Literature DB >> 31050210

Lnc-GIHCG promotes cell proliferation and migration in gastric cancer through miR- 1281 adsorption.

Guozheng Liu1, Zaipeng Jiang2, Mingliang Qiao2, Fengyong Wang3.   

Abstract

BACKGROUND: Long noncoding RNAs (lncRNAs) are from the family of noncoding RNAs. Existing studies have shown that lncRNAs are involved in many biological processes and are strongly related to the occurrence and development of tumors. Recent studies have indicated that lncRNA GIHCG participates in the progression of many cancers by adjusting cell proliferation and migration. Gastric cancer (GC) is a prevalent malignant tumor that arises from gastric epithelium. This study mainly explored the influence of GIHCG on GC and its underlying mechanism.
METHODS: GIHCG expression was detected in GC through quantitative real-time polymerase chain reaction while the relationship of GIHCG with miR-1281 and miR-1281 with TLE1 was verified using dual luciferase reporter gene assay. The influence of GIHCG, miR-1281 and TLE1 on cell function was verified using cell counting Kit-8 (CCK-8) and Transwell experiment.
RESULTS: In GC, GIHCG was significantly overexpressed and significantly increased cell proliferation and migration, with the possible mechanism of upregulatingTLE1 expression through adsorption of miR-1281.
CONCLUSION: Taken together, we revealed the role of GIHCG/miR-1281/TLE1 in GC and provided a new perspective.
© 2019 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

Entities:  

Keywords:  zzm321990GIHCGzzm321990; zzm321990TLE1zzm321990; gastric cancer; lncRNAs; mR-1281

Mesh:

Substances:

Year:  2019        PMID: 31050210      PMCID: PMC6565586          DOI: 10.1002/mgg3.711

Source DB:  PubMed          Journal:  Mol Genet Genomic Med        ISSN: 2324-9269            Impact factor:   2.183


INTRODUCTION

Gastric cancer (GC) is malignant and greatly affects human health, with a high global morbidity (Chen et al., 2016). Although its morbidity and mortality decrease with the improvement of early intervention and treatment, most GC patients already step into progressive stage upon definite diagnosis (Deng et al., 2011), with 5‐year survival rate significantly lower than early GC. The current treatment for early GC patients mainly includes surgeries. However, chemotherapy, as a primary treatment for advanced patients, provides unsatisfactory efficacy as a result of the influence of tumor metastasis and drug resistance(Wu, Huang, & Wang, 2015). Therefore, it is important to conduct intensive studies on the pathogenesis of GC from the genetic and molecular level for the prevention and treatment of GC (Liu et al., 2011; Zhou, Li, & He, 2016). A human genomic study has shown that 80% of DNA may be transcribed into RNA; however, only less than 2% RNA is translated into proteins. RNAs without protein‐coding function are called noncoding RNAs (ncRNA) (Awan, Shah, Rashid, & Shan, 2017). Long noncoding RNAs (lncRNA), a member of ncRNAs, are a group of sequences that have more than 200 nucleotides and are generally incapable of protein coding (Esteller, 2011). With the development and wide application of sequencing technique, new lncRNAs are discovered. Numerous studies reveal that lncRNAs affect gene expression at multiple levels during and after transcription (Yang, Lu, & Yuan, 2014) and involve in the occurrence and development of multiple tumors (Aguilo, Zhou, & Walsh, 2011; Shang, Guo, Zhang, & Xue, 2016). lncRNA GIHCG (HGNC: 52649) that was found in liver cancer for the first time, appeared with significant overexpression , and was found to significantly promote cell proliferation and migration in liver cancer and also enhance tumor growth in mice (Sui et al., 2016). In addition, for renal cancer, some studies have found that after downregulating the GIHCG expression, cell proliferation and migration in renal cancer are significantly inhibited and GIHCG shows significant overexpression in the plasma of renal cancer patients. Thus GIHCG can be a potential diagnostic marker for renal cancer (He, Qin, Zhang, Yi, & Han, 2018; Zhang, Zhang, & Liu, 2016). Although GIHCG has been studied in other cancers, no report exists for its role in GC. This study detected the GIHCG expression in GC patients and investigated the influence of GIHCG on cell proliferation and migration in GC patients. Moreover, the underlying mechanism by which GIHCG played a role in GC was further explored.

MATERIALS AND METHODS

Ethical compliance

The research was approved by the Ethics Committee of The Third Hospital of Tongde Hospital of Zhejiang Province.

General information

Specimens of fresh cancer tissues and their adjacent tissues were harvested from 24 GC patients who received operative treatment. The cancer tissue samples were harvested from the medial wall of cancerous ulcerous excavation. The adjacent tissue samples were harvested from the non‐neoplastic gastric mucosae which were more than 5 cm away from tumor edge. All samples were stored in liquid nitrogen immediately after labeling in vitro. The patients' clinical pathology mainly including: age, gender, smoking history, tumor size, pathological subtype, histological grade, TNM classification and lymph node status was collected. The patients who volunteered for this study signed the written informed consent. This study received approval from the Hospital Ethics Committees.

Cell culture

GC cell lines SNU‐5, HGC‐27, N87 and SGC‐7901 and the normal gastric mucosal cell line GES1 were purchased from ATCC (Manassas VA). RPMI1640 culture media (GIBCO‐BRL; Thermo Fisher Scientific, Waltham, MA) containing 100 U/ml streptomycin/penicillin and 10% fetal bovine serum (FBS) (Hyclone, USA) were placed in a thermostatic incubator containing 5% CO2 at saturated humidity at 37°C.

Cell transfection

The day before transfection, moderate cells seeded into a 6‐well plate were cultured with antibiotic‐free culture medium overnight. Transient transfection was performed when cells covered 60%–70% of the culture dish; miR‐1281 mimics, pcDNA‐lncGIHCG and pcDNA‐TLE1 and their corresponding negative control transfected cells were used and mixed with Lipo2000. They were homogenized at room temperature for 20 min to form mimics/Lipo2000 (or DNA/Lipo2000) compound, and 100 μl of this compound was added to the culture medium slowly and homogenized. After 4–6 hr of cell coculture, the compound was removed and replaced with complete medium containing 1% streptomycin/penicillin and 10% FBS for 24 hr for subsequent experiment.

Total RNA extraction for tissues and cells

Afterwards 100 mg of tissues was added into 5 ml glass tube, 1 ml of precooled Trizol (Invitrogen, USA) was added; at a rotation rate of 8,000 r/min, the samples in the glass tube were homogenized for 30–45 s; and then the homogenate was transferred to a centrifuge tube without RNase; 5 min after mixed at room temperature, precooled chloroform (200 µl chloroform/1 ml Trizol) was added. Then the centrifuge tube was shaken vigorously for 15 s and kept at room temperature for 10 min before 15 min of centrifugation (4°C, 12,000 g/min); about 500 µl of the upper aqueous phase was removed and added into a centrifuge tube without RNase, and then 500 µl of isopropyl alcohol was added. The tube was inverted for 6–8 times before it was kept in the refrigerator at −20°C for 30 min; at 4°C, centrifugation was performed at 10,000 g/min for 15 min. After discarding the supernatant, 650 μl of 75% ethyl alcohol was added. The tube was centrifuged at 8,000 g/min for 5 min. With the supernatant discarded, the tube was dried under natural condition (do not dry completely); 20 μl of diethyl pyrocarbonate (DEPC) water was added to dissolve RNA and the solution was stored in the refrigerator at −80°C for later use.

Quantitative real‐time polymerase chain reaction

After concentration and purity determination of RNA samples, they were subjected to reverse transcription to synthesize cDNA samples, with U6 and GAPDH as internal reference, respectively. SYBR Green (Applied Biosystems, USA) premix, template, forward/reverse primer and DEPC (Beyotime Biotechnology, China) were used to prepare the PCR reaction solution which was subjected to PCR amplification on a real‐time PCR amplifier. miRNA RT Kit from Shanghai TIANGEN was used for miRNA's PCR reaction. After miRNA was reverse transcribed into cDNA, PCR reaction and quantitative analysis of miRNA were performed as per the instructions mentioned in the MiRNA qPCR kit (TIANGEN, Shanghai). The primer sequences are shown below: miR‐1281 (F: 5′ ACACTCCAGCTGGGTCGCCTCCTCC 3′, R: 5′ CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGGGAGAGG 3′); U6 (F: CTCGCTTCGGCAGCAGCACATATA, R: AAATATGGAACGCTTCACGA); GIHCG (F: 5′CTTTCAAGAAGTTTGGCTGTC 3′, R: 5′ GCTCATTCAACGGATAAGTC 3′), GAPDH (F: 5′GAAGAGAGAGACCCTCACGCTG3′, R: 5′ACTGTGAGGAGGGGAGATTCAGT3′); TLE1 (NCBI Gene ID: 7088) (F: 5′GAGTCCCTGGACCGGATTAAA3′, R: 5′ AATACATCACATAGTGCCTCTGC 3′).

Dual luciferase reporter gene assay

WT3′UTR group was constructed by cloning transcript 3′UTR sequence of TLE1 to pGL3 vector containing Luciferase reporter gene. Using a site‐directed mutagenesis kit, the core region for miRNA binding on 3′UTR was mutated into an invalid binding sequence to construct control plasmid MUT3′UTR group. Furthermore, pGL‐3‐lncGIHCG WT and pGL‐3‐lncGIHCG MUT groups were also constructed. Each group was transferred with renilla luciferase internal reference plasmids and miR‐1281 mimics. After 24 hr of transfection, all cell culture media were discarded. A moderate amount of lysis buffer was added into the kit for sufficient cell lysis. After centrifugation, 100 μL of supernatant was taken from lysis buffer for determination. Renilla luciferase was applied as internal reference and the value of RLU measured by firefly luciferase is divided by it. The obtained value was used for comparing the degree of activation of reporter gene for different sample purposes.

Cell migration

Transwell chamber was placed in the upper 24‐well plate; transfected GC cells were digested by pancreatins. Serum‐free medium was used for cell suspension while a cell counter was applied for counting. Serum‐free medium was used for dilution, with the cell density adjusted to 1 × 105/ml, and then the above cell suspension was added into the chamber. Culture media containing 10% FBS were added into a sterile 24‐well plate for culture in an incubator. After the medium was removed 48 hr later, PBS was used for washing twice. After removing the Transwell chamber, 4% paraformaldehyde was used for 30 min of fixation. Cells were subjected to 0.5% crystal violet staining for 10–15 min and the staining reagent was washed with PBS after staining. Cells were observed and counted under microscope.

Cell proliferation

The treated GC cells seeded into the 96‐well plate at 1 × 104/well were cultured for 0, 24, 48, 72, and 96 hr. Counting Kit‐8 (CCK‐8, Dojindo, Japan) was used to detect cell proliferation. Before this detection, each well was added with CCK‐8/culture medium mixture according to the ratio of 1:10. The previous culture medium was replaced with 110 μl of mixed medium. After 1 hr of incubation at 37°C, OD value was detected using an enzyme‐linked immunoassay detector at 450 nm. Another six wells were set for each group.

Western blot

Appropriate concentration of SDS‐PAGE gel was prepared according to the target protein’s molecular weight, with 50–80 μg of proteins for each lane. After electrophoresis, wet transfer method was used for transferring the proteins onto the PVDF membrane on ice. The PVDF membrane was removed after transfer membrane; the PVDF membrane was blocked with 5% skim milk powder prepared by TBST and placed on a shaker for 1 hr of blocking; TBST was used for four runs of washing, 10 min for each run; after adding diluted primary antibodies and storing in the refrigerating chamber at 4°C overnight, TBST was used for four runs of washing, 10 min for each run; diluted secondary antibodies were added and 1 hr of incubation was performed at room temperature; TBST was used for four runs of washing, 10 min for each run; chemiluminescence development was applied, with photos obtained using an exposure apparatus.

Statistical method

SPSS22.0 (IBM, USA) was used for statistical analysis of all data. Chi‐square test was applied for between‐group comparison of enumeration data while independent t test was applied for measurement data. p Value < 0.05 indicated statistical differences.

RESULTS

Significant overexpression of GIHCG in GC

First, GC tissues and their adjacent tissues were collected for detecting the expression of lncRNA GIHCG. The results indicated significantly higher GIHCG expression in GC tissues than that in their adjacent tissues (Figure 1a). Then the detection of GIHCG expression at different stages of GC showed that GIHCG expression in the stage III–IV patients was significantly increased compared with that in stage I–II patients (Figure 1b). To explore whether GIHCG could be identified as a potential biomarker for GC, the ROC curve was plotted for GC and area under the curve (AUC) was 0.8941 with a cutoff value of 0.04917, indicating that GIHCG was of some predictive potential (Figure 1c). Meanwhile, detection of GIHCG expression in GC cell line indicated common overexpression of GIHCG in GC cell line relative to normal gastric mucosal cells GES1 (Figure 1d).
Figure 1

Significant overexpression of GIHCG in gastric cancer. (a) Significant overexpression of GIHCG in gastric cancer tissues relative to their adjacent tissues. (b) Significantly higher expression of GIHCG in stage III‐IV patients than stage I‐II patients. (c) Survival curve analysis showing AUC of 0.8941 and a cutoff value of 0.04917. (d) Common overexpression of GIHCG in gastric cancer cell line relative to normal gastric mucosal cells. *p < 0.05, **p < 0.01, ***p < 0.001

Significant overexpression of GIHCG in gastric cancer. (a) Significant overexpression of GIHCG in gastric cancer tissues relative to their adjacent tissues. (b) Significantly higher expression of GIHCG in stage III‐IV patients than stage I‐II patients. (c) Survival curve analysis showing AUC of 0.8941 and a cutoff value of 0.04917. (d) Common overexpression of GIHCG in gastric cancer cell line relative to normal gastric mucosal cells. *p < 0.05, **p < 0.01, ***p < 0.001

GIHCG significantly promoted the cell proliferation and migration

To explore the potential role of GIHCG in the occurrence and development of GC, we also selected SGC‐7901 and HGC‐27 cell lines for subsequent study. After transfection of overexpressed plasmids of GIHCG in the two cell lines, GIHCG expression was significantly increased relative to the control group (Figure 2a). The influence of upregulated GIHCG expression on cell proliferation and migration was also detected and the results showed that upregulated GIHCG significantly promoted cell proliferation and migration (Figure 2b,c). Hence, we speculated that GIHCG took part in the progression of GC by promoting GC cell migration and proliferation.
Figure 2

GIHCG promoted the proliferation and migration of gastric cancer cells. (a) Significant upregulation of GIHCG expression after transfection of overexpressed plasmids of GIHCG in gastric cancer cell lines HGC‐2 and SGC‐7901. (b) Significant higher cell proliferation after upregulation of GIHCG in HGC‐27 and SGC‐7901 cells. (c) Significant higher cell migration after upregulation of GIHCG in HGC‐27 and SGC‐7901 cells. *p < 0.05, **p < 0.01, ***p < 0.001

GIHCG promoted the proliferation and migration of gastric cancer cells. (a) Significant upregulation of GIHCG expression after transfection of overexpressed plasmids of GIHCG in gastric cancer cell lines HGC‐2 and SGC‐7901. (b) Significant higher cell proliferation after upregulation of GIHCG in HGC‐27 and SGC‐7901 cells. (c) Significant higher cell migration after upregulation of GIHCG in HGC‐27 and SGC‐7901 cells. *p < 0.05, **p < 0.01, ***p < 0.001

miR‐1281 was a target gene of GIHCG

Bioinformatic analysis showed that miR‐1281 was a potential target gene of GIHCG and the dual luciferase reporter gene experiment further demonstrated their binding (Figure 3a–c). To further verify their relationship, miR‐1281 expression was detected after upregulation of GIHCG expression in HGC‐27 and SGC‐7901 cells. The results suggested significant reduction of miR‐1281 expression with upregulated GIHCG (Figure 3d), further demonstrating that miR‐1281 was a target gene of GIHCG. Detection of miR‐1281 expression in GC showed a significantly low expression of miR‐1281 in GC (Figure 3e) and negative correlation with GIHCG expression in GC (Figure 3f). Next, the function of miR‐1281 was explored. The results suggested that cell migration and proliferation were significantly inhibited with upregulated miR‐1281 and the promotion of cell function by GIHCG was partially reversed (Figure 3g,h).
Figure 3

miR‐1281 was a target gene of GIHCG. (a) Bioinformatic analysis showing their potential binding site. (b,c) Dual luciferase reporter gene assay demonstrating their binding relationship. (d) Significant lower miR‐1281 expression after upregulation of GIHCG expression in HGC‐27 and SGC‐7901 cells; E Significantly low miR‐1281 expression in gastric cancer tissues relative to adjacent tissues. (f) Negative correlation between GIHCG and miR‐1281 in gastric cancer, p < 0.05, R 2 = 0.7192. (g) After upregulation of miR‐1281 expression in HGC‐27 and SGC‐7901 cells, significant inhibition of cell proliferation and partial reversion of the promotion effect of GIHCG on cell proliferation. (h) After upregulation of miR‐1281 expression in HGC‐27 and SGC‐7901 cells, significant inhibition of cell migration and partial reversion of the promotion effect of GIHCG on cell migration. *p < 0.05, **p < 0.01, ***p < 0.001

miR‐1281 was a target gene of GIHCG. (a) Bioinformatic analysis showing their potential binding site. (b,c) Dual luciferase reporter gene assay demonstrating their binding relationship. (d) Significant lower miR‐1281 expression after upregulation of GIHCG expression in HGC‐27 and SGC‐7901 cells; E Significantly low miR‐1281 expression in gastric cancer tissues relative to adjacent tissues. (f) Negative correlation between GIHCG and miR‐1281 in gastric cancer, p < 0.05, R 2 = 0.7192. (g) After upregulation of miR‐1281 expression in HGC‐27 and SGC‐7901 cells, significant inhibition of cell proliferation and partial reversion of the promotion effect of GIHCG on cell proliferation. (h) After upregulation of miR‐1281 expression in HGC‐27 and SGC‐7901 cells, significant inhibition of cell migration and partial reversion of the promotion effect of GIHCG on cell migration. *p < 0.05, **p < 0.01, ***p < 0.001

TLE1 was a potential target gene of miR‐1281

It was further found that TLE1 was a potential target gene for miR‐1281 (Figure 4a), as demonstrated by the binding relationship in the dual luciferase reporter gene experiment (Figure 4b,c). After upregulation of miR‐1281 in cells, TLE1 expression was significantly decreased regardless of mRNA level or protein level (Figure 4d,e). The above results confirmed that miR‐1281 might downregulate TLE1 expression.
Figure 4

TLE1 was a potential target gene of miR‐1281. (a) Bioinformatic analysis showing their potential binding site. (b,c) Dual luciferase reporter gene assay showing their binding relationship. (d,e) Significant lower TLE1 expression at protein and mRNA levels after upregulation of miR‐1281 expression in HGC‐27 and SGC‐7901 cells. *p < 0.05, **p < 0.01, ***p < 0.001

TLE1 was a potential target gene of miR‐1281. (a) Bioinformatic analysis showing their potential binding site. (b,c) Dual luciferase reporter gene assay showing their binding relationship. (d,e) Significant lower TLE1 expression at protein and mRNA levels after upregulation of miR‐1281 expression in HGC‐27 and SGC‐7901 cells. *p < 0.05, **p < 0.01, ***p < 0.001

miR‐1281 exerted its role through downregulation of TLE1

TLE1 expression was significantly higher in GC and showed a negative correlation with miR‐1281 expression (Figure 5a,b). The results of functional experiment indicated that cell proliferation was significantly enhanced after upregulation of TLE1 expression in SGC‐7901/HGC‐27 cell lines. Meanwhile, cell proliferation was partially suppressed with concurrent upregulation of miR‐1281 expression (Figure 5c,d). In addition, the results of the Transwell experiment showed that upregulated TLE1 significantly promoted cell migration; however, after concurrent upregulation of miR‐1281 expression, this promotion was partially reversed (Figure 5e). Taken together, it may be concluded that miR‐1281 exerted its role through downregulation of TLE1 expression.
Figure 5

miR‐1281 exerted its role through downregulation of TLE1. (a) Significantly higher TLE1 expression in gastric cancer tissues than in their adjacent tissues. (b) TLE1 negatively correlated with miR‐1281 in gastric cancer, p < 0.05, R 2 = 0.4552. (c,d) After upregulation of TLE1 expression in HGC‐27 and SGC‐7901 cells, significantly higher cell proliferation and partial reversion of the suppression of miR‐1281 on cell proliferation. (e) After upregulation of TLE1 expression in SGC‐7901 and HGC‐27 cells, significantly higher cell migration and partial reversion of the suppression of miR‐1281 on cell migration. *p < 0.05, **p < 0.01, ***p < 0.001

miR‐1281 exerted its role through downregulation of TLE1. (a) Significantly higher TLE1 expression in gastric cancer tissues than in their adjacent tissues. (b) TLE1 negatively correlated with miR‐1281 in gastric cancer, p < 0.05, R 2 = 0.4552. (c,d) After upregulation of TLE1 expression in HGC‐27 and SGC‐7901 cells, significantly higher cell proliferation and partial reversion of the suppression of miR‐1281 on cell proliferation. (e) After upregulation of TLE1 expression in SGC‐7901 and HGC‐27 cells, significantly higher cell migration and partial reversion of the suppression of miR‐1281 on cell migration. *p < 0.05, **p < 0.01, ***p < 0.001

DISCUSSION

MicroRNAs (miRNAs), are a member of noncoding RNAs, that are highly conservative small RNAs with about 20–22 nucleotides. miRNAs widely exist in multiple cellular organisms and involve in almost all processes of vital activities (Yan et al., 2017) Numerous studies on the relationship between miRNAs and tumors conducted by scientists have indicated that miRNAs are important in many tumors such as GC, lung cancer, colon cancer, prostatic cancer, thyroid cancer, breast cancer (Ghaedi et al., 2019; Qi et al., 2015). For LncRNAs, the modes of action include binding to proteins, chromosome and other macromolecules and involvement in the regulatory network of competing endogenous RNA (ceRNA) (Salmena, Poliseno, Tay, Kats, & Pandolfi, 2011). Studies conducted in recent years have shown that the involvement of endogenous RNAs (including mRNAs, long noncoding, pseudogene and circular RNA) in the progression of tumors is achieved by competitively binding to miRNAs by miRNA response elements (MREs) to affect mutual expression levels (Cesana et al., 2011; Sumazin et al., 2011). For instance, a study has shown that upregulated lncRNA‐HOTAIR expression in GC patients enhances the invasion of GC cells by competitively binding to miR‐331‐3p and adjusting its suppression on human epidermal growth factor receptor 2 (HER2) (Liu et al., 2014). Another study has shown that lncRNA‐TUSC7 may suppress the action of miR‐23b on the target gene as ceRNA and may become a prognostic marker for GC patients (Qi et al., 2015). In this study, quantitative real‐time polymerase chain reaction assay revealed significant GIHCG overexpression in cancer tissues of GC patients and lower expression in stages I‐II GC than that in stages III‐IV GC. ROC analysis suggested that GIHCG could be a potential diagnostic marker for GC. GC cell proliferation and migration were significantly increased after upregulation of GIHCG expression. To further explore its possible mode of action, we confirmed that miR‐1281 was a potential target gene and GIHCG downregulated miR‐1281 expression as observed in bioinformatic analysis and the dual luciferase reporter gene experiment. As shown by reversion experiment, upregulated miR‐1281 inhibited cell proliferation and migration and partially reversed the promotion of proliferation and migration by GIHCG. Thus, we surmised that GIHCG exerted its role by downregulating miR‐1281. TLE1 (HGNC:11837) is from the family of Groucho/Transducin‐Like Enhancer of split and may regulate and control the transcription process and play a role in Notch and Wnt signaling (Kaul, Schuster, & Jennings, 2014; Ramasamy et al., 2016). Existing studies confirm that its abnormal expression may result in the occurrence and development of multiple tumors. For lung cancer, TLE1 participates in the progression of lung cancer by enhancing epithelial mesenchymal transition of lung cancer cells by inhibiting E‐cadherin expression (Yao et al., 2014). As shown by bioinformatic analysis, TLE1 was a potential target gene of miR‐1281 and miR‐1281 downregulated TLE1 expression. Further functional experiment confirmed that TLE1 increased GC cell migration and proliferation and partially relieved the suppression of miR‐1281 on cell function. Therefore, we concluded that miR‐1281 played a role by downregulating TLE1 expression. Taken together, this study revealed that GIHCG played a certain role in GC and its possible mechanism was to upregulate the expression of the target gene of miR‐1281—TLE1 through downregulation of miR‐1281 expression. This provides a new theoretical basis for the prevention and targeted therapy of GC and represents a new promising therapeutic target.

CONFLICT OF INTEREST

None declared.
  23 in total

Review 1.  Non-coding RNAs in human disease.

Authors:  Manel Esteller
Journal:  Nat Rev Genet       Date:  2011-11-18       Impact factor: 53.242

Review 2.  LncRNA: a link between RNA and cancer.

Authors:  Guodong Yang; Xiaozhao Lu; Lijun Yuan
Journal:  Biochim Biophys Acta       Date:  2014-08-23

3.  An extensive microRNA-mediated network of RNA-RNA interactions regulates established oncogenic pathways in glioblastoma.

Authors:  Pavel Sumazin; Xuerui Yang; Hua-Sheng Chiu; Wei-Jen Chung; Archana Iyer; David Llobet-Navas; Presha Rajbhandari; Mukesh Bansal; Paolo Guarnieri; Jose Silva; Andrea Califano
Journal:  Cell       Date:  2011-10-14       Impact factor: 41.582

Review 4.  Long noncoding RNA, polycomb, and the ghosts haunting INK4b-ARF-INK4a expression.

Authors:  Francesca Aguilo; Ming-Ming Zhou; Martin J Walsh
Journal:  Cancer Res       Date:  2011-08-09       Impact factor: 12.701

5.  Investigation of the recurrence patterns of gastric cancer following a curative resection.

Authors:  Jingyu Deng; Han Liang; Dianchang Wang; Dan Sun; Yi Pan; Yong Liu
Journal:  Surg Today       Date:  2011-01-26       Impact factor: 2.549

6.  A ceRNA hypothesis: the Rosetta Stone of a hidden RNA language?

Authors:  Leonardo Salmena; Laura Poliseno; Yvonne Tay; Lev Kats; Pier Paolo Pandolfi
Journal:  Cell       Date:  2011-07-28       Impact factor: 41.582

7.  Combination gene therapy using VEGF-shRNA and fusion suicide gene yCDglyTK inhibits gastric carcinoma growth.

Authors:  Ting Liu; Ling Ye; Yongzheng He; Xuanmin Chen; Jie Peng; Xiaomei Zhang; Hong Yi; Fang Peng; Aimin Leng
Journal:  Exp Mol Pathol       Date:  2011-08-07       Impact factor: 3.362

8.  A long noncoding RNA controls muscle differentiation by functioning as a competing endogenous RNA.

Authors:  Marcella Cesana; Davide Cacchiarelli; Ivano Legnini; Tiziana Santini; Olga Sthandier; Mauro Chinappi; Anna Tramontano; Irene Bozzoni
Journal:  Cell       Date:  2011-10-14       Impact factor: 41.582

9.  Lnc RNA HOTAIR functions as a competing endogenous RNA to regulate HER2 expression by sponging miR-331-3p in gastric cancer.

Authors:  Xiang-Hua Liu; Ming Sun; Feng-Qi Nie; Ying-Bin Ge; Er-Bao Zhang; Dan-Dan Yin; Rong Kong; Rui Xia; Kai-Hua Lu; Jin-Hai Li; Wei De; Ke-Ming Wang; Zhao-Xia Wang
Journal:  Mol Cancer       Date:  2014-04-28       Impact factor: 27.401

10.  The Groucho co-repressor is primarily recruited to local target sites in active chromatin to attenuate transcription.

Authors:  Aamna Kaul; Eugene Schuster; Barbara H Jennings
Journal:  PLoS Genet       Date:  2014-08-28       Impact factor: 5.917

View more
  17 in total

1.  Circ_0001588 Upregulates ERBB4 to Promote Glioma Malignant Progression Through Sponging miR-1281.

Authors:  Jun Wang; Juan Li; Peng Duan; Yanwei Dang; Tao Shi
Journal:  Neurotox Res       Date:  2022-01-04       Impact factor: 3.911

Review 2.  Blood-derived lncRNAs as biomarkers for cancer diagnosis: the Good, the Bad and the Beauty.

Authors:  Cedric Badowski; Bing He; Lana X Garmire
Journal:  NPJ Precis Oncol       Date:  2022-06-21

3.  Overexpression of GIHCG is Associated with a Poor Prognosis and Immune Infiltration in Hepatocellular Carcinoma.

Authors:  Siyu Xiao; Shanzhou Huang; Jie Yang
Journal:  Onco Targets Ther       Date:  2020-11-12       Impact factor: 4.147

4.  LINC01089 is a tumor-suppressive lncRNA in gastric cancer and it regulates miR-27a-3p/TET1 axis.

Authors:  Xufeng Guo; Ming Li
Journal:  Cancer Cell Int       Date:  2020-10-16       Impact factor: 5.722

5.  Machine learning predicts treatment sensitivity in multiple myeloma based on molecular and clinical information coupled with drug response.

Authors:  Lucas Venezian Povoa; Carlos Henrique Costa Ribeiro; Israel Tojal da Silva
Journal:  PLoS One       Date:  2021-07-28       Impact factor: 3.240

6.  DNM3OS Facilitates Ovarian Cancer Progression by Regulating miR-193a-3p/MAP3K3 Axis.

Authors:  Lei He; Guolin He
Journal:  Yonsei Med J       Date:  2021-06       Impact factor: 2.759

7.  Transducin-Like Enhancer of Split-1 Inhibits Malignant Behaviors in vitro and Predicts a Better Prognosis in Pancreatic Ductal Adenocarcinoma.

Authors:  Yizhi Wang; Da Yuan; Li Zhou; Zhiyong Liang; Weixun Zhou; Jun Lu; Bolun Jiang; Lei You; Junchao Guo; Yu-Pei Zhao
Journal:  Front Oncol       Date:  2020-05-05       Impact factor: 6.244

8.  Long Non-Coding RNA HOTAIR Modulates KLF12 to Regulate Gastric Cancer Progression via PI3K/ATK Signaling Pathway by Sponging miR-618.

Authors:  Jin Xun; Chunfeng Wang; Jianning Yao; Bing Gao; Lianfeng Zhang
Journal:  Onco Targets Ther       Date:  2019-11-27       Impact factor: 4.147

9.  LncRNA LOXL1-AS1 facilitates the tumorigenesis and stemness of gastric carcinoma via regulation of miR-708-5p/USF1 pathway.

Authors:  Qi Sun; Jian Li; Fan Li; Huanqin Li; Songhua Bei; Xiaohong Zhang; Li Feng
Journal:  Cell Prolif       Date:  2019-08-29       Impact factor: 6.831

10.  Phosphorylated STAT3 suppresses microRNA-19b/1281 to aggravate lung injury in mice with type 2 diabetes mellitus-associated pulmonary tuberculosis.

Authors:  Xianhua Wang; Yuefu Lin; Ying Liang; Yang Ye; Dong Wang; Aer Tai; Shuimiao Wu; Jian Pan
Journal:  J Cell Mol Med       Date:  2020-10-22       Impact factor: 5.295

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.