Literature DB >> 31061419

Selection of reference genes for qPCR normalization in buffalobur (Solanum rostratum Dunal).

Dandan Zhao1, Xu Wang1, Jingchao Chen1, Zhaofeng Huang1, Heqiang Huo2, Cuilan Jiang1, Hongjuan Huang3, Chaoxian Zhang1, Shouhui Wei4.   

Abstract

Buffalobur (Solanum rostratum Dunal), which belongs to the Solanaceae family, is a worldwide noxious invasive weed and is listed as one of the top 10 alien invasive species in China. It is harmful to humans and livestock because the entire plant is covered with spines containing toxins. Many studies have analysed the gene expression in this weed species under different stress conditions using quantitative real-time PCR (qPCR). However, until now, there has been no report on suitable reference genes in buffalobur. Herein, 14 candidate reference genes were selected and evaluated for their expression stability in buffalobur in different tissues, at different developmental stages, and in response to several stress conditions using the geNorm, NormFinder, BestKeeper and RefFinder statistical algorithms. The results showed that EF1α, ACT and SAND are suitable reference genes across all samples tested. We recommend the normalization of target gene expression under different experimental conditions using these three genes together. Validation of selected reference genes was achieved by assessing the relative expression levels of P5CS and GI. This work identified the appropriate reference genes for transcript normalization in buffalobur, which will be helpful in future genetic studies of this invasive weed.

Entities:  

Mesh:

Year:  2019        PMID: 31061419      PMCID: PMC6502881          DOI: 10.1038/s41598-019-43438-6

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


Introduction

Buffalobur (Solanum rostratum Dunal) is native to North America and is ranked as a highly invasive weed species across the world[1]. Buffalobur poses a serious threat to local biodiversity and agro-ecosystems. The aggressive growth of this weed results in devastating damage to crop production[2]. Additionally, buffalobur is a crucial intermediate host for a wide range of pests and diseases, which threaten the health of crops[3]. Moreover, this weed species is harmful to humans and livestock because its leaves, stems and calyx are covered with spines containing toxins[3]. Eradication of this weed using conventional control measures including manual, mechanical, or chemical methods is difficult. Therefore, new and innovative approaches are being explored to control this weed. Measuring gene expression will help form weed-control approaches, and quantitative gene expression measurement requires appropriate reference genes. Due to its advantages of high sensitivity and specificity, qPCR has been widely used to quantify gene expression to discover the genetic basis of physiological patterns during the plant life cycle[4]. Attaining precision in qPCR-based analysis depends on the selection of a suitable reference gene in experimental sets[5]. The expression level of the appropriate internal control gene should remain relatively constant and should not change significantly across experimental conditions, types of tissues, developmental stages or stress treatments[6,7]; however, in practice, no gene exhibits fully stable expression throughout all growth stages and experimental conditions. It has been suggested that multiple reference genes can achieve accurate normalization[8]. There is general agreement that the expression stability of candidate genes should be validated prior to initiating normalization studies using qPCR in a particular species. There have been studies on the selection and validation of reference genes in many Solanaceae plants, such as pepper (Capsicum annuum L.)[9], potato (Solanum tuberosum L.)[10], eggplant (Solanum melongena L.)[11], tomato (Lycopersicon esculentum Mill.)[12], Lycium barbarum L. and L. ruthenicum Murray[13]. However, until now, no appropriate reference gene has been identified for qPCR analysis in buffalobur. In this study, 14 genes, namely, GAPDH, ACT, GR, UBQ, TIP41, RPL8, eIF, DNAJ, TUB, CYP, EF1α, PP2Acs, RUBP, and SAND, were selected as candidate reference genes for buffalobur. The expression stabilities of these genes were tested with respect to different developmental periods, tissues, abiotic stresses, and hormone stimuli and with glyphosate treatment using geNorm[8], NormFinder[14], BestKeeper[15] and RefFinder[16] to identify the most stable gene for qPCR normalization in buffalobur.

Results

Expression profiles of candidate reference genes

The quantification cycle values (Cq) of the 14 candidate genes across all samples ranged from 11.8 to 30.8, showing a wide range of variation (Fig. 1). The majority of values were between 18 and 23. The Cq values of TIP41 and RUBP ranged from 18.8 to 30.8 and from 11.8 to 28.3, respectively, showing great expression differences. Moreover, the Cq values of RUBP in roots were relatively high. According to the Cq values, we can make a preliminary judgement that TIP41 and RUBP might not be suitable candidate reference genes.
Figure 1

Cq values of 14 reference genes across all samples. The box plots represent the interquartile range, the median, and the maximum and minimum values of each reference gene in all buffalobur samples.

Cq values of 14 reference genes across all samples. The box plots represent the interquartile range, the median, and the maximum and minimum values of each reference gene in all buffalobur samples.

geNorm analysis

The geNorm software identifies the optimal reference gene pair; smaller M values correlate with more stable gene expression. Some studies have established the threshold of M values ≤ 1.0 or 1.5 to identify appropriate reference genes[17]. M values below 0.5 are indicative of strong reference genes. Except for the group of total samples (M = 0.527), the M values of the best pairs in other groups were less than 0.5 in our study (Tables 2, 3 and 4; see Supplementary Fig. S1). For leaves of different developmental stages and different tissues in the fruiting period, the best two gene pairs were eIF and SAND. RPL8 and EF1α were the most stable gene pair in both the abiotic stress and glyphosate group. For the hormone stimuli group, the best gene pairs were ACT and RPL8. For the total samples group, the best gene pairs were ACT and PP2Acs. TIP41, RUBP and DNAJ were low-ranking candidates according to geNorm.
Table 2

Gene expression stability ranked by four algorithms for the “Developmental stages” and “Tissues” groups.

GroupRankgeNormNormFinderBestKeeperRefFinder
GeneStabilityGeneStabilityGeneSD [±Cq]CV (%Cq)GeneStability
Developmentalstagesa1 eIF 0.343 ACT 0.084 GR 0.301.24 ACT 2.11
2 SAND 0.343 EF1α 0.124 ACT 0.331.80 EF1α 2.51
3 UBQ 0.411 GR 0.185 PP2Acs 0.381.73 GR 2.82
4 EF1α 0.530 PP2Acs 0.287 CYP 0.442.51 SAND 3.66
5 ACT 0.576 CYP 0.295 EF1α 0.482.70 PP2Acs 4.56
6 PP2Acs 0.610 SAND 0.359 SAND 0.582.45 CYP 5.03
7 GR 0.654 UBQ 0.425 UBQ 0.613.10 eIF 5.20
8 CYP 0.686 GAPDH 0.455 GAPDH 0.693.74 UBQ 5.86
9 GAPDH 0.715 eIF 0.522 eIF 0.763.52 GAPDH 7.97
10 RPL8 0.747 RPL8 0.564 RPL8 0.834.03 RPL8 10.00
11 TUB 0.794 TUB 0.714 RUBP 0.886.73 TUB 11.24
12 TIP41 0.929 TIP41 1.040 TUB 1.115.49 TIP41 12.24
13 RUBP 1.039 RUBP 1.048 TIP41 1.145.20 RUBP 12.47
14 DNAJ 1.260 DNAJ 1.724 DNAJ 1.999.98 DNAJ 14.00
Tissuesb1 eIF 0.413 SAND 0.166 PP2Acs 0.401.89 SAND 1.57
2 SAND 0.413 PP2Acs 0.181 SAND 0.451.94 PP2Acs 1.93
3 CYP 0.459 CYP 0.289 CYP 0.543.07 eIF 2.51
4 EF1α 0.532 eIF 0.364 GR 0.562.26 CYP 3.22
5 RPL8 0.574 ACT 0.579 eIF 0.673.21 EF1α 6.45
6 GAPDH 0.601 GAPDH 0.619 UBQ 0.683.88 GAPDH 6.51
7 PP2Acs 0.636 UBQ 0.640 ACT 0.724.14 ACT 6.85
8 UBQ 0.732 GR 0.643 EF1α 0.875.00 UBQ 7.20
9 ACT 0.792 EF1α 0.657 TUB 1.015.17 GR 7.52
10 GR 0.843 RPL8 0.726 GAPDH 1.045.74 RPL8 8.39
11 TUB 0.943 TUB 0.943 RPL8 1.065.11 TUB 10.46
12 TIP41 1.084 TIP41 1.206 DNAJ 1.528.05 TIP41 12.24
13 DNAJ 1.330 DNAJ 1.483 TIP41 1.667.70 DNAJ 12.74
14 RUBP 1.936 RUBP 3.812 RUBP 3.8520.82 RUBP 14.00

aThe fully expanded leaves were harvested at different developmental stages. bDifferent tissues were harvested in the fruiting period.

Table 3

Gene expression stability ranked by four algorithms for the “Abiotic stresses”, “Hormone stimuli” and “Glyphosate” groups.

GroupRankgeNormNormFinderBestKeeperRefFinder
GeneStabilityGeneStabilityGeneSD [±Cq]CV (%Cq)GeneStability
Abioticstresses1 RPL8 0.355 EF1α 0.123 EF1α 0.422.43 EF1α 1.00
2 EF1α 0.355 TUB 0.175 TUB 0.492.57 RPL8 2.63
3 ACT 0.413 ACT 0.201 PP2Acs 0.512.25 TUB 2.83
4 TUB 0.454 RPL8 0.207 RPL8 0.562.82 ACT 3.22
5 PP2Acs 0.489 PP2Acs 0.245 SAND 0.562.35 PP2Acs 4.40
6 SAND 0.568 GR 0.442 ACT 0.573.06 SAND 5.96
7 GR 0.647 SAND 0.444 RUBP 0.695.13 GR 6.96
8 RUBP 0.721 RUBP 0.585 GR 0.783.21 RUBP 7.97
9 CYP 0.780 CYP 0.605 eIF 0.854.07 CYP 8.97
10 GAPDH 0.865 eIF 0.780 CYP 0.864.89 eIF 9.97
11 eIF 0.958 GAPDH 0.880 GAPDH 1.206.47 GAPDH 10.74
12 UBQ 1.069 UBQ 1.056 DNAJ 1.246.45 UBQ 12.24
13 TIP41 1.180 DNAJ 1.211 UBQ 1.266.73 DNAJ 13.22
14 DNAJ 1.283 TIP41 1.225 TIP41 1.476.38 TIP41 13.49
Hormonestimuli1 ACT 0.250 SAND 0.061 SAND 0.180.78 SAND 1.78
2 RPL8 0.250 EF1α 0.077 EF1α 0.201.22 EF1α 1.86
3 EF1α 0.264 ACT 0.139 UBQ 0.281.42 ACT 2.82
4 GAPDH 0.281 UBQ 0.143 eIF 0.291.41 RPL8 3.50
5 SAND 0.300 RPL8 0.189 TUB 0.311.62 UBQ 4.12
6 UBQ 0.314 TUB 0.216 RPL8 0.341.78 TUB 6.19
7 TUB 0.348 GAPDH 0.224 ACT 0.351.92 GAPDH 6.56
8 eIF 0.374 eIF 0.254 GR 0.361.46 eIF 6.73
9 PP2Acs 0.393 PP2Acs 0.262 PP2Acs 0.371.66 PP2Acs 9.00
10 CYP 0.418 CYP 0.274 CYP 0.402.37 CYP 10.00
11 GR 0.443 GR 0.341 GAPDH 0.402.25 GR 10.16
12 RUBP 0.484 RUBP 0.413 RUBP 0.493.57 RUBP 12.00
13 DNAJ 0.586 DNAJ 0.804 DNAJ 0.774.01 DNAJ 13.00
14 TIP41 0.697 TIP41 0.906 TIP41 0.813.56 TIP41 14.00
Glyphosate1 RPL8 0.363 TUB 0.088 PP2Acs 0.261.17 ACT 2.06
2 EF1α 0.363 ACT 0.129 SAND 0.301.31 EF1α 2.51
3 ACT 0.436 RPL8 0.134 ACT 0.311.67 RPL8 3.00
4 GAPDH 0.489 CYP 0.184 EF1α 0.462.67 TUB 4.12
5 CYP 0.518 EF1α 0.194 CYP 0.492.73 PP2Acs 4.30
6 TUB 0.544 GAPDH 0.306 GR 0.522.11 CYP 4.47
7 PP2Acs 0.611 PP2Acs 0.369 eIF 0.562.75 SAND 5.03
8 SAND 0.648 SAND 0.425 TUB 0.602.99 GAPDH 6.78
9 GR 0.687 GR 0.591 RPL8 0.613.05 GR 8.13
10 eIF 0.756 UBQ 0.668 UBQ 0.643.41 eIF 9.59
11 UBQ 0.792 eIF 0.701 GAPDH 0.673.58 UBQ 10.24
12 DNAJ 0.971 RUBP 1.299 DNAJ 1.397.28 RUBP 12.49
13 RUBP 1.156 DNAJ 1.437 RUBP 1.7811.51 DNAJ 12.49
14 TIP41 1.484 TIP41 2.338 TIP41 2.7110.45 TIP41 14.00
Table 4

Gene expression stability ranked by four algorithms for the total samples group.

RankgeNormNormFinderBestKeeperRefFinder
GeneStabilityGeneStabilityGeneSD [±Cq]CV (%Cq)GeneStability
1 ACT 0.527 EF1α 0.275 SAND 0.492.07 EF1α 1.68
2 PP2Acs 0.527 ACT 0.393 EF1α 0.512.95 ACT 1.86
3 SAND 0.712 SAND 0.412 ACT 0.583.16 SAND 2.28
4 EF1α 0.742 RPL8 0.454 PP2Acs 0.602.67 PP2Acs 3.36
5 RPL8 0.810 TUB 0.462 GR 0.602.43 RPL8 5.14
6 GR 0.853 CYP 0.466 TUB 0.693.57 GR 5.96
7 CYP 0.879 GR 0.470 RPL8 0.703.51 TUB 6.62
8 TUB 0.907 PP2Acs 0.482 eIF 0.723.43 CYP 7.17
9 GAPDH 0.937 eIF 0.643 CYP 0.734.17 eIF 8.97
10 eIF 0.977 GAPDH 0.654 GAPDH 0.935.08 GAPDH 9.74
11 UBQ 1.051 UBQ 0.907 UBQ 1.055.60 UBQ 11.00
12 DNAJ 1.179 TIP41 1.564 DNAJ 1.246.46 DNAJ 12.00
13 TIP41 1.370 DNAJ 1.173 TIP41 1.757.57 TIP41 13.00
14 RUBP 1.644 RUBP 2.162 RUBP 1.8312.51 RUBP 14.00
Additionally, geNorm provides the pairwise variation (Vn/Vn+1), which determines the minimal number of reference genes to obtain an accurate and reliable normalization. A value of 0.2 is usually considered acceptable. For the total samples group, the V3/4 value of 0.186 indicated that the top three reference genes (ACT, PP2Acs and SAND) would be appropriate to use for normalization; for the other groups, the top two genes were sufficient for normalization because their V2/3 values were all less than 0.15 (see Supplementary Fig. S2).

NormFinder analysis

The lower the stability value obtained via NormFinder, the more stable the candidate reference gene is. A grouped analysis can be used to evaluate these candidate reference genes with this statistical algorithm. The output includes the best reference gene and the best combination of two reference genes (Tables 2, 3 and 4; see Supplementary Table S3). Notably, the ranking alone cannot identify whether a candidate gene is good, the stability values need to be considered for the assessment. Only when the stability value is low enough, the gene can be considered good. In our study, for leaves of different developmental stages (grouped by stage), the best gene was ACT (0.111), and the best combination of genes was GR and eIF with a stability value of 0.082. For different tissues in the fruiting period (grouped by tissue), SAND (0.121) was the best reference gene, and the best pair was GR and PP2Acs (0.084). ACT (0.114) was ranked the top gene for glyphosate-treated samples (grouped by time), and eIF and CYP were the best combination with a stability value of 0.079. For abiotic stress-treated samples (grouped by stress type), the best gene was EF1α (0.051), and the best combination of two genes was TUB and EF1α (0.036). For samples of hormone stimuli (grouped by ABA and GA), EF1α (0.019) was also the best reference gene, and EF1α and SAND (0.015) formed the best gene pair. For the total samples (grouped by subgroup), the top three genes were EF1α (0.065), ACT (0.065) and TUB (0.072); the best combination of two genes was GAPDH and SAND with a stability value of 0.046. The ranking of candidate reference genes and best combination of two genes from NormFinder were not identical to those from the geNorm analysis (Tables 2, 3 and 4).

BestKeeper analysis

Pfaffl proposed that genes with high SD or CV values can be considered inconsistent[15]. In general, a gene with an SD value greater than 1 is not acceptable(Tables 2, 3 and 4). For leaves of different developmental stages, GR was the optimal reference gene with an SD value of 0.30. For different tissues in the fruiting period and the group with glyphosate treatment, PP2Acs (SD values of 0.40 and 0.26, respectively) was the most stable gene. For the abiotic stress group, EF1α (an SD value of 0.42) was the most stable of the candidate reference genes. For the hormone treatment and total samples group, BestKeeper ranked SAND as the best reference gene with SD values of 0.18 and 0.49, respectively.

RefFinder analysis

The stability rankings generated by geNorm, NormFinder and BestKeeper, which are based on different algorithms, differed; but in most cases the 3 or 4 same genes were ranked highly, just in different orders. We used RefFinder to obtain a final ranking based on the outputs of the previous three methods (plus Delta-Ct) (Tables 2, 3 and 4). For leaves of different developmental stages and the glyphosate treatment group, the best gene was ACT followed by EF1α. For different tissues in the fruiting period, the suitable reference genes were SAND and PP2Acs. For the abiotic stress groups, the top two genes were EF1α and RPL8. SAND and EF1α were the most stable genes in the leaves of hormone treatment groups. For the total samples group, the most stable three reference genes were EF1α, ACT and SAND. RUBP, DNAJ and TIP41 had unstable expression in all of the groups.

Reference gene validation

Delta 1-pyrroline-5-carboxylate synthetase (P5CS) is the rate-limiting enzyme in the proline synthesis pathway under stress conditions[18]. GIGANTEA (GI) participates in multiple molecular regulatory responses including flowering, circadian rhythm and stress tolerance[19]. The elevated expression of P5CS and GI improves resistance against salinity and drought stresses. Therefore, P5CS and GI expression should increase or hold stable rather than decrease. Previous studies found that the Arabidopsis thaliana gi mutant is resistant to herbicide[20], indicating that lower expression of GI indicates stronger herbicide tolerance. As shown in Figs 2 and 3, the expression patterns of P5CS and GI were significantly different when using the best reference gene combination for normalization under different stress conditions than when normalized with the least stable reference gene. With the best gene combination, the P5CS level at 72 h was 2.2-fold higher than in the untreated sample; with the least stable reference gene, the expression at 72 h was 475-fold higher than in the untreated sample (Fig. 2). Using the stable gene combination, the expression level of GI decreased significantly within 48 h of glyphosate treatment, which is consistent with the expected pattern; while using the worst reference gene, its expression dramatically increased (Fig. 3).
Figure 2

The relative expression patterns of P5CS under different treatments and with normalization to different reference genes. (a) Glyphosate treatment, (b) drought treatment, (c) salinity treatment, (d) heat treatment, (e) cold treatment, (f) ABA treatment, and (g) GA treatment. The error bars represent the standard error.

Figure 3

Relative expression of GI under different treatments and with normalization to different reference genes. (a) Glyphosate treatment, (b) drought treatment, (c) salinity treatment, (d) heat treatment, (e) cold treatment, (f) ABA treatment, and (g) GA treatment. The error bars represent the standard error.

The relative expression patterns of P5CS under different treatments and with normalization to different reference genes. (a) Glyphosate treatment, (b) drought treatment, (c) salinity treatment, (d) heat treatment, (e) cold treatment, (f) ABA treatment, and (g) GA treatment. The error bars represent the standard error. Relative expression of GI under different treatments and with normalization to different reference genes. (a) Glyphosate treatment, (b) drought treatment, (c) salinity treatment, (d) heat treatment, (e) cold treatment, (f) ABA treatment, and (g) GA treatment. The error bars represent the standard error. In the drought, salinity or abscisic acid (ABA) treatment groups, the expression of P5CS and GI increased or decreased slightly when using the best reference gene combinations for normalization, and the values ranged from 0.4 to 1.5; when using the least stable reference genes, these expressions decreased by 4 to 30-fold (Figs 2 and 3). The expression patterns of P5CS and GI normalized by stable reference gene combinations were more in line with the expectations than when they were normalized with the least stable reference genes. For the heat, cold and gibberellin (GA) stress groups, the expression of P5CS and GI ranged from 0.3 to 1.5 when normalized with the best reference gene combination; the expression normalized by the worst reference genes increased 3 to 40-fold (Figs 2 and 3). For the relative expression of P5CS or GI, the coefficients of variation (CV (%)) using the poor reference genes were much higher than those produced by using the best gene combinations (see Supplementary Table S4). This indicates that the normalization with stable reference genes lowers the variability of the raw data, so the selected stable reference genes are acceptable. In our study, the expression normalized with the least stable reference genes DNAJ and TIP41 deviated dramatically from those normalized with the best gene combination. DNAJ, a molecular chaperone, responds to stress and maintains protein homeostasis in plant cells[21]. DNAJ rises sharply in response to stress, as observed in Figs 2 and 3. Similarly, TIP41 responds to abiotic stresses via the TOR signalling pathway[22]. Under stress conditions, the acute decrease in TIP41 levels results in unreasonably higher normalized expression values (Figs 2 and 3).

Discussion

Buffalobur (Solanum rostratum Dunal) is a worldwide noxious invasive weed, and it ranked as one of the top 10 alien invasive species in China[1]. Many studies have focused on understanding the physiological characteristics of this weed, including seed germination and seedling emergence[23]. For genetic research, it is necessary to select stable reference genes to ensure the accuracy of research results. In this study, three software packages and one web tool were used to test the statistical reliability of candidate reference genes. Notably, the different algorithms evaluating the expression stability of reference genes generated different stable genes due to their different mathematical calculations. One disadvantage of geNorm is that it is likely to select coregulated genes with similar expression profiles, such as genes in the same functional class. When groups are specified, NormFinder considers the inter- and intragroup variations for normalization factor calculation and eliminates artificial selection of coregulated gene values; however, it cannot exclude systematic errors generated from sample preparation[14]. For BestKeeper, input data derived from more than three candidate genes are required for accurate assessment of the stability of each gene[15]. Based on different calculation principles, the stability rankings of three statistical packages were different. RefFinder considers four statistical approaches (geNorm, NormFinder, BestKeeper and Delta-Ct); therefore, we used RefFinder to obtain a comprehensive ranking of gene expression stability. In our study, the combination of EF1α, ACT (β-actin) and SAND was sufficient to normalize expression levels of target genes in the total samples group. Therefore, it is recommended that EF1α, ACT and SAND should be used together for normalization in various buffalobur experimental samples. ACT, which is a cytoskeleton component and cell division regulator[24], is the most stable gene in leaves of different developmental stages and glyphosate-treated leaves (Tables 2 and 3). ACT is also stably expressed in Hordeum vulgare L.[25]. In Descurainia sophia, actin 7 (ACT7) is suitable in most samples under different conditions, and actin 8 (ACT8) is the least stable reference gene[26]. SAND is the most stable reference gene for different tissues in the fruiting period and in hormone-stimulated leaves (Tables 2 and 3). Similarly, SAND is stable in different tomato tissues[12]. In Stellera chamaejasme and Robinia pseudoacacia L., SAND levels are stable under ABA and drought treatments, respectively[27,28]. In Peucedanum praeruptorum Dunn, SAND and actin 2 (ACT2) are the top two most stable reference genes under abiotic stress and hormone treatments and in different tissues[29]. EF1α, which participates in the elongation cycle of protein biosynthesis, is the most stable gene for leaves under abiotic stress or hormone stimulation (Tables 2 and 3). In potato, the expression of EF1α has been used to normalize expression levels across cold, salt and late blight stresses[10]; in drought and simulated drought environments, EF1α performs best out of candidate reference genes[30]. In tomato, EF1α is the top-ranked reference gene during N and cold stress[31]. However, for hormone stimuli, EF1α ranks behind other candidates in Diospyros kaki Thunb and Hibiscus cannabinus L.[32,33]. These results suggest that evaluation of reference gene expression stability is indispensable prior to the analysis of target gene expression under specific experimental conditions. Buffalobur is closely related to tomato, whose qPCR reference genes have been reported in numerous studies[12,34]. TIP41 has exhibits highly stable expression in different tissues (root, leaves, and inflorescence) at different developmental stages in tomato[12]; however, in buffalobur, it ranks behind other reference genes in different tissues of the fruiting period and leaves of different developmental stages (Table 2). It showed that reference genes used in tomato might not be suitable in genetically related species. Our results here further emphasize the importance of species-specific screening of proper reference genes because genetic difference, even in closely related species, may contribute to distinct and variable expression of these genes under the same experimental conditions. P5CS is stress-responsive as it is involved in the synthesis of key enzymes in the proline synthesis pathway[18]. GI participates in developmental processes such as plant flowering, but it is also involved in mediating cold stress and salt stress responses[19]. Under stress conditions such as salinity, drought and ABA, the expression of P5CS and GI are expected to increase or hold stable rather than decrease to help plants adapt to the negative conditions. In our research, the P5CS or GI expression levels normalized using the best reference gene combination were significantly different from those normalized with the least stable reference gene (Figs 2 and 3). With the best gene combination for normalization, the expression of P5CS and GI were only slightly different before and after stresses; with the least stable reference gene, P5CS and GI expression rose or fell sharply (Figs 2 and 3). Therefore, the reference genes selected in this study are reliable. In summary, 14 candidate reference genes were first selected under different treatments in buffalobur. For leaves of different developmental stages and leaves of glyphosate-treated plants, the best reference genes are ACT and EF1α. For different tissues in the fruiting period, the most stable gene pair is SAND and PP2Acs. EF1α and RPL8 are the most stable reference genes for the abiotic stress group. EF1α and SAND are suitable reference genes for the hormone stimuli group. For the total samples group, the EF1α, ACT and SAND triplet should be used as reference genes for normalization. This study will facilitate the study of gene expression analysis in buffalobur, which might lay a fundamental path for exploring the molecular mechanism underlying its developmental regulation and for effectively controlling this invasive weed species.

Materials and Methods

Plant materials and stress treatments

Buffalobur seeds were collected from the Miyun District (N40.24.082, E116.50.364), Beijing, China, in 2017. Seeds were sown in pots (11 cm diameter) filled with Pindstrup substrate (SIA Pindstrup, Balozi, Latvia) and grown in chambers under a 14 h light/10 h dark photoperiod with 300 μmol·m−2·s−1 of light intensity at 30 ± 2 °C. When the seedlings were at the 5-leaf stage, they were subjected to three types of stress treatments including abiotic stress (drought, salinity, cold, and heat), hormone stimuli (ABA and GA) and herbicide treatment (glyphosate) (Table 5). For salt or drought treatments, approximately 150 mL of NaCl (300 mM) or 20% PEG-6000 was applied to irrigate the plants; for cold or heat treatments, the plants were transferred to chambers at a temperature of 4 °C or 40 °C under the same photoperiod and light intensity as previously specified; for hormone treatment, the leaves were sprayed with 0.35 mM ABA (Sinopharm Chemical Reagent Co., Ltd., Shanghai, China) or 0.35 mM GA (Sinopharm Chemical Reagent Co., Ltd., Shanghai, China); and for glyphosate treatment, 1680 g ae ha−1 of glyphosate (Roundup, isopropylamine salt of glyphosate, 410 g ae L−1, Monsanto Company, St. Louis, USA) was sprayed on the leaves. The fifth leaves were collected at 0 (untreated), 24, 48 and 72 h after treatment. Three independent biological replicates per treatment were collected, immediately frozen in liquid nitrogen and stored at −80 °C until RNA extraction.
Table 5

The summary of samples collected under different conditions in this study.

Stress treatmentsaTimes after treatment
0 hb (N = 3)24 h (N = 3)48 h (N = 3)72 h (N = 3)
Abiotic StressesDrought
Salt
Cold
Heat
Hormone stimuliABA
GA
Glyphosate
Tissues c
RootsStemsThe 7th leavesPetalsPericarps
Periods d
Cotyledon stageSeedling stageVegetative stageFruiting period

aThe 5th leaves were harvested at different time under different kinds of stresses. Three samples were taken at each time point for biological replicates. For the “Drought”, “Salt”, “Cold”, “Heat”, “ABA”, “GA” and “Glyphosate” groups, and each group contains 12 samples (four timepoints, and 3 samples for each timepoint); The “Abiotic Stresses” and “Hormone stimuli” groups contain 48 and 24 samples, respectively. bLeaves without stress treatment were harvested. cDifferent tissues were harvested in the fruiting period. Three samples were taken from each tissue for biological replicates. dThe fully expanded leaves were harvested at different developmental stages. Three samples were taken at each period for biological replicates.

Developmental tissue samples

Buffalobur seeds were sown in pots and grown in chambers under the conditions mentioned above. The leaves were collected at different developmental stages; the collected leaves included the cotyledons (cotyledon stage) and the fully expanded 3rd (seedling stage), 5th (vegetative stage) and 7th (fruiting period) leaves (Table 5). For different tissues in the fruiting period, the roots, stems (6 cm above the root), 7th leaves, petals (without stamens and pistils), and pericarps (with thorns) were collected (Table 5). Three independent biological replicates per treatment were collected, and the storage procedure was same as that for the stress-treatment samples.

RNA extraction and cDNA synthesis

Total RNA isolation was conducted using the common method described by Chen et al.[35]. The concentration and purity of total RNA were quantified using the NanoDrop™ One/OneC ultra trace UV spectrophotometer (ThermoFisher, Waltham, MA, USA). The A260/A280 values of the RNA samples ranged from 1.90 to 2.10. The RNA integrity was assessed using 1% agarose electrophoresis gels stained with Solargel Red nucleic-acid dyes (Solarbio, Beijing, China), and gels of all RNA samples exhibited sharp and intense bands for 28S and 18S (see Supplementary Fig. S5). cDNA synthesis was performed with 800 ng of total RNA in a final volume of 20 μL using the same kit described by Chen et al., and the synthetic cDNA was stored at −80 °C until use[35].

Primer design and qPCR assay

Fourteen candidate reference genes (GAPDH, ACT, GR, UBQ, TIP41, RPL8, eIF, TUB, DNAJ, CYP, EF1α, PP2Acs, RUBP, and SAND) were selected for the stable expression assay, and the GenBank accession numbers of these genes are MG930815, MG930814, MG930816, MG930817, KT807935, KT807936, KT596731, KT807934, KT596730, MK181638, MK181640, MK181639, MK181641 and MK181642, respectively. The primers for qPCR were designed using the Oligo 7 software; information on the primers is presented in Table 1. Polymerase chain reaction (PCR) was performed to confirm the 14 candidate reference gene sequences, and the primers amplified a single correct target product without visible primer dimers (see Supplementary Fig. S6). The qPCR reactions were performed using the 7500 RealTime PCR System (Applied Biosystems, Waltham, MA, USA) for thermal cycling and SYBR Green detection chemistry (Applied Biosystems, CA, USA). The reaction mixtures and cycling conditions were based on the method described by Chen et al.[35]. A single peak was detected on the melting curve for each primer pair after qPCR, which further demonstrated the specificity of these primers (see Supplementary Fig. S7). To confirm the specificity of the primer pairs, the amplification efficiency (E) and correlation coefficient (R2) parameters were obtained from the standard curves using the common method[33]. The amplification efficiencies of 14 candidate reference genes ranged from 90.0% to 104.7%, and the correlation coefficients (R2) were between 0.990 and 0.998 (Table 1; see Supplementary Fig. S8).
Table 1

Information on the selected primer pairs and amplification characteristics of the 14 candidate reference genes and 2 target genes for buffalobur.

Gene symbolGene descriptionPrimer sequence F/RProduct length (bp)Efficiency (%)Correlation coefficient
GAPDH Glyceraldehyde-3-phosphate dehydrogenaseGCAGTCAACGATCCATTTATCTCCACTCAACAACGAACTCAGCACCAG203101.10.995
ACT β-actinGTGTTCCCTAGCATTGTTGGTCGGCCATATCTTCTCCATATCATCCCAGTTG17295.00.998
GR Glutaredoxin proteinGCTACTGAGGCTTCCAACAATAACGACCATAAATTAGCAAGAAAATCACAGAGGC9690.00.995
UBQ UbiquitinGCACTTCTTTTTCCTCTCATTCTCTCGATGCCTTCCTTGTCTTGAATCTTAGC16891.30.996
TIP41 Tonoplast intrinsic protein/aquaporinATCACCCCAGTTCACACCTTAGCGCCCCAACAACAAGCCCAGTTAG17091.40.994
RPL8 Ribosomal protein L8CAAATCCCACACCCACCACCGCAACACATTACCAACCATAAGACTAGC26090.40.994
eIF Eukaryotic initiation factorTGGTCACATCGTCATTAAAAATCGTCCTGGTATCATCAGTTGGGAGCCTCAAG27793.10.994
TUB β-tubulinGGTGTTACTTGCTGTTTGAGATTCCCTATCATCTGTTCATCTACCTCCTTTGTGC290104.70.990
DNAJ DnaJ-like protein (hsp40)GTTTCCGCCTCTTGCTCCACACCGCCGACGAATTTTGCTG19396.20.991
CYP CyclophilinTCAAGAAGGTGGAGGCTGTTGGGACAAGACCCGACCCAAGCA21198.60.998
EF1α Elongation factor 1-alphaCTGTGCTGTCCTGATTATTGACTCGGGGTGAAAGCAAGCAACGCA9890.60.995
PP2Acs A catalytic subunit of protein phosphatase 2AGCCAGTAAAAAGCCCTGTGACTACGCAAGCATTCATCATAGAACCCAT26797.70.997
RUBP Ribulose 1,5 bisphosphateGCAAAACACTGACATCACCTCCAATACAAATCCGTGCTCAGTCTCG20694.20.998
SAND SAND protein familyACTAGAGAATCGTCAGAGAGGTTTGCCGGAGTAACCCAGCACAGTAGA26791.60.997
P5CS Delta 1-pyrroline-5-carboxylate synthetaseAGTTCTGTTGAGTGATGTAGAGGGTCCCGATGAAAGAGGGTGCCGAT271100.90.995
GI GIGANTEAACACTACAACCGCCCGATTTTCCATAACACCGCCACACCAACG233104.70.998
Information on the selected primer pairs and amplification characteristics of the 14 candidate reference genes and 2 target genes for buffalobur. Gene expression stability ranked by four algorithms for the “Developmental stages” and “Tissues” groups. aThe fully expanded leaves were harvested at different developmental stages. bDifferent tissues were harvested in the fruiting period. Gene expression stability ranked by four algorithms for the “Abiotic stresses”, “Hormone stimuli” and “Glyphosate” groups. Gene expression stability ranked by four algorithms for the total samples group. The summary of samples collected under different conditions in this study. aThe 5th leaves were harvested at different time under different kinds of stresses. Three samples were taken at each time point for biological replicates. For the “Drought”, “Salt”, “Cold”, “Heat”, “ABA”, “GA” and “Glyphosate” groups, and each group contains 12 samples (four timepoints, and 3 samples for each timepoint); The “Abiotic Stresses” and “Hormone stimuli” groups contain 48 and 24 samples, respectively. bLeaves without stress treatment were harvested. cDifferent tissues were harvested in the fruiting period. Three samples were taken from each tissue for biological replicates. dThe fully expanded leaves were harvested at different developmental stages. Three samples were taken at each period for biological replicates.

Data analysis for expression stability

We chose three statistical software programs (geNorm[8], NormFinder[14], and BestKeeper[15]) and a web tool (RefFinder[16]) (http://150.216.56.64/referencegene.php?type=reference#) to evaluate the stability of 14 candidate reference genes. The analysis methods of these four programs were the same as those reported in other published articles[35]. geNorm identifies the best reference gene pair by calculating the value M[8]. The smaller the M value, the more stable the gene expression. Furthermore, geNorm also determines the optimal number of reference genes needed by calculating the pairwise variation (Vn/Vn+1)[35]. NormFinder evaluates gene expression stability via grouped analysis. The output is not simply the best gene but also the best combination of two genes. The value of expression stabilities derived from NormFinder is smaller, and the single reference gene is more stable. BestKeeper employs pair-wise correlation analysis of all pairs of candidate reference genes to estimate gene expression stability. Pfaffl considers genes with elevated SD or CV values inconsistent[15]. RefFinder generates a comprehensive ranking synthesized using the results of four algorithms (geNorm, NormFinder, BestKeeper and Delta- Ct).

Validation of reference genes

To validate the reliability of the obtained reference genes, the expression of two target genes—delta 1-pyrroline-5-carboxylate synthetase (P5CS) and GIGANTEA (GI)—under different experimental conditions was normalized using the combination of the two best reference genes and the most variable gene obtained via RefFinder (see Supplementary Tables S9, S10 and S11). The GenBank accession numbers of P5CS and GI are MK181643 and MK181644, respectively. Information on the primers for these two target genes is listed in Table 1. The expression levels of these two target genes normalized to the reference genes were analysed using the 2−ΔΔCt method[36]. We set up three biological and technical replicates in qPCR assays.
  2 in total

1.  Selection and validation of reference genes for quantitative real-time PCR of Quercus mongolica Fisch. ex Ledeb under abiotic stresses.

Authors:  Hao Zhan; Hanzhang Liu; Tianchong Wang; Lin Liu; Wanfeng Ai; Xiujun Lu
Journal:  PLoS One       Date:  2022-04-28       Impact factor: 3.752

2.  Evaluation of stable reference genes for qPCR normalization in circadian studies related to lung inflammation and injury in mouse model.

Authors:  Allan Giri; Isaac Kirubakaran Sundar
Journal:  Sci Rep       Date:  2022-02-02       Impact factor: 4.379

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.