| Literature DB >> 29632740 |
Xin Liu1,2, Huirui Guan1,2, Min Song1,2, Yanping Fu1,2, Xiaomin Han1,2, Meng Lei1,2, Jingyu Ren1,2, Bin Guo1,2, Wei He1,2, Yahui Wei1,2.
Abstract
BACKGROUND: Stellera chamaejasme Linn, an important poisonous plant of the China grassland, is toxic to humans and livestock. The rapid expansion of S. chamaejasme has greatly damaged the grassland ecology and, consequently, seriously endangered the development of animal husbandry. To draft efficient prevention and control measures, it has become more urgent to carry out research on its adaptive and expansion mechanisms in different unfavorable habitats at the genetic level. Quantitative real-time polymerase chain reaction (qRT-PCR) is a widely used technique for studying gene expression at the transcript level; however, qRT-PCR requires reference genes (RGs) as endogenous controls for data normalization and only through appropriate RG selection and qRT-PCR can we guarantee the reliability and robustness of expression studies and RNA-seq data analysis. Unfortunately, little research on the selection of RGs for gene expression data normalization in S. chamaejasme has been reported.Entities:
Keywords: Abiotic stresses; Hormone treatments; Reference gene; Stellera chamaejasme; Transcriptome; qRT-PCR
Year: 2018 PMID: 29632740 PMCID: PMC5888148 DOI: 10.7717/peerj.4535
Source DB: PubMed Journal: PeerJ ISSN: 2167-8359 Impact factor: 2.984
Description of candidate reference genes and target genes.
| Unigene gene ID | Accession number | Gene symbol | Gene name | Homolog locus | |
|---|---|---|---|---|---|
| >c73334.graph_c0 | AH001810 | 1e-105 | |||
| >c68075.graph_c0 | KJ634810 | 0.0 | |||
| >c71629.graph_c0 | Cyclophilin | JN032296 | 2e-123 | ||
| >c70757.graph_c0 | Elongation factor 1-beta | XM_013599463 | 9e-138 | ||
| >c67520.graph_c0 | Glyceraldehyde-3-phosphate dehydrogenase of plastid 1 | NM_106601 | 0.0 | ||
| >c74212.graph_c0 | Glyceraledehyde-3-phosphate dehydrogenase 2 | KM370884 | 0.0 | ||
| >c70711.graph_c1 | Malate dehydrogenase | HQ449567 | 0.0 | ||
| >c72957.graph_c1 | SAND family protein | NM_128399 | 0.0 | ||
| >c60567.graph_c0 | Alpha-tubulin 1 | AT1G64740 | 0.0 | ||
| >c65147.graph_c0 | Alpha-tubulin 6 | AT4G14960 | 0.0 | ||
| >c57696.graph_c0 | Delta 1-pyrroline-5-carboxylate synthetase 2 | AT3G55610 | 0.0 | ||
| >c73625.graph_c0 | GIGANTEA | KR813315 | 0.0 |
Selected candidate RGs and target genes, primers, and amplicon characteristics.
| Name | Forward primer sequences (5′–3′) | Amplicon size (bp) | Product Tm (°C) | ||
|---|---|---|---|---|---|
| CTATCCAGCGAAACCACAG | 122 | 81.5–82.0 | 1.918 | 0.996 | |
| TTGTTCGATAGCATCCGTCT | 170 | 78.0–78.5 | 1.836 | 0.997 | |
| ACATAGTTTGAGGCAACCTAGCAGT | 161 | 80.0 | 1.854 | 0.997 | |
| GCAGTGAACTCTCCCCAG | 191 | 78.0–79.0 | 1.842 | 0.998 | |
| CCATTAGATCCGTCGCCTGTT | 192 | 83.0–83.5 | 1.834 | 0.998 | |
| GTGAAACTGGTCTCCTGGTATG | 115 | 81.0 | 1.930 | 0.998 | |
| CCGCGACTTTGAATAAGCCCAT | 94 | 76.0–76.5 | 1.824 | 0.997 | |
| CCTGCCAAGATACAATCCCA | 267 | 80.0–80.5 | 1.872 | 0.997 | |
| GGCACTTTCGAGTTTTCGC | 97 | 79.0–79.5 | 1.840 | 0.998 | |
| GAAGGAATGGAGGAAGGGGAG | 165 | 81.5–82.5 | 1.837 | 0.997 | |
| TGACTTTATACGGTGGACCAA | 178 | 82.5–84.5 | 1.839 | 0.997 | |
| ATGATTACAGAAACGGAATTAACTCA | 112 | 79.5–81.0 | 1.858 | 0.994 |
Figure 1Distribution of Ct values for 10 candidate RGs across all S. chamaejasme samples.
Lines across the boxes denote the medians. The box represents the 25th and 75th percentile. The top and bottom whisker caps depict the maximum and minimum values, respectively. The white and black dots represent mean Ct values and potential outliers, respectively.
Figure 2Average expression stability value (M) and ranking of the 10 RGs across all treatments calculated using geNorm.
(A) Drought stress. (B) Cold stress. (C) Salt stress. (D) ABA treatment. (E) GA treatment. (F) ETH treatment. (G) All samples. The least stable genes are listed on the left, while the most stable genes are exhibited on the right.
Expression stability of 10 candidate reference genes calculated by NormFinder.
| Rank | Drought | Cold | Salt | ABA | GA | ETH | ALL |
|---|---|---|---|---|---|---|---|
| 1 | |||||||
| Stability | 0.025 | 0.015 | 0.089 | 0.071 | 0.075 | 0.048 | 0.028 |
| 2 | |||||||
| Stability | 0.052 | 0.018 | 0.089 | 0.072 | 0.075 | 0.051 | 0.031 |
| 3 | |||||||
| Stability | 0.069 | 0.060 | 0.237 | 0.109 | 0.096 | 0.135 | 0.032 |
| 4 | |||||||
| Stability | 0.074 | 0.076 | 0.284 | 0.159 | 0.103 | 0.149 | 0.065 |
| 5 | |||||||
| Stability | 0.245 | 0.238 | 0.319 | 0.188 | 0.323 | 0.150 | 0.130 |
| 6 | |||||||
| Stability | 0.316 | 0.385 | 0.371 | 0.201 | 0.358 | 0.207 | 0.163 |
| 7 | |||||||
| Stability | 0.326 | 0.481 | 0.447 | 0.255 | 0.414 | 0.251 | 0.185 |
| 8 | |||||||
| Stability | 0.405 | 0.523 | 0.726 | 0.401 | 0.754 | 0.359 | 0.294 |
| 9 | |||||||
| Stability | 0.615 | 0.586 | 1.286 | 0.516 | 0.836 | 0.486 | 0.357 |
| 10 | |||||||
| Stability | 0.999 | 1.093 | 1.748 | 1.272 | 0.965 | 0.497 | 0.556 |
Expression stability of 10 candidate reference genes calculated by BestKeeper.
| Rank | Drought | Cold | Salt | ABA | GA | ETH | ALL |
|---|---|---|---|---|---|---|---|
| 1 | |||||||
| CV ± SD | 0.52 ± 0.16 | 1.16 ± 0.31 | 1.35 ± 0.36 | 1.04 ± 0.27 | 0.82 ± 0.22 | 0.68 ± 0.18 | 0.53 ± 0.16 |
| 2 | |||||||
| CV ± SD | 0.89 ± 0.27 | 1.21 ± 0.37 | 1.88 ± 0.58 | 1.06 ± 0.29 | 1.02 ± 0.26 | 1 ± 0.26 | 0.82 ± 0.22 |
| 3 | |||||||
| CV ± SD | 1.07 ± 0.28 | 1.39 ± 0.41 | 1.93 ± 0.5 | 1.27 ± 0.32 | 1.76 ± 0.56 | 1.16 ± 0.35 | 0.91 ± 0.28 |
| 4 | |||||||
| CV ± SD | 1.24 ± 0.38 | 1.4 ± 0.36 | 2.1 ± 0.61 | 1.37 ± 0.39 | 1.78 ± 0.52 | 1.17 ± 0.35 | 0.93 ± 0.24 |
| 5 | |||||||
| CV ± SD | 1.27 ± 0.34 | 1.48 ± 0.38 | 2.38 ± 0.75 | 1.45 ± 0.43 | 1.81 ± 0.56 | 1.2 ± 0.33 | 0.99 ± 0.27 |
| 6 | |||||||
| CV ± SD | 1.71 ± 0.45 | 1.77 ± 0.52 | 2.39 ± 0.74 | 1.76 ± 0.45 | 1.9 ± 0.51 | 1.21 ± 0.36 | 1.1 ± 0.33 |
| 7 | |||||||
| CV ± SD | 1.86 ± 0.52 | 1.87 ± 0.49 | 2.65 ± 0.74 | 1.92 ± 0.53 | 1.92 ± 0.61 | 1.43 ± 0.37 | 1.11 ± 0.32 |
| 8 | |||||||
| CV ± SD | 2.07 ± 0.61 | 2.06 ± 0.57 | 2.87 ± 0.81 | 1.95 ± 0.58 | 3.14 ± 0.85 | 1.61 ± 0.44 | 1.26 ± 0.33 |
| 9 | |||||||
| CV ± SD | 3.32 ± 0.94 | 2.31 ± 0.7 | 5.02 ± 1.27 | 2.07 ± 0.63 | 3.17 ± 0.88 | 1.62 ± 0.46 | 1.71 ± 0.48 |
| 10 | |||||||
| CV ± SD | 6.33 ± 1.29 | 8.32 ± 1.63 | 12.7 ± 2.45 | 8.26 ± 1.46 | 6.34 ± 1.32 | 2.91 ± 0.52 | 3.56 ± 0.69 |
Figure 3Pairwise variation (V/V) values analysis in all the seven experimental subsets calculated using geNorm.
The cut-off value to determine the optimal number of RGs for qRT-PCR normalization is 0.15.
Expression stability ranking of the 10 candidate reference genes.
| Method | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 |
|---|---|---|---|---|---|---|---|---|---|---|
| geNorm | ||||||||||
| NormFinder | ||||||||||
| BestKeeper | ||||||||||
| Comprehensive ranking | ||||||||||
| geNorm | ||||||||||
| NormFinder | ||||||||||
| BestKeeper | ||||||||||
| Comprehensive ranking | ||||||||||
| geNorm | ||||||||||
| NormFinder | ||||||||||
| BestKeeper | ||||||||||
| Comprehensive ranking | ||||||||||
| geNorm | ||||||||||
| NormFinder | ||||||||||
| BestKeeper | ||||||||||
| Comprehensive ranking | ||||||||||
| geNorm | ||||||||||
| NormFinder | ||||||||||
| BestKeeper | ||||||||||
| Comprehensive ranking | ||||||||||
| geNorm | ||||||||||
| NormFinder | ||||||||||
| BestKeeper | ||||||||||
| Comprehensive ranking | ||||||||||
| geNorm | ||||||||||
| NormFinder | ||||||||||
| BestKeeper | ||||||||||
| Comprehensive ranking | ||||||||||
Figure 4Comprehensive ranking of candidate genes calculated by the geometric mean of three types of rankings (geNorm, NormFinder, and BestKeeper) in each subset.
(A) Drought stress. (B) Cold stress. (C) Salt stress. (D) ABA treatment. (E) GA treatment. (F) ETH treatment. (G) All samples.
Figure 5Relative expression levels of P5CS2 under different experimental conditions normalized by the most stable RG combination, the most stable gene and the most unstable gene.
(A) Drought stress. (B) Cold stress. (C) Salt stress. (D) ABA treatment. (E) GA treatment. (F) ETH treatment. Bars represent the standard error from three biological replicates.
Figure 6Relative expression levels of GI under different experimental conditions normalized by the most stable RG combination, the most stable gene and the most unstable gene.
(A) Drought stress. (B) Cold stress. (C) Salt stress. (D) ABA treatment. (E) GA treatment. (F) ETH treatment. Bars represent the standard error from three biological replicates.