BACKGROUND: To explore the role of non-coding RNA activated by DNA damage (NORAD), a long non-coding ribonucleic acid (lncRNA), in non-small cell lung cancer (NSCLC) and its possible mechanism. METHODS: Quantitative real-time polymerase chain reaction was adopted for the detection of the expression levels of NORAD, micro RNA (miR)-656-3p, and AKT serine/threonine kinase 1 (AKT1). The effects of NORAD, miR-656-3p, and AKT1 on cell proliferation and migration were examined through the Cell Counting Kit-8 (CCK-8) and Transwell assay. Subsequently, the binding relationships between miR-656-3p and AKT1 and between miR-656-3p and NORAD were verified by dual-luciferase reporter gene assay. Finally, the potential mechanisms of action of NORAD and miR-656-3p were explored through the torsion experiment. RESULTS: The lncRNA NORAD expression level in NSCLC patients was notably higher than that in people in control group, that in patients with metastasis was higher than that in patients without metastasis, and that in patients with NSCLC in stage III-IV was significantly higher than that in patients with NSCLC in stage I-II. Elevation of NORAD stimulated the proliferation and migration of NSCLC A549/H460 cells. According to the reporter gene assay, NORAD could bind to miR-656-3p. Besides, miR-656-3p was significantly under-expressed in cancer tissues of patients with NSCLC, and overexpression of miR-656-3p could block the proliferation and migration of A549/H460 cells and reversed promotion on cell proliferation and migration by NORAD. Furthermore, the reporter gene assay revealed that the overexpression of AKT1, a miR-656-3p target gene, could reverse miR-656-3p's inhibitory effect on the proliferation and migration of A549/H460 cells. CONCLUSION: LncRNA NORAD is capable of promoting the proliferation and migration of NSCLC cells, and its mechanism may be that it increases the AKT1 expression by adsorbing miR-656-3p.
BACKGROUND: To explore the role of non-coding RNA activated by DNA damage (NORAD), a long non-coding ribonucleic acid (lncRNA), in non-small cell lung cancer (NSCLC) and its possible mechanism. METHODS: Quantitative real-time polymerase chain reaction was adopted for the detection of the expression levels of NORAD, micro RNA (miR)-656-3p, and AKT serine/threonine kinase 1 (AKT1). The effects of NORAD, miR-656-3p, and AKT1 on cell proliferation and migration were examined through the Cell Counting Kit-8 (CCK-8) and Transwell assay. Subsequently, the binding relationships between miR-656-3p and AKT1 and between miR-656-3p and NORAD were verified by dual-luciferase reporter gene assay. Finally, the potential mechanisms of action of NORAD and miR-656-3p were explored through the torsion experiment. RESULTS: The lncRNA NORAD expression level in NSCLCpatients was notably higher than that in people in control group, that in patients with metastasis was higher than that in patients without metastasis, and that in patients with NSCLC in stage III-IV was significantly higher than that in patients with NSCLC in stage I-II. Elevation of NORAD stimulated the proliferation and migration of NSCLC A549/H460 cells. According to the reporter gene assay, NORAD could bind to miR-656-3p. Besides, miR-656-3p was significantly under-expressed in cancer tissues of patients with NSCLC, and overexpression of miR-656-3p could block the proliferation and migration of A549/H460 cells and reversed promotion on cell proliferation and migration by NORAD. Furthermore, the reporter gene assay revealed that the overexpression of AKT1, a miR-656-3p target gene, could reverse miR-656-3p's inhibitory effect on the proliferation and migration of A549/H460 cells. CONCLUSION: LncRNA NORAD is capable of promoting the proliferation and migration of NSCLC cells, and its mechanism may be that it increases the AKT1 expression by adsorbing miR-656-3p.
Lung cancer is a malignant tumor, whose incidence and mortality rates were the highest worldwide, which seriously threatens human life and health (Jemal, Siegel, Xu, & Ward, 2010; McGuire, 2016; Wei, Tian, Song, Wu, & Liu, 2018). Based on pathological types, lung cancer can be divided into two types, namely, small cell lung cancer and non‐small cell lung cancer (NSCLC), and the incidence rate of the latter takes up 80%–90% of the total of lung cancer (Stewart et al., 2014). Currently, lung cancer is primarily diagnosed using imaging techniques. Although the growth and metastasis of NSCLC are relatively slow, most patients have been already in the middle and advanced stages when they are definitely diagnosed with the disease as there are no effective molecular markers for early diagnosis. At this time, cancer cells have undergone extensive invasion and metastasis, so the patients miss the best time for operation, which leads to the overall 5‐year survival rate of only about 17%. In terms of treatment, although there is an opportunity for early NSCLC to undergo surgical treatment, the radical cure rate is not high. Advanced NSCLC receives the comprehensive treatment dominated by chemotherapy, but the therapeutic effect is not satisfactory ("Cancer statistics", 2013). Therefore, lung cancer has become a major killer threatening human health. Investigating the mechanism of occurrence and development of lung cancer and finding molecular markers for early diagnosis of lung cancer are of great significance for early diagnosis and clinical treatment of lung cancer.A long non‐coding ribonucleic acid (lncRNA) is a kind of linear RNA molecule which is abundant in various cells and has a length of more than 200 bases, but generally does not have the ability to code proteins (Chen et al., 2017). Current studies have manifested that varying lncRNAs can indirectly modulate the malignant behavior of cells, including malignant transformation, drug sensitivity, proliferation ability, and metastasis by participating in the regulation of various molecular mechanisms of malignant tumor cells (Gong et al., 2017; Zhang et al., 2016). However, more and more in‐depth studies have verified that lncRNAs also regulate the gene expression at both transcriptional and post‐transcriptional levels as well as the epigenetic level, so as to exert crucial effects on tumor initiation, progression, and metastasis, proving that they are potential prognostic markers and therapeutic targets for tumors (Hennessy, 2017; Shi et al., 2015). For instance, it has been demonstrated in some studies that lncRNA UCA1 can regulate the proliferation of bladder cancer cells by acting on the PI3K‐AKT‐mTOR signaling pathway. Meanwhile, it has been confirmed that the transcription factor Ets‐2 can affect the expression level of UCA1 and indirectly participate in the AKT‐mTOR signaling pathway to realize the regulation on cell apoptosis, thereby promoting the development of bladder tumor (Wu et al., 2013). Additionally, studies on lncRNA in lung cancer have been reported frequently. For instance, it has been found in some studies that HOX transcript antisense RNA (HOTAIR) exhibits a high expression in NSCLC tissues, and highly expressed HOTAIR often represents the poor prognosis of patients (Balci et al., 2016). According to other studies, lncRNA KCNQ1OT1 located on human chromosome 11p15.5 has a close relationship to proliferation and drug resistance of lung cancer, and lowering its expression can remarkably enhance drug resistance of lung cancer to chemotherapeutic drugs (Du, Zhou, Beatty, Weksberg, & Sadowski, 2004; Ren, Xu, Huang, Zhao, & Shi, 2017). Moreover, it has been reported that lncRNA colon cancer associated transcript 1 (CCAT1) is primarily associated with malignant transformation of lung cancer, whose mechanism is probably to indirectly promote the c‐Myc activity in human bronchial epithelial cells induced by cigarette smoke exposure to induce malignant transformation, thereby promoting lung cancer's occurrence and development (Tran et al., 2015). However, the above research cannot explain all the phenomena, so it is very crucial to further study the effect of lncRNA on lung cancer.It has been confirmed by existing studies that non‐coding RNA activated by DNA damage (NORAD), a lncRNA, plays a crucial role in varying tumors (Wang et al., 2018; Wu et al., 2017). In pancreatic cancer, for example, lncRNA NORAD can induce epithelial‐mesenchymal transformation caused by hypoxia to boost metastasis of pancreatic cancer (Li et al., 2017). Besides, in cervical cancer, NORAD is able to enhance the proliferation and invasion abilities of cancer cells by increasing the SIP1 expression, so as to accelerate the process of tumors (Huo et al., 2018), but there is no research on the role of NORAD in NSCLC.In this study, it was found that lncRNA NORAD exhibits an obvious high expression in NSCLC, so it was expected to further explore the role of NORAD in NSCLC and its potential mechanism.
MATERIALS AND METHODS
Ethical compliance
The research was approved by the Ethics Committee of Jiangsu Taizhou People's Hospital.
General data
Fresh NSCLC and NSCLC‐adjacent tissue samples of 24 NSCLCpatients receiving surgical treatment were collected, and the NSCLC‐adjacent tissues should be at more than 5 cm from the edge of the tumor tissues. Besides, these patients had no history of other primary secondary tumors and no history of chemotherapy, radiotherapy, targeted therapy, etc. After collection, the samples were placed in a freezing storage tube, marked with sample information and stored in liquid nitrogen, and procedures in the whole storage and transportation process were operated under the condition with no enzyme. Meanwhile, clinicopathological data of all the patients were collected, including age, gender, smoking history, the tumor size, pathological subtypes, histological grades, TNM stages, and the lymph node status. All the patients voluntarily entered into this study and signed the written informed consent, and this study gained the approval of the Ethics Committee of the Jiangsu Taizhou People's Hospital.
Cell culture
HBE, a normal bronchial epithelial cell line, and SPC‐A1, H460, H1650, and A549, NSCLC cell lines, were all purchased from ATCC. The cells were cultured in Dulbecco's Modified Eagle's medium (Thermo Fisher Scientific, Waltham, MA) containing 10% fetal bovine serum (FBS; Hyclone, USA) or Roswell Park Memorial Institute 1,640 medium (GIBCO‐BRL; Thermo Fisher Scientific, Waltham, MA, USA) in a constant temperature incubator with 5% CO2 and saturated humidity at 37°C.
Cell transfection
At 1 day before transfection, an appropriate number of cells were seeded into six‐well plates and cultured in the cell culture medium without antibiotics, followed by transient transfection when the cells covered 60%–70% of the culture dish overnight. Then the cells were transfected with micro RNA (miR)‐656‐3p mimics, plasmid complementary deoxyribonucleic acid pcDNA‐NORAD, pcDNA‐AKT1 and corresponding negative controls and mixed with Lipo2000. Subsequently, the mixture was let stand for 20 min after even mixing at room temperature to form the mimics/Lipo2000 (or DNA/Lipo2000) complex. Hundred microliters of the complex was slowly dripped into the culture solution and mixed well to co‐culture the cells for 4–6 hr. After that, the complex was removed, and the complete culture medium containing 10% FBS and 1% streptomycin was used to replace the culture medium for 24 hr for subsequent experiments. The siRNAs (si‐NC, si‐NORAD), miRNA mimics (miR‐NC, miR‐656‐3p), and overexpression plasmids (pcDNA‐NC, pcDNA‐NORAD, pcDNA‐AKT1) were synthesized by Shanghai GenePharma Co., Ltd. (Shanghai, China). They were cloned into the mammalian expression vector pcDNA3.1 (Invitrogen).
Total RNA extraction from tissues and cells
About 50 mg tissues were taken, ground in liquid nitrogen, and added with 1 ml TRIzol (Invitrogen, USA). Then cells were washed with PBS once after collection, added with 1 ml TRIzol at the cell density of 5 × 106/ml. After that, the tissues or cells were fully homogenized, transferred to a 1. 5 ml centrifuge tube, and let stand for 5 min. Chloroform with a volume of 0.2 times that of the volume of TRIzol (1 ml TRIzol reagent needs 0.2 ml chloroform) was added into a centrifuge tube containing lysate, let stand for 5 min at room temperature after even mixing, and centrifuged for 10 min. Then the supernatant was transferred to another unused 1. 5 ml centrifuge tube, added with an equal volume of isopropyl alcohol, mixed evenly, and centrifuged for 10 min, and ultimately the supernatant was carefully sucked and discarded. After that, 1 ml of 75% ethanol was added into a centrifuge tube containing RNA precipitates, mixed uniformly, let stand for 5 min at room temperature, and centrifuged for 5 min. DNase 1 was applied to remove DNA in case of DNA contamination and the A260/A280 ratio was used to assess the quality of RNA. Finally, the supernatant was carefully sucked and discarded, and the RNA precipitates were dried at room temperature and dissolved in diethyl pyrocarbonate (DEPC)‐treated water according to their amount.
Quantitative real‐time polymerase chain reaction
After the concentration and purity of RNA samples were tested, cDNA samples were synthesized by reverse transcription with U6 and GAPDH as the internal reference, respectively. SYBR Green (Applied Biosystems, USA) premixed solution, templates, forward (F)/reverse (R) primers, and DEPC (Beyotime Biotechnology, China) were prepared into PCR solution, which was placed on a RT‐PCR instrument for PCR amplification. MiRNAs were reversely transcribed into cDNAs by miRNA RT Kit [Tiangen Biotech (Shanghai) Co., Ltd.], and PCR and quantitative analysis of miRNAs were carried out according to miRNA qPCR kit instructions [Tiangen Biotech (Shanghai) Co., Ltd.]. 2‐△△ct method was applied to calculate the relative expression levels and the control genes were U6 and GAPDH. Primer sequences are listed below:miR‐656‐3p (F: 5'ACACTCCAGCTGGGAATATTATACAGTCA 3',.R: 5'CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAGAGGUUG 3');U6 (F: CTCGCTTCGGCAGCAGCACATATA,R: AAATATGGAACGCTTCACGA);NORAD (F: 5'TGATAGGATACATCTTGGACATGGA3'),R: 5'AACCTAATGAACAAGTCCTGACATACA3');GAPDH (F: 5'GAAGAGAGAGACCCTCACGCTG3', R: 5'ACTGTGAGGAGGGGAGATTCAGT3');AKT1 (F: 5'AGCGACGTGGCTATTGTGAAG3', R: 5'GCCATCATTCTTGAGGAGGAAGT3').
Luciferase enzyme detection
For the binding assay of miR‐656‐3p and NORAD or AKT1, complementary sequences for miR‐656‐3p and NORAD or AKT1 predicted by bioinformatics analysis were synthesized chemically and inserted into the pGL3 vector carrying the Renilla luciferase (Rluc) gene to generate pGL3‐NORAD or pGL3‐AKT1 for the luciferase reporter assay (the vectors synthesized by Shanghai GenePharma). The luciferase reporter plasmid or empty vector was co‐transfected into lung cancer cell lines with the encoding gene plasmid in a 24‐well plate. Luciferase activities were measured at 48 hr after transfection with the Dual‐Luciferase Reporter Assay System (Promega), according to the manufacturer's protocol. Rluc activity was normalized against firefly luciferase activity and presented as the percentage of inhibition.
Cell migration
A Transwell chamber was placed above a 24‐well plate. Then the transfected NSCLC cells were digested with trypsin and suspended in serum‐free medium, followed by counting with a cell counting plate. After that, the cells were diluted with serum‐free medium, whose density was adjusted to 1 × 105/ml, and then the above cell suspension was added into the chamber. Then a culture medium containing 10% FBS was added into the sterile 24‐well plate for culture in an incubator. After 48 hr, the culture medium was removed, followed by washing with PBS, and the Transwell chamber was taken out and fixed with 4% paraformaldehyde for 30 min. After 0.5% crystal violet was applied for 10–15 min of staining, the staining agent was washed with PBS. Finally, observation and counting of the cells were performed using a microscope. All the experiments were repeated three times.
Cell proliferation
NSCLC cells after treatment were seeded into 96‐well plates at the density of 1 × 104/well, followed by culturing for 0 hr, 24 hr, 48 hr, 72 hr, and 96 hr, respectively. Cell Counting Kit‐8 (CCK‐8) kit (Dojindo, Japan) was utilized to detect the cell proliferation ability, before which CCK‐8 and the culture medium were mixed at a ratio of 1:10 to prepare a mixed solution. The old culture medium was discarded, and 110 μl of the mixed culture medium was added for further 1 hr of incubation at 37°C away from light. Ultimately, the OD value at 450 nm was examined by enzyme‐linked immunosorbent assay, and six replicate wells were set in each group. All the experiments were repeated three times.
Western blotting
Cells were collected and lysed with RIPA lysis buffer (Beyotime, Beijing, China) with complete Protease Inhibitor Cocktail (Roche, USA). Equal amounts of protein lysates were subjected to 12% SDS‐PAGE gels and then transferred to PVDF membrane (Millipore, Billerica, MA). The membranes were incubated with the primary antibodies at 4°C overnight. The following primary antibodies were used: GAPDH (Cell Signaling, USA), AKT1(Cell Signaling, USA). After incubating with secondary horseradish peroxidase‐conjugated antibodies (Cell Signaling, USA) for 2 hr at room temperature, blots were visualized through an enhanced chemiluminescence system (Thermo Fisher Scientific, USA). Protein bands were quantified by densitometric analysis using Quantity One software (Bio‐Rad Laboratories, San Diego, CA).
Statistical methods
All data are presented as the mean ± standard deviation (SD) from three independent experiments. All statistical analyses were performed using SPSS 18.0 software (IBM, USA). Differences between groups were analyzed using Student's t test (two groups) or one‐way ANOVA analysis (multiple groups). A chi‐square test was applied to determine the association of NORAD levels with clinicopathological features. A value of p < 0.05 was considered statistically significant.
RESULTS
NORAD was obviously highly expressed in lung cancer and lung cancer cell lines
At first, the expression level of lncRNA NORAD in lung cancer tissues and corresponding cancer‐adjacent tissues was measured, and it was found that NORAD was obviously highly expressed in lung cancer tissues (Figure 1a). Second, lung cancerpatients were divided into metastasis group and non‐metastasis group, and the expression level of NORAD in the two groups was examined. The results revealed that NORAD exhibited a notably high expression in the tissues of patients with cancer metastasis (Figure 1b). Thirdly, the expression of NORAD in different lung cancer stages were detected, which manifested that the expression of NORAD in patients with lung cancer in stage III–IV was markedly higher than that in patients with cancer in stage I–II (Figure 1c). Furthermore, the expression level of NORAD in lung cancer cell lines was also determined. According to the results, compared with that in HBE, the normal bronchial epithelial cell line, the NORAD expression level was generally high in lung cancer cell lines (Figure 1d). The above results indicate that NORAD may play a certain role in the process of lung cancer.
Figure 1
NORAD exhibits a remarkably high expression in lung cancer and lung cancer cell lines. (a) The expression of NORAD is obviously high in lung cancer tissues (n = 24) compared with that in cancer‐adjacent tissues (n = 24). (b) The NORAD expression in metastasis group (n = 16) is higher than that in non‐metastasis group (n = 8). (c) The expression of NORAD in the tissues of patients with lung cancer in stage III–IV (n = 18) is remarkably higher than that in patients with lung cancer in stage I–II (n = 6). (d) Compared with that in normal bronchial epithelial cells, the NORAD expression is generally high in lung cancer cell lines. *p < 0.05, **p < 0.01, ***p < 0.001
NORAD exhibits a remarkably high expression in lung cancer and lung cancer cell lines. (a) The expression of NORAD is obviously high in lung cancer tissues (n = 24) compared with that in cancer‐adjacent tissues (n = 24). (b) The NORAD expression in metastasis group (n = 16) is higher than that in non‐metastasis group (n = 8). (c) The expression of NORAD in the tissues of patients with lung cancer in stage III–IV (n = 18) is remarkably higher than that in patients with lung cancer in stage I–II (n = 6). (d) Compared with that in normal bronchial epithelial cells, the NORAD expression is generally high in lung cancer cell lines. *p < 0.05, **p < 0.01, ***p < 0.001
NORAD could evidently promote cell proliferation and migration
In order to explore the possible role of NORAD in lung cancer's occurrence and development, A549 and H460 cell lines were chosen for the following research. After transfection with NORAD overexpression plasmids, the NORAD expression in the two cell lines was evidently elevated compared with that in control group (Figure 2a). The effects of the NORAD expression on cell proliferation and migration were examined through the up‐regulation of its expression. The results denoted that the proliferation and migration of cells were markedly enhanced after the expression of NORAD was increased (Figure 2b–d).
Figure 2
NORAD can evidently promote cell proliferation and migration. (a) After lung cancer cell lines A549 and H460 are transfected with NORAD overexpression plasmids, the NORAD expression is markedly elevated. (b, c) Cell proliferation ability is obviously enhanced after the NORAD expression in A549 and H460 cells is upregulated. (d) Cell migration ability is remarkably improved after the NORAD expression in A549 and H460 cells is upregulated. *p < 0.05, **p < 0.01, ***p < 0.001
NORAD can evidently promote cell proliferation and migration. (a) After lung cancer cell lines A549 and H460 are transfected with NORAD overexpression plasmids, the NORAD expression is markedly elevated. (b, c) Cell proliferation ability is obviously enhanced after the NORAD expression in A549 and H460 cells is upregulated. (d) Cell migration ability is remarkably improved after the NORAD expression in A549 and H460 cells is upregulated. *p < 0.05, **p < 0.01, ***p < 0.001
MiR‐656‐3p was a target gene of NORAD
It was found in bioinformatics analysis that miR‐656‐3p was a potential target gene for NORAD, and a potential binding site existed between the two (Figure 3a). Furthermore, the binding relationship between the two was verified through the dual‐luciferase reporter gene assay (Figure 3b,c). The expression of NORAD in A549/H460 cells was upregulated or downregulated to verify whether NORAD regulates the expression of miR‐656‐3p, and the expression level of miR‐656‐3p was detected. According to the results, the expression level of miR‐656‐3p was notably reduced after the expression of NORAD was upregulated, while it was increased after the expression of NORAD was downregulated (Figure 3d,e). Due to this regulatory relationship, the expression of miR‐656‐3p in lung cancer was further measured, which showed that miR‐656‐3P exhibited a significant low expression in lung cancer (Figure 3f).
Figure 3
MiR‐656‐3p is NORAD's target gene. (a) Bioinformatics analysis shows that the two have potential binding sites. (b, c) Dual‐luciferase reporter gene displays that there is a binding relationship between them. (d, e) After the NORAD expression in A549/H460 cells is upregulated or downregulated, respectively, the miR‐656‐3p expression is notably decreased or increased. (f) Compared with that in cancer‐adjacent tissues (n = 24), miR‐656‐3p is significantly lowly expressed in lung cancer tissues(n = 24). *p < 0.05, **p < 0.01, ***p < 0.001
MiR‐656‐3p is NORAD's target gene. (a) Bioinformatics analysis shows that the two have potential binding sites. (b, c) Dual‐luciferase reporter gene displays that there is a binding relationship between them. (d, e) After the NORAD expression in A549/H460 cells is upregulated or downregulated, respectively, the miR‐656‐3p expression is notably decreased or increased. (f) Compared with that in cancer‐adjacent tissues (n = 24), miR‐656‐3p is significantly lowly expressed in lung cancer tissues(n = 24). *p < 0.05, **p < 0.01, ***p < 0.001
NORAD played its role by adsorbing miR‐656‐3p
Since NORAD could modulate the expression of miR‐656‐3p, it was speculated that NORAD lowered miR‐656‐3p to play its role. Then a torsion experiment was conducted to verify this speculation. In the first place, the transfection efficiency of miR‐656‐3p mimics was examined to ensure its effectiveness (Figure 4a). Then functional experiments denoted that upregulating the expression of miR‐656‐3p could markedly block the proliferation and migration of A549 and H460 cells, and can inhibited the promotion of NORAD on cell proliferation and migration in part (Figure 4b‐4e), which also confirmed the above speculation.
Figure 4
NORAD functions by adsorbing miR‐656‐3p. (a) The miR‐656‐3p expression is obviously upregulated after A549/H460 cells are transfected with miR‐656‐3p mimics. (b, c) The elevated miR‐656‐3p expression in A549/H460 cells can significantly inhibit cell proliferation and partially reverse NORAD's promotion on cell proliferation. (d, e) The elevated miR‐656‐3p expression in A549/H460 cells can evidently suppress the cell migration ability and can partially reverse the promotion effect of NORAD on cell migration. *p < 0.05, **p < 0.01, ***p < 0.001
NORAD functions by adsorbing miR‐656‐3p. (a) The miR‐656‐3p expression is obviously upregulated after A549/H460 cells are transfected with miR‐656‐3p mimics. (b, c) The elevated miR‐656‐3p expression in A549/H460 cells can significantly inhibit cell proliferation and partially reverse NORAD's promotion on cell proliferation. (d, e) The elevated miR‐656‐3p expression in A549/H460 cells can evidently suppress the cell migration ability and can partially reverse the promotion effect of NORAD on cell migration. *p < 0.05, **p < 0.01, ***p < 0.001
AKT1 was a potential target gene of miR‐656‐3p
It was found in prediction and analysis through websites that AKT1 was a potential target gene of miR‐656‐3p (Figure 5a), and the dual‐luciferase reporter gene assay further confirmed the binding relationship between the two (Figure 5b,c). The AKT1 expression was measured after the expression of miR‐656‐3p was elevated in A549 and H460 cells, which displayed that both mRNA and protein expression levels of AKT1 was remarkably inhibited (Figure 5d,e). We also found they have other binding sites, but the luciferase assay showed no significant difference (Supplementary Figure S1). The above results denote that AKT1 is the target gene of miR‐656‐3p, and miR‐656‐3p can reduce the AKT1 expression.
Figure 5
AKT1 is a potential target gene of miR‐656‐3p. (a) Bioinformatics analysis manifests that the two have potential binding sites. (b, c) According to the dual‐luciferase reporter gene assay, there is a binding relationship between them. (d, e) After the expression of miR‐656‐3p in A549/H460 cells is upregulated, and the mRNA and protein expression levels of AKT1 obviously declined. *p < 0.05, **p < 0.01, ***p < 0.001
AKT1 is a potential target gene of miR‐656‐3p. (a) Bioinformatics analysis manifests that the two have potential binding sites. (b, c) According to the dual‐luciferase reporter gene assay, there is a binding relationship between them. (d, e) After the expression of miR‐656‐3p in A549/H460 cells is upregulated, and the mRNA and protein expression levels of AKT1 obviously declined. *p < 0.05, **p < 0.01, ***p < 0.001
MiR‐656‐3p exerted its effects by decreasing AKT1
Similarly, in order to explore whether miR‐656‐3p exerts its effects by decreasing AKT1, a torsion experiment was carried out. The experimental results confirmed that the proliferation and migration abilities of A549 and H460 cell lines were significantly enhanced after the AKT1 expression was increased. However, the proliferation and migration abilities of cells were partially impeded after the expressions of both miR‐656‐3p and AKT1 were upregulated compared with those after the elevation of the AKT1 expression alone (Figure 6a,b), which indicates that miR‐656‐3p reduces the expression of AKT1 to exert its effects. As NORAD was capable of downregulating the expression of miR‐656‐3p, the effect of NORAD on the AKT1 expression level was expected to be verified. After the NORAD of expression was upregulated, it was found that AKT1 was notably highly expressed at mRNA and protein levels compared with that in control group (Figure 6c,d), suggesting that NORAD upregulates the AKT1 expression by adsorbing miR‐656‐3p.
Figure 6
MiR‐656‐3p exerts its effects by decreasing AKT1. (a, b) After the AKT1 expression in A549/H460 cells rose up, the cell proliferation and migration abilities are notably enhanced, and miR‐656‐3p's inhibition on cell proliferation and migration are partially reversed. (c, d) After the AKT1 expression in A549/H460 cells is upregulated, the mRNA and protein expression levels of AKT1 are evidently increased. *p < 0.05, **p < 0.01, ***p < 0.001
MiR‐656‐3p exerts its effects by decreasing AKT1. (a, b) After the AKT1 expression in A549/H460 cells rose up, the cell proliferation and migration abilities are notably enhanced, and miR‐656‐3p's inhibition on cell proliferation and migration are partially reversed. (c, d) After the AKT1 expression in A549/H460 cells is upregulated, the mRNA and protein expression levels of AKT1 are evidently increased. *p < 0.05, **p < 0.01, ***p < 0.001
DISCUSSION
As a class of highly conserved small non‐coding RNAs with 1825 nucleotides in length, miRNAs can suppress protein translation or degrade target genes at the post‐transcriptional level to regulate gene expression (Hayes & Chayama, 2016). It is well known that miRNAs play a role as oncogenes or tumor suppressor genes in the occurrence and development of cancer (Feng, Zhang, Wang, & Chen, 2015). In recent years, the competitive endogenous RNA (ceRNA) hypothesis has revealed a new mechanism of RNA interaction. In this case, non‐coding RNAs may act as competitive ceRNAs to play the sponge role of miRNAs, thus regulating the expression level of miRNA targets (Dawson, Harris, & Powell, 1990). Among them, the lncRNA, as a ceRNA, participates in the regulation of gene expression and varying biological processes, thereby promoting or inhibiting the occurrence and development of tumors, which is also relatively clear at present (Sterner, 1989; Zou et al., 2016). In prostate cancer, for example, lncRNA‐ROR can inhibit cell proliferation and invasion by adsorbing miR‐145 to upregulate the expression of downstream target genes (Liu et al., 2017). In breast cancer, lncRNA MIAT, as a ceRNA molecular sponge, competitively combines with miR‐155‐5p to achieve modulation of the expression of DUSP7 and promote the development of breast cancer (Luan et al., 2017). In lung cancer, it has also been reported that the lncRNA can be used as a ceRNA to modulate the expression of its target genes through interaction with miRNAs, thus participating in the development process of NSCLC (Li, Li, Yang, & Kang, 2018).In this study, it was found that lncRNA NORAD was markedly highly expressed in NSCLC tissues and had a close relationship to tumor migration and staging. The expression of NORAD in A549 and H460, lung cancer cell lines, was elevated so as to further investigate the possible role of NORAD in lung cancer, and the CCK‐8 and Transwell assay were conducted to determine its effects on cell proliferation and migration. The results showed that NORAD significantly promoted cell proliferation and migration, suggesting that NORAD may be involved in the pathogenesis of lung cancer.In order to further investigate the potential mechanism of action of NORAD, the bioinformatics analysis was performed, which revealed that miR‐656‐3p was its potential target gene. Additionally, it was confirmed by the dual‐luciferase reporter gene assay results that there was a binding relationship between the two, so it was speculated that NORAD also performed its role as a ceRNA. To verify this speculation, the expression of miR‐656‐3p in lung cancer was measured at first, which demonstrated that miR‐656‐3p exhibited an evident low expression in lung cancer tissues. After the NORAD expression was upregulated or downregulated, the expression of miR‐656‐3p was detected, and it was found that NORAD could notably modulate the expression of miR‐656‐3p. Subsequently, the expressions of miR‐656‐3p and NORAD in cells were simultaneously elevated. Functional experiments indicated that upregulating miR‐656‐3p could partially impede the promotion of NORAD on cell proliferation and migration, which also confirmed the abovementioned speculation.In this study, it was confirmed that AKT1 was the target gene of miR‐656‐3p, and miR‐656‐3p regulated the expression of AKT1, a member of the AKT (serine/threonine protein kinase) family (Weis & Hatton, 1989). At present, there are more and more studies revealing that AKT1 plays a crucial role in tumors. For instance, in breast cancer and prostate cancer, the activation of AKT1 can stimulate the proliferation of tumor cells, but at the same time it can suppress the migration ability of these cells (Gao, Alwhaibi, Artham, Verma, & Somanath, 2018; Riggio et al., 2017). This urges us to further explore what role AKT1 plays in lung cancer. Torsion experiments denoted that elevating the AKT1 expression could promote cell proliferation and migration and partially alleviate the miR‐656‐3p's inhibition on cell proliferation and migration, indicating that miR‐656‐3p may exert an effect by downregulating the AKT1 expression. According to the speculation, NORAD upregulates the expression of downstream target genes by adsorbing miR‐656‐3p. For verification, the expression level of AKT1 was examined after the NORAD expression in A549/H460 cells was upregulated. Based on the results, AKT1 expression was markedly increased at the mRNA and protein levels, which also verifies the above speculation.
CONCLUSION
To sum up, it was found in this study that lncRNA NORAD could stimulate the proliferation and migration of NSCLC cells, and its mechanism was probably to adsorb and downregulate the miR‐656‐3p expression, thus upregulating the expression of AKT1, its downstream gene. This study not only provides a new idea for investigating the mechanism of NSCLC, but also provides a new perspective for its prevention and treatment.
CONFLICT OF INTEREST
None declared.Click here for additional data file.