| Literature DB >> 31048683 |
Sibylle Cocciardi1, Anna Dolnik1, Silke Kapp-Schwoerer1, Frank G Rücker1, Susanne Lux1, Tamara J Blätte1, Sabrina Skambraks1, Jan Krönke1, Florian H Heidel2,3, Tina M Schnöder2,3, Andrea Corbacioglu1, Verena I Gaidzik1, Peter Paschka1, Veronica Teleanu1, Gudrun Göhring4, Felicitas Thol5, Michael Heuser5, Arnold Ganser5, Daniela Weber1, Eric Sträng6, Hans A Kestler6, Hartmut Döhner1, Lars Bullinger7,8, Konstanze Döhner9.
Abstract
Mutations in the nucleophosmin 1 (NPM1) gene are considered founder mutations in the pathogenesis of acute myeloid leukemia (AML). To characterize the genetic composition of NPM1 mutated (NPM1mut) AML, we assess mutation status of five recurrently mutated oncogenes in 129 paired NPM1mut samples obtained at diagnosis and relapse. We find a substantial shift in the genetic pattern from diagnosis to relapse including NPM1mut loss (n = 11). To better understand these NPM1mut loss cases, we perform whole exome sequencing (WES) and RNA-Seq. At the time of relapse, NPM1mut loss patients (pts) feature distinct mutational patterns that share almost no somatic mutation with the corresponding diagnosis sample and impact different signaling pathways. In contrast, profiles of pts with persistent NPM1mut are reflected by a high overlap of mutations between diagnosis and relapse. Our findings confirm that relapse often originates from persistent leukemic clones, though NPM1mut loss cases suggest a second "de novo" or treatment-associated AML (tAML) as alternative cause of relapse.Entities:
Mesh:
Substances:
Year: 2019 PMID: 31048683 PMCID: PMC6497712 DOI: 10.1038/s41467-019-09745-2
Source DB: PubMed Journal: Nat Commun ISSN: 2041-1723 Impact factor: 14.919
Fig. 1Incidence of mutations in 129 paired (diagnosis/relapse) NPM1mut pts. Colored bars indicate the presence of a mutation, white bars represent wild-type, data not available is indicated by a gray bar. Light and dark green bars illustrate heterozygous and homozygous FLT3-ITD mutations, respectively. Bars marked by X illustrate different mutation types found in the diagnosis and relapse sample. Stability was calculated by the number of mutations that persisted at relapse divided by all mutations present at diagnosis. D, diagnosis; R, relapse
Fig. 2CNAs and UPDs identified at diagnosis and relapse by SNP profiling. Bars next to each chromosome indicate genomic gain, loss, and uniparental disomy (UPD). The length of the bar indicates the respective genomic region affected by the aberrations. Bars highlighted by a grey box indicate relapse specific aberrations. Bars marked by a star indicate genomic changes which are lost at relapse
Fig. 3Mutational map and enriched pathways in diagnosis/relapse pairs of NPM1mut loss and persistent pts. a Mutational profile of 10 NPM1mut loss and 10 NPM1mut persistent pts found by WES. Colors indicate the varying occurrence of mutations during disease progression, including mutations which persist during remission (preleukemic/germline mutations; [green]), mutations which are solely present in the diagnosis sample (blue), relapse specific mutations (red) and mutations which are shared between the diagnosis and relapse sample (black). b Enriched pathways in diagnosis and relapse samples from NPM1mut loss and NPM1mut persistent pts based on mutated genes
Relapse specific mutations detected in diagnosis samples with UltraDeep-sequencing
| Patient ID | Chr | Start | End | Ref | Alt | Gene | AAChange | VAF % relapse (WES) | VAF % remission (WES) | VAF % diagnosis (WES) | Found at diagnosis (UltraDeep-seq) | Coverage (UltraDeep-seq) | VAF % (UltraDeep-seq) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 103 L | chr11 | 32417907 | 32417907 | – | CCGA | WT1 | A382fs | 13.54 | 0 | 0 | NO | 9660 | 0 |
| 103 L | chr1 | 115258744 | 115258744 | C | T | NRAS | G13D | 31.89 | 0.45 | 0 | NO | 8062 | 0 |
| 103 L | chr2 | 25463286 | 25463286 | C | T | DNMT3A | R736H | 25 | 37 | 51.35 | YES | 1128 | 29.8 |
| 172 L | chr12 | 112888211 | 112888211 | A | C | PTPN11 | E76A | 14.29 | 0 | 0 | NO | 5244 | 0 |
| 172 L | chr21 | 36171600 | 36171600 | – | A | RUNX1 | S322fs | 50 | 0 | 0 | NO | 2207 | 0 |
| 172 L | chr2 | 25457243 | 25457243 | G | A | DNMT3A | R882C | 38.46 | 36 | 38.46 | YES | 4531 | 48.5 |
| 172 L | chr1 | 115258744 | 115258744 | C | T | NRAS | G13D | 8 | 0 | 0 | NO | 9311 | 0 |
| 355 L | chr7 | 140476755 | 140476755 | T | C | BRAF | I551V | 26.47 | 0 | 0 | NO | 2282 | 0 |
| 355 L | chr2 | 25458596 | 25458596 | T | A | DNMT3A | L859F | 35.29 | 0 | 0 | NO | 1163 | 0 |
| 355 L | chr17 | 29662024 | 29662024 | – | A | NF1 | A1994fs | 36.54 | 0 | 0 | NO | 3309 | 0 |
| 355 L | chr2 | 209113113 | 209113113 | G | T | IDH1 | R132S | 40 | 33 | 43 | YES | 2736 | 45.1 |
| 355 L | chr2 | 25468187 | 25468187 | A | C | DNMT3A | C497G | 29.27 | 25 | 48.08 | YES | 646 | 44.8 |
| 340 P | chr2 | 25457242 | 25457242 | C | T | DNMT3A | R882H | 11 | 7 | 50 | YES | 1172 | 57.3 |
| 340 P | chr5 | 170837543 | 170837543 | – | TCTG | NPM1 | L287fs | 40 | 0 | nd | YES | 698 | 36.5 |
| 340 P | chr13 | 28608244 | 28608244 | – | 1* | FLT3 | 2* | nd | 0 | nd | YES | 10884 | 1.9 |
| 340 P | chr17 | 7577548 | 7577548 | C | T | TP53 | G206S | 61.9 | 0 | 0 | YES | 5151 | 0.6 |
| 340 P | chr11 | 32417914 | 32417914 | – | T | WT1 | R380fs | 50.53 | 0 | 32.14 | YES | 6096 | 38.9 |
| 584 P | chr5 | 170837543 | 170837543 | – | TCTG | NPM1 | L287fs | nd | 0 | nd | YES | 553 | 40.3 |
| 584 P | chr2 | 25457252 | 25457252 | T | C | DNMT3A | N879D | 20 | 37 | 47.62 | YES | 1133 | 62.5 |
| 584 P | chr2 | 209113112 | 209113112 | C | T | IDH1 | R132H | 31.94 | 0 | 0 | NO | 3550 | 0 |
| 584 P | chr4 | 55599321 | 55599321 | A | T | KIT | D816V | 30.9 | 0 | 0 | NO | 16031 | 0 |
| 1019 P | chr5 | 170837545 | 170837545 | NPM1 | L287fs | nd | 0 | nd | YES | 423 | 21.7 | ||
| 1019 P | chr2 | 25457242 | 25457242 | C | T | DNMT3A | R882H | 68.75 | 0 | 66.67 | YES | 862 | 49.4 |
| 1019 P | chr2 | 209113112 | 209113112 | C | T | IDH1 | R132H | 45.45 | 0 | 0 | YES | 4553 | 0.2 |
1* TCCCATTTGAGATCATATTCATATTCTCTGAAATCAACGTAG
2* E604delinsDYVDFREYEYDLKWE
L NPM1mut loss patient, P NPM1mut persistent patient, VAF variant allele frequency, WES whole exome sequencing, nd not detected with exome sequencing
Fig. 4Mutation types before and after chemotherapy in NPM1mut loss and persistent pts. a Frequency of transversions (A to C, A to T, C to A, and C to G) and transitions (A to G and C to T). b Proportion of transversions in NPM1mut loss diagnosis (rose) and relapse (pink) samples and NPM1mut persistent diagnosis (light blue) and relapse (dark blue) samples
Fig. 5Heatmap of differentially expressed genes and GSEA of diagnosis versus relapse NPM1mut loss samples. a Differentially expressed genes (significant at 0.05 level of the univariate test) from RNA-Seq were assessed using the ClassComparison option from BRB-ArrayTools. Blue indicates upregulation and red downregulation between groups. b Diagnosis samples show enrichment of MYC_UP.V1_UP and BIOCARTA_CELLCYCLE_PATHWAY gene sets. c Relapse samples were enriched in KEGG_MAPK_SIGNALING_PATHWAY, WNT_UP.V1_UP gene sets and genes which are downregulated in NPM1mut samples (VERHAAK_AML_WITH_NPM1_MUTATED_DN). ES, enrichment score; FDR, false discovery rate; NES, normalized enrichment score
Fig. 6Flow cytometry of total and active CTNNB1 in diagnosis samples of NPM1mut loss and NPM1mut persistent pts. Higher expression of a CTNNB1 total, b CTNNB1 8e7 in 3 NPM1mut persistent diagnosis samples compared to 4 NPM1mut loss diagnosis samples, and c mean fluorescent intensity (MFI) including all data points, data is presented as mean ± s.d
Fig. 7Remission duration of NPM1mut loss and persistent pts. Pts with NPM1mut loss (red) had a significantly longer remission duration compared to pts maintaining NPM1mut (black) at relapse
Fig. 8Possible mechanisms of relapse in NPM1mut AML. a Based on our mutation data we postulate different mechanisms of relapse for NPM1mut loss and NPM1mut persistent pts. b Variant allele frequency plots of mutated genes from exemplary pts for each group
Clinical characteristics of 129 NPM1mut patients at diagnosis
| Variable | No. | % | |
|---|---|---|---|
| Age, years | |||
| Median | 54 | ||
| Range | 25–78 | ||
| Sex | |||
| Female | 64 | 50 | |
| Male | 65 | 50 | |
| AML history | |||
| De novo | 108 | 84 | |
| tAML | 2 | 2 | |
| Not available | 19 | 15 | |
| Cytogenetics | |||
| CN | 102 | 79 | |
| Deletion 9q | 5 | 4 | |
| Others | 3 | 2 | |
| Not available | 19 | 15 | |
| NPM1 mutation type | |||
| A | 100 | 78 | |
| B | 12 | 9 | |
| D | 9 | 7 | |
| Others | 8 | 6 | |
| WBC count, ×10 | |||
| Median | 20 | ||
| Range | 1–279 | ||
| BM Blasts, % | |||
| Median | 80 | ||
| Range | 20–100 | ||
| Induction cycles, | |||
| 1 | 16 | 12 | |
| 2 | 113 | 88 | |
| Remission status after first induction cycle ( | |||
| CR/CRi | 97 | 75 | |
| PR | 31 | 24 | |
| RD | 1 | 1 | |
| Remission status after second induction cycle ( | |||
| CR | 112 | 87 | |
| Relapse | 1 | 1 | |
| Consolidation therapy ( | |||
| High-dose Cytarabine | 114 | 88 | |
| Allogeneic SCT | 9 | 7 | |
| Autologous SCT | 4 | 3 | |
| Overall survival, days | |||
| Median | 535 | ||
CN cytogenetically normal, WBC white blood cell, BM bone marrow, CR complete remission, CRi complete remission with incomplete hematologic recovery, PR partial remission, RD refractory disease, SCT stem cell transplantation