| Literature DB >> 31172301 |
Chen Wang1, Qinglian Wang2, Xudong Zhu3, Menjie Cui3, Haifeng Jia3, Wenying Zhang3, Wei Tang3, Xiangpeng Leng3, Wenbiao Shen4.
Abstract
miRNA156 family members (miR156s) participate in regulating the transition of plant vegetative and reproductive growth, flower development, and formation of berry skin color by negatively modulating their target gene SPLs. However, the evolution and functional diversification of miR156s in plants remain elusive. Phylogenetic analysis on 310 miR156s from 51 plant species on miRBase 21.0 showed that only miR156a could be conserved in the 51 plant species, but their sequences exhibited variation; another set of miR156s, such as miR156m/n/o/p/q/r/s/t/u/v/w/x/y/z, was identified only in certain special plant species (Glycine max and Malus); also, all base variations in the sequences of 310 miR156s occurred within one miR156 seed sequence, "TGACAGAAGAGAGTGAGCAC," and the changed base sites were mainly located at the 11th and 14th bases from the 5' end of the miR156 seed sequence, in which some base variations of miR156s resulted in a difference in miR156 targeting modes; by contrast, miR156 precursor sequences are highly divergent across diverse species. Similarly, cis-regulatory motifs on the promoter sequence of MIR156s in various plants also exhibited significant discrepancy. The intragenic MIR156 genes overlapped their target SBP genes, thereby suggesting that some microRNAs (miRNAs) originate from duplication of target genes. These traits might be the reasons of the conservation and diversification of miR156 gene family. This study identified the conserved seed sequence "TGACAGAAGAGAGTGAGCAC," and the sequence variation characterization, of miR156 family evolution, also investigated the varied traits of their promoters, precursors, and mature sequences in sequence evolutions and found some miRNAs might originate from duplication of target genes. Our findings will contribute to our understanding of the functional diversification of miRNAs and the interactions of miRNA/target pairs based on the evolutionary history of miRNA genes.Entities:
Keywords: Cis-regulatory motifs; Conservation; Evolution; SPL; miR156
Mesh:
Substances:
Year: 2019 PMID: 31172301 DOI: 10.1007/s10142-019-00679-y
Source DB: PubMed Journal: Funct Integr Genomics ISSN: 1438-793X Impact factor: 3.410