA ADP-ribosylation by TRPT1. (I) RNA ADP-ribosylation of ssRNA with 5P ssRNA 3Cy3 catalysed by TRPT1 reversed by PARG, MACROD1 and MACROD2. Gels were visualized using Cyanine3 label and PharosFX imager.
Figure 4.RNA ADP-ribosylation activity of TRPT1 is evolutionarily conserved. (A) KptA homolog from Homo sapiens (TRPT1) and bacterial S. coelicolor (Sco KptA) were tested with RNA oligo with or without phosphate group at 5′ or 3′ end of RNA and Cyanine3 label at the non-phosphorylated end. 5′ 32P RNA oligo with Cyanine3 at 3′ end was used as size marker in lane 1. (B) RNA ADP-ribosylation catalysed by Sco KptA can be reversed by human MACROD1 and S. coelicolor macrodomain containing protein Sco6450 but not by Mtb DarG. (C) S. coelicolor macrodomain containing protein Sco6450 can also reverse RNA ADP-ribosylation mediated by TRPT1.