Literature DB >> 31031947

Molecular basis underlying the successful invasion of hexaploid cytotypes of Solidago canadensis L.: Insights from integrated gene and miRNA expression profiling.

Chanchan Xu1, Yimeng Ge1, Jianbo Wang1.   

Abstract

Dissecting complex connections between cytogenetic traits (ploidy levels) and plant invasiveness has emerged as a popular research subject in the field of invasion biology. Although recent work suggests that polyploids are more likely to be invasive than their corresponding diploids, the molecular basis underlying the successful invasion of polyploids remains largely unexplored. To this end, we adopted an RNA-seq and sRNA-seq approach to describe how polyploids mediate invasiveness differences in two contrasting cytotypes of Solidago canadensis L., a widespread wild hexaploid invader with localized cultivated diploid populations. Our analysis of the leaf transcriptome revealed 116,801 unigenes, of which 12,897 unigenes displayed significant differences in expression levels. A substantial number of these differentially expressed unigenes (DEUs) were significantly associated with the biosynthesis of secondary metabolites, carbohydrate metabolism, lipid metabolism, and environmental adaptation pathways. Gene Ontology term enrichment-based categorization of DEU-functions was consistent with this observation, as terms related to single-organism, cellular, and metabolic processes including catalytic, binding, transporter, and enzyme regulator activity were over-represented. Concomitantly, 186 miRNAs belonging to 44 miRNA families were identified in the same leaf tissues, with 59 miRNAs being differentially expressed. Furthermore, we discovered 83 miRNA-target interacting pairs that were oppositely regulated, and a meticulous study of these targets depicted that several unigenes encoding transcription factors, DNA methyltransferase, and leucine-rich repeat receptor-like kinases involved in the stress response were greatly influenced. Collectively, these transcriptional and epigenetic data provide new insights into miRNA-mediated gene expression regulatory mechanisms that may operate in hexaploid cytotypes to favor successful invasion.

Entities:  

Keywords:  Solidago canadensis L.; invasiveness; miRNA; ploidy; polyploid; transcriptome

Year:  2019        PMID: 31031947      PMCID: PMC6476842          DOI: 10.1002/ece3.5084

Source DB:  PubMed          Journal:  Ecol Evol        ISSN: 2045-7758            Impact factor:   2.912


INTRODUCTION

Amid growing evidence of biological invasion impacts on global biodiversity, ecosystem functioning, species conservation, and even social and economic activities (Dyer et al., 2017; Rejmánek, 2015), there is mounting interest in searching the determining elements underlying the successful invasion of alien species. A key element associated with successful invasion of alien species is their capacity for rapid adaptation to environmental challenges following introduction (Huang et al., 2017). Identifying critical traits that benefit this rapid environmental adaptation is therefore a talking point for conservation concern as it can create greater opportunities to predict the invasion risk related to diverse alien species. A steady stream of ecological research in recent years has identified a variety of shared ecological traits related to invasiveness among invasive alien species, such as increased growth and fecundity, wide ecological tolerance, high fitness, and strong clonal propagation (Richardson & Pyšek, 2008). As ecological traits have not generated an explicit recognition pattern in plant invasiveness, some invasion biologists have switched from ecological traits to genetic or genomic traits in comprehending patterns of plant invasiveness (Hodgins, Lai, Nurkowski, Huang, & Rieseberg, 2013; Prentis & Pavasovic, 2013; Rius & Darling, 2014). For instance, Rius and Darling (2014) showed that genetic admixture may act as a genuine driver to play central roles in the successful invasion of genetically admixed individuals. Likewise, another related study performed on invasive alien plants showed a statistical connection between ploidy level and invasiveness, concluding that polyploid plants were more likely to be invasive than diploids and that ploidy level (and chromosome number) was positively related to plant invasiveness (Pandit, Pocock, & Kunin, 2011; Pandit, White, & Pocock, 2014). Polyploids, recognized as organisms that possess more than two complete sets of chromosomes in their somatic cells, have often been suggested to represent a powerful driver in the speciation, evolution, and adaptation of plants, with far‐reaching ecological and evolutionary consequences. On the other hand, polyploids often appear to be over‐represented in invasive plants (Thébault, Gillet, Müller‐Schärer, & Buttler, 2011) and have cumulatively been acknowledged as a latent advantageous attribute of plant invaders (Pandit et al., 2011; te Beest et al., 2012). Furthermore, the influences of polyploids can act as a cascade process that directly or indirectly mediates virtually all aspects of plant genetics, morphology, physiology, life history, and ecology (Levin, 1983). Therefore, many evolutionary biologists believe that polyploids provide introduced plants with new features that permit them to invade largely varied environments or expand their geographical range. However, this hypothesis has not yet been proved efficiently. Ecological studies have conventionally focused on comparing clearly relevant diploid and polyploid in their native and introduced ranges (Hahn, Buckley, & Müller‐Schärer, 2012), but few studies have elucidated the molecular basis underlying the invasiveness difference in alien plants with different ploidy levels (cytotypes). Therefore, the genetic and epigenetic impact imposed by ploidy alteration remains elusive. Studies on natural and synthetic polyploids have repeatedly revealed that rapid and dynamic changes at the genetic, gene expression, and epigenetic levels occur after polyploid formation (Chen, 2007; Jackson & Chen, 2010; Sun, Wu, et al., 2017). Likewise, evidence is also mounting that epigenetic modifications can change gene expression and reconstruct gene expression networks thus resulting in pronounced phenotypic alterations (Hao, Lucero, Sanderson, Zacharias, & Holbrook, 2013; Song & Chen, 2015) and allowing polyploids to occupy new habitats, grow vigorously and improve adaptation in novel environments (Madlung, 2013). As an extensive type of epigenetic modifications in nonmodel organisms, miRNA has attracted considerable concern due to its regulatory mechanisms for gene expression. Additionally, miRNA is highly conserved in evolution but becomes activated in polyploidization (Axtell, 2008; Ha et al., 2009). More importantly, alterations in miRNA expression can mediate their target‐gene expression at the post‐transcriptional level, and this effect is viewed as one of the main reasons for phenotypic changes of polyploids (Chen, 2007; Ha et al., 2009). Accordingly, elucidating the divergences in gene and miRNA expression between different ploidy levels (cytotypes) of alien plants and how they influence phenotypic differentiation is crucial to explain how polyploids might have contributed to successful invasion. Herein, we evaluate the effect of polyploids on gene and miRNA expression while also considering the potential roles of miRNA‐mediated gene expression regulation in driving differences in invasiveness between diploid and hexaploid cytotypes of Solidago canadensis L. Specifically, the objectives of our current work are as follows: (a) to characterize the initial expression profiling of genes and miRNAs in two identified ploidy levels, that is, diploid and hexaploid cytotypes of S. canadensis at a genome‐wide scale; (b) to determine key candidate genes and miRNA regulators that may contribute to the successful invasion of hexaploid cytotypes based on gene and miRNA expression divergences, as well as over‐represented functional categories of these candidates; and (c) finally to explore the strong evidence for the potential genetic roles of epigenetic and transcriptional alterations in the successful invasion of hexaploid cytotypes. To this end, we adopted an RNA‐seq and sRNA‐seq approach to investigate the divergences of gene and miRNA expression between diploid and hexaploid cytotypes of S. canadensis. Furthermore, we constructed a co‐expression network of differentially expressed genes and miRNAs to shed light on the regulatory action of miRNAs. Taken together, our work provides new insights into miRNA‐mediated gene expression regulatory mechanisms that may be useful to explain the successful invasion of hexaploid cytotypes.

MATERIALS AND METHODS

Study species

Solidago canadensis (Asteraceae), a perennial weed native to North America (Werner, Bradbury, & Gross, 1980) where it exists in a diploid, tetraploid, or hexaploid cytotype (Melville & Morton, 1982), has invaded a wide geographical range globally, including New Zealand, Australia, Europe, and Asia (Abhilasha, Quintana, Vivanco, & Joshi, 2008; Szymura, Szymura, Wolski, & Swierszcz, 2018). Introduced into eastern China in the 1930s as an ornamental plant, S. canadensis began to escape cultivation and spread in the 1980s. Currently, it has become highly abundant and has noticeably affected the diversity and richness of native plant species (Wang, Jiang, Zhou, & Wu, 2018). However, it is worthwhile noting that, only hexaploid cytotypes of S. canadensis have long been convincingly reported to occur widely in the introduced range in China and become invasive thus far (Wang, 2016). Their corresponding diploid cytotypes (also called “Huang Ying” in China) were cultivated mainly in Yunnan Province in southwestern China as an important cut‐flower plant. An earlier experiment carried out with common gardens showed that the growth of hexaploid cytotypes of S. canadensis was more vigorous than their related diploids, offering clear advantages for the successful invasion of hexaploid cytotypes (Li, 2011). Additionally, the roots, stems, and leaves of hexaploid cytotypes were morphologically and anatomically distinct from their diploids (Wang, 2007). Overall, the contrasting invasive propensities and geographical and phenotypic differentiation between hexaploid cytotypes and their related diploids make S. canadensis an excellent study system to answer such questions as how polyploids both affect gene and miRNA expression and alter molecular pathways that may be responsible for the successful invasion of hexaploid cytotypes and whether miRNA plays key roles in reprogramming the transcriptional expression.

Population sampling and chromosome counting

Invasive populations of S. canadensis largely cluster around the Yangtze River Delta, which occupies its main distribution range in China (Figure 1, Figure A1 in Appendix), and cultivated populations were narrowly cultivated in Yunnan Province in southwestern China. Therefore, we sampled invasive populations (separated from each other by at least 3 km) in 42 locations throughout Jiangsu, Zhejiang, Anhui, Hubei, and Shanghai and one cultivated population from Yunnan Province (Table 1; Figure 1). Finally, 449 sampled individuals representing 43 populations were collected and subsequently transplanted into pots with commercial soil and grown for 3 months in the greenhouse of Wuhan University under natural photoperiod conditions. Chromosome counting was performed according to the modified carbol fuchsin squash method (The detailed methods are presented in Supporting Information Appendix S1).
Figure 1

Map of China sampling sites for 43 populations of S. canadensis described in Table 1. The circles indicate sampling locations. The blue and yellow circles show the diploid and hexaploid populations used in gene and miRNA expression analyses, respectively

Figure A1

A photograph of one invasive population of S. canadensis in eastern China

Table 1

Geographical coordinates and sample size of 43 populations of S. canadensis in China

No.Population codeLocationGeographical coordinatesStatusNo.of samplesChromosome number
Latitude (N)Longitude (E)
1MH 1Minhang District, Shanghai CityN31°08′41.40″E121°23′19.51″Invasive1054
2MH 2Minhang District, Shanghai CityN31°09′54.98″E121°20′53.35″Invasive1054
3MH 3Minhang District, Shanghai CityN31°13′02.09″E121°18′33.51″Invasive1054
4SJ 1Songjiang District, Shanghai CityN31°05′37.02″E121°11′39.99″Invasive1054
5SJ 2Songjiang District, Shanghai CityN31°06′01.76″E121°12′17.63″Invasive1054
6PDPudong District, Shanghai CityN31°15′14.57″E121°38′25.04″Invasive1054
7GYGuanyun County, Lianyungang City, Jiangsu ProvinceN34°23′34.49″E119°14′15.33″Invasive854
8XPXinpu District, Lianyungang City, Jiangsu ProvinceN34°38′24.10″E119°11′06.86″Invasive854
9YD 1Yandu District, Yancheng City, Jiangsu ProvinceN33°18′14.48″E120°06′26.04″Invasive854
10YD 2Yandu District, Yancheng City, Jiangsu ProvinceN33°18′15.30″E120°06′45.48″Invasive854
11DFDafeng District, Yancheng City, Jiangsu ProvinceN33°10′44.02″E120°22′23.67″Invasive854
12TC 1Taicang City, Jiangsu ProvinceN31°32′16.26″E121°07′48.35″Invasive1054
13TC 2Taicang City, Jiangsu ProvinceN31°26′51.43″E121°06′33.75″Invasive1054
14KSKunshan City, Jiangsu ProvinceN31°13′49.32″E121°01′35.66″Invasive1054
15BH 1Binhu District, Wuxi City, Jiangsu ProvinceN31°32′01.06″E120°09′22.39″Invasive1054
16BH 2Binhu District, Wuxi City, Jiangsu ProvinceN31°29′51.43″E120°24′50.49″Invasive1054
17BH 3Binhu District, Wuxi City, Jiangsu ProvinceN31°29′27.02″E120°27′01.11″Invasive1054
18WJWujin District, Changzhou City, Jiangsu ProvinceN31°31′26.74″E120°03′33.15″Invasive1054
19QXQixia District, Nanjing City, Jiangsu ProvinceN32°06′50.22″E118°52′17.00″Invasive1054
20XW 1Xuanwu District, Nanjing City, Jiangsu ProvinceN32°05′46.33″E118°53′07.09″Invasive1054
21XW 2Xuanwu District, Nanjing City, Jiangsu ProvinceN32°05′21.80″E118°50′13.38″Invasive1054
22PKPukou District, Nanjing City, Jiangsu ProvinceN32°04′20.65″E118°36′43.51″Invasive1054
23JGJianggan District, Hangzhou City, Zhejiang ProvinceN30°17′29.55″E120°14′22.75″Invasive1254
24XS 1Xiaoshan District, Hangzhou City, Zhejiang ProvinceN30°11′33.37″E120°16′23.98″Invasive1054
25XS 2Xiaoshan District, Hangzhou City, Zhejiang ProvinceN30°16′30.02″E120°17′05.09″Invasive1154
26XS 3Xiaoshan District, Hangzhou City, Zhejiang ProvinceN30°07′19.58″E120°15′41.75″Invasive954
27BJ 1Binjiang District, Hangzhou City, Zhejiang ProvinceN30°10′18.65″E120°08′13.93″Invasive954
28BJ 2Binjiang District, Hangzhou City, Zhejiang ProvinceN30°09′26.83″E120°08′07.79″Invasive1254
29XHXihu District, Hangzhou City, Zhejiang ProvinceN30°08′28.35″E120°04′20.74″Invasive1054
30NH 1Nanhu District, Jiaxing City, Zhejiang ProvinceN30°45′04.50″E120°44′21.24″Invasive1354
31NH 2Nanhu District, Jiaxing City, Zhejiang ProvinceN30°43′32.96″E120°44′53.83″Invasive1054
32HNHaining City, Zhejiang ProvinceN30°26′47.84″E120°23′35.61″Invasive954
33JH 1Jinghu District, Wuhu City, Anhui ProvinceN31°21′35.87″E118°22′52.54″Invasive1254
34JH 2Jinghu District, Wuhu City, Anhui ProvinceN31°22′10.33″E118°22′13.17″Invasive1254
35SS 1Sanshan District, Wuhu City, Anhui ProvinceN31°13′15.10″E118°13′19.19″Invasive1254
36SS 2Sanshan District, Wuhu City, Anhui ProvinceN31°12′54.60″E118°16′31.88″Invasive1254
37LMLion Mountain District, Tongling City, Anhui ProvinceN30°55′23.64″E117°51′06.76″Invasive1254
38GC 1Guichi District, Chizhou City, Anhui ProvinceN30°36′19.83″E117°30′10.12″Invasive1254
39GC 2Guichi District, Chizhou City, Anhui ProvinceN30°37′35.69″E117°29′16.50″Invasive1254
40HS 1Hongshan District, Wuhan City, Hubei ProvinceN30°32′53.42″E114°31′17.84″Invasive754
41HS 2Hongshan District, Wuhan City, Hubei ProvinceN30°32′36.65″E114°24′53.26″Invasive954
42HS 3a Hongshan District, Wuhan City, Hubei ProvinceN30°32′22.40″E114°25′01.12″Invasive1454
43CGa Chenggong District, Kunming City, Yunnan ProvinceN24°55′05.42″E102°47′51.01″Cultivated2018

Population used in the analyses of gene and miRNA expression.

Map of China sampling sites for 43 populations of S. canadensis described in Table 1. The circles indicate sampling locations. The blue and yellow circles show the diploid and hexaploid populations used in gene and miRNA expression analyses, respectively Geographical coordinates and sample size of 43 populations of S. canadensis in China Population used in the analyses of gene and miRNA expression.

Sample preparation, cDNA and small RNA library construction and sequencing

Based on chromosome survey on the above 43 populations, diploid (population code: CG) and hexaploid cytotypes (HS 3) were selected as the experimental materials for comparison to investigate gene and miRNA expression profiling in this work (Figure 2a,b). Leaves were collected from three independent comparable potted‐seedlings creating three biological replicates for diploid (D) and hexaploid cytotypes (H). The top three to four fully expanded leaves were gently removed in the morning, covered by aluminum foil, frozen in liquid nitrogen immediately, and subsequently stored at −80°C until total RNA extraction. The cDNA and small RNA library were constructed following the methods provided by Beijing Genomics Institute (BGI, Shenzhen, China) (Supporting Information Appendix S1).
Figure 2

Morphological and cytological divergences between diploid (sampled from CG population, 2n = 2x = 18) and hexaploid cytotypes (HS 3 population, 2n = 6x = 54) of S. canadensis. Plant morphology of diploid and hexaploid cytotypes in vegetative stage (a) and reproductive stage (b). Chromosome numbers of diploid (c) and hexaploid cytotypes (d). Population names follow Table 1

Morphological and cytological divergences between diploid (sampled from CG population, 2n = 2x = 18) and hexaploid cytotypes (HS 3 population, 2n = 6x = 54) of S. canadensis. Plant morphology of diploid and hexaploid cytotypes in vegetative stage (a) and reproductive stage (b). Chromosome numbers of diploid (c) and hexaploid cytotypes (d). Population names follow Table 1

De novo assembly and unigene annotation

Raw reads were filtered by removing those reads that contained adaptors, unknown nucleotides (more than 5%), and low‐quality bases (more than 20% of the bases with a quality score less than 15). De novo assembly of all processed reads was performed by Trinity (version: v2.0.6, Grabherr et al., 2011), with parameters set as follows: ‐min_contig_length 200; ‐CPU 8; ‐min_kmer_cov_4; ‐min_glue_4; ‐bfly_opts'‐ V5; ‐edge‐thr=0.1; and ‐stderr'. Then, the constructed transcripts from the Inchworm, Chrysalis, and Butterfly modules of Trinity were further clustered into nonredundant unigenes by using TGICL (version: v2.0.6, Pertea et al., 2003) to eliminate the redundant Trinity‐generated transcripts, with parameters set as follows: ‐I40‐c10‐v25‐O'‐repeat_stringency 0.95‐minmatch 35‐minscore35'. To construct a uniform transcriptome reference, all assembled unigenes from six samples of two cytotypes of S. canadensis were pooled together and further clustered to generate “All‐Unigene” for subsequent assembly evaluation, unigene annotation, and expression analysis. The “All‐Unigene” sequences were aligned by BLASTx to a series of protein databases to gain unigene annotation. See Supporting Information Appendix S1 for more unigene annotation details.

Unigene quantification and differentially expressed unigene (DEU) analysis

The Bowtie2 program (version: v2.2.5, Langmead & Salzberg, 2012) was used to map clean reads from each sample to assemble “All‐Unigene” with the following parameters: ‐q; ‐phred 64; ‐sensitive; ‐dpad 0; ‐gbar 99999999; ‐mp 1,1; ‐np 1; ‐score‐minL,0, ‐0.1‐I1‐X 1000; ‐no‐mixed; ‐no‐discordant; ‐p 1‐k 200, and RSEM (version: v1.2.12, Li & Dewey, 2011) was applied to calculate the read counts mapped to each unigene with the default parameter. Then, fragments per kilobase of transcript per million fragments mapped (FPKM) was applied to normalize the expression value. Differential gene expression analysis was performed using the DESeq2 R package as described by Love, Huber, and Anders (2014) for comparisons between diploid and hexaploid cytotypes with three biological replicates. An absolute value of log2fold‐change ≥2 and an adjusted p‐value <0.001 was set as the threshold to identify DEUs. Following this, identified DEUs were subjected to GO and KEGG analyses. The regulated unigenes were assigned GO terms by the Blast2‐GO program (version: v2.5.0, Conesa et al., 2005), and their enrichment was performed for testing over‐represented GO categories using the GOseq R package with a corrected p‐value (FDR analog) setting of ≤0.05. DEUs were further assigned KO (KEGG Orthology) numbers using the KEGG database, and their enrichment was performed as mentioned for GO.

Transcription factor (TF)‐encoding gene prediction

To identify putative TF candidate genes, getorf (version: EMBOSS: 6.5.7.0, Rice, Longden, & Bleasby, 2000) was used to find and extract open reading frames (ORFs) from all assembled unigene sequences with the minimum size parameter set as 150, and then the sequences of ORFs were searched against the plant transcription factor database (PlnTFDB; version: 3.0) using hmmsearch (version: 3.0, Mistry, Finn, Eddy, Bateman, & Punta, 2013) with the default parameters.

miRNA identification and differentially expressed miRNA (DEM) analysis

Raw reads were filtered by removing low‐quality contaminated reads as well as adaptor sequences, and then generated clean reads in the range of 18–30 nt were chosen for mapping to the S. canadensis mRNA transcriptome by SOAP with default settings. Subsequently, sequences with a perfect match were compared to Rfam 11.0 and NCBI GenBank databases to eliminate noncoding RNAs, including rRNA, scRNA, snRNA, snoRNA, tRNA, and repeats. Given that sequences from S. canadensis were not included in miRBase, the remaining unique reads were searched against currently annotated plant miRNAs (Viridiplantae) available in the miRBase 22.0 database using the BLASTn program to identify the known miRNAs. Transcripts per million was used to normalize the read count of each identified miRNA based on the following formula: Normalized expression = Actual miRNA count × 106/Total count of clean reads. After normalization, differential expression analysis of miRNA was performed using DEGseq as described by Wang, Feng, Wang, Wang, and Zhang (2010). An absolute value of log2fold‐change ≥1 and a q‐value <0.001 was set as the threshold to identify DEMs.

Prediction of miRNA targets

To predict the potential genes targeted by miRNAs, the Targetfinder (version: 1.5, Fahlgren & Carrington, 2010) in combination with psRobot (version: 1.2, Wu, Ma, Chen, Wang, & Wang, 2012) software was applied to predict as many miRNA targets as possible from the assembled S. canadensis unigene set (116,801 “All‐Unigene”) with default parameters. Additionally, the expression level of predicted miRNA targets was taken from the inventory of assembled “All‐Unigene.” GO terms were also evaluated using a similar method.

Visualization of miRNA‐target interaction network

To unravel complex links between candidate miRNAs and unigenes, we proposed a strategy that integrated expression data of DEMs and DEUs to visualize the miRNA‐target interaction network and further discover key miRNAs. Here, we defined coherent miRNA targets as those presenting opposite expression patterns compared with those of the miRNAs, showing that the expression of unigenes was negatively correlated with that of miRNAs (Ye, Wang, & Wang, 2016). To construct the miRNA‐target interaction network, three separate steps were performed. First, DEMs and DEUs were screened following the method mentioned above. Second, predicted targets of up‐regulated miRNAs (down‐regulated miRNAs) overlapped with identified down‐regulated unigenes (up‐regulated unigenes) to obtain coherent miRNA targets. Finally, acquired coherent miRNA targets and DEMs were subjected to visualization of the miRNA‐target interaction network by Cytoscape.

Candidate unigene and miRNA validation via qRT‐PCR

Eighteen promising candidate unigenes and six miRNAs observed to be differentially expressed were chosen for qRT‐PCR to validate the reliability of RNA‐seq and sRNA‐seq results with the following selection criteria: (a) up‐ or down‐regulated unigenes discussed in this paper (i.e., Expansin, ARGOS); and (b) miRNA‐target interaction pairs that were negatively correlated in expression levels. qRT‐PCR was implemented in triplicate on an ABI Step One Plus Real‐Time PCR System (Applied Biosystems) with unigene‐ and miRNA‐specific sense and anti‐sense primer (Table A1 in Appendix, Supporting Information Appendix S1). A homolog of GAPDH (Unigene25510_All) was co‐amplified to normalize the expression values of unigenes and miRNAs in each sample using the double‐standard curve method.
Table A1

Primers designed for qRT‐PCR analysis of unigenes and miRNAs

MiRNA/unigenePrimers
RT primerSense primerAnti‐sense primer
sca‐miR164dGTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGCACGTGCCGCTTGGAGAAGCAGGGCGTGCAGGGTCCGAGGT
sca‐miR165aGTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGGGATGCCGCTTCGGACCAGGCTTCGTGCAGGGTCCGAGGT
sca‐miR166pGTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCTTGAGCCGCTGGAATGTTGTCTGGTGTGCAGGGTCCGAGGT
sca‐miR169dGTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGGCAAGCCGCTTAGCCAAGGATGACGTGCAGGGTCCGAGGT
sca‐miR169eGTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCGGCAGCCGCTCAGCCAAGGATGACTGTGCAGGGTCCGAGGT
sca‐miR396dGTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTTTCCCGCCGCTGTTCAATAAAGCTGTGTGCAGGGTCCGAGGT
Unigene3688_AllTGTAAACGCTTCCGTAAATCAGTGCCACAATAGACAACCCAC
Unigene13166_AllGGATGGAGTAAGCCGAGGATGAAGTGACCGTGACAATGACC
CL3766.Contig4_AllTCTGGTTTCCGTATCATTCCTCCGATGCGATGTCCCTAA
CL4387.Contig1_AllCTGGCTGTCATCACCTTTGGCCTCTAACTGCTGCTGCGTAT
CL6884.Contig1_AllAGCATACCCAGTAGCAAACCGTCAAAGATGATTGGAAAGGCAC
CL12537.Contig2_AllTTCAGACATAAGGGAAGGTGGTATCCGAAAATGAGATAAGAGGC
Unigene30116_AllACTGCCGTCTCCGATTTATGCTGCTTATGTATGCCTCTGTCTTC
Unigene21625_AllAGACAGAGGCATACATAAGCAGGACACCCAAAGGGGAGACCA
CL7649.Contig3_AllGAAGACAGAGGCATACATAAGCAGACACCCAAAGGGGAGACCA
CL2151.Contig12_AllTCGCTCAGGGTATTCAGGTCATTTCACGGAAGGGGTT
CL5929.Contig3_AllCTAACTGGAGTATCGCCGTGTCCGGGTCATTCGCTTCTTTG
CL8246.Contig1_AllCAAGCCCTTCATCCATCTATTCAAACCCCATTTCCCTCA
CL17048.Contig1_AllGAGTTCAGGGATGTATGGAGGTTGATGATAGTTGTCCGCACAGATT
Unigene38227_AllCGTAATAAGCAGGTGGCATCACAAGCATTTTCCCAGCAGAGT
CL12301.Contig3_AllTGGAAGAACCATCACGAGCAACACTACGACCCGAACGA
CL15040.Contig2_AllCGACACCGTTAGTCCAAGCAGACAACAAAGGCGGCATACA
CL15841.Contig1_AllTGTAAGGCAAAGGCACTGGGCGGCTTCTTCGGCTGTATCA
Unigene2041_AllCGGGGTCTTTACAGGTTACTCGTGTGCTCCACTCCAGCGTTT
GAPDHTAAGGTCGTCGCTTGGTATCTTCTTCGGATGGGTTC

RESULTS

Gene expression profiling in diploid and hexaploid cytotypes of S. canadensis

The inspection of chromosome numbers revealed that two cytotypes were ascertained among the 449 individuals of S. canadensis examined. For the cultivated population, all individuals were observed to be diploid cytotypes with a chromosome number of 2n = 2x = 18 (Figure 2c). For the invasive populations, all individuals were observed to be hexaploid cytotypes with a chromosome number of 2n = 6x = 54 (Table 1; Figure 2d). However, tetraploid cytotypes with a chromosome number of 2n = 4x = 36 or mixed‐cytotypes reported by Li (2011) were not found in the current work. To explore key candidate genes behind the invasiveness differences in diploid and hexaploid cytotypes, we generated the first transcriptomic profile of S. canadensis. A total of 334.79 million (M) raw reads were produced and subjected to Seq‐QC collating, which resulted in 289.45 M (86%) clean reads with Q20 values ranging from 98.88% to 98.94%. Then, clean reads from six libraries were de novo assembled separately into unigenes by Trinity. These assembled unigenes were pooled together and further clustered into a reference transcriptome (116,801 “All‐Unigene”) with an average length of 1,056 bp, a N50 value of 1,610 bp, and a GC content of 39.20% (Table A2 in Appendix). These numbers are comparable to those generated in other polyploid studies (e.g., Vigna et al., 2016; Zhou et al., 2015) and imply a high‐quality assembly. Furthermore, we also found that the length distribution of the assembled “All‐Unigene” ranged from 224 to 23,608 bp with a total length of 123,376,557 bp, of which 32,942 (28.20%) unigenes ranged from 300 to 500 bp, 32,696 (27.99%) unigenes ranged from 500 to 1,000 bp, 33,468 (28.65%) unigenes ranged from 1,000 to 2,000 bp, and 17,695 (15.15%) unigenes had lengths longer than 2,000 bp (Figure A2 in Appendix).
Table A2

Overview of sequencing data of trinity‐assembled S. canadensis transcriptome

CategoryD1D2D3H1H2H3
Raw reads (Mb)55,530,16255,530,38855,530,27457,163,62455,530,28855,511,070
Clean reads (Mb)48,699,93448,275,08848,972,39048,416,76048,261,97246,824,558
Q20 (%)98.9498.8998.8998.8998.9498.88
Unigenes55,76956,00158,47157,86758,15256,528
Mean length965949953944904950
N501,4581,4031,4331,4491,3771,455
GC (%)39.6739.5939.6239.8039.8439.81

D1‐D3 and H1‐H3 correspond to diploid and hexaploid cytotypes of S.canadensis, respectively.

Figure A2

Length distribution of the assembled “All‐Unigene”

Out of the 116,801 “All‐Unigene” acquired above, expression of 12,428 unigenes was found only in diploid cytotypes, and expression of 19,520 unigenes was observed only in hexaploid cytotypes. These seem to represent a suite of ploidy‐dependent unigenes, which means a specific role of these ploidy‐dependent unigenes in contrasting invasiveness differences. Subsequently, to identify notably changed unigenes, we applied the aforementioned filter criterion and noticed that 12,897 unigenes displayed at least a four‐fold change in expression levels, with the majority of them (6,768 out of 12,897) down‐regulated in hexaploid cytotypes (Supporting Information Table S1). After that, these DEUs were further subjected to investigation of the specific regulated pathways in which they were involved. However, it must be underlined here that our work has revealed novel unigenes whose functions are unknown, which will be the long‐running theme of future research. Furthermore, qRT‐PCR analysis performed for eighteen DEUs confirmed the mRNA changes detected by RNA‐seq (Figure A3 in Appendix).
Figure A3

Quantitative qRT‐PCR analysis data of selected ploidy‐responsive 18 unigenes in S. canadensis. Error bars represent the standard deviations of three qRT‐PCR replicates. Corresponding coherent miRNAs are indicated in brackets

Further, the identified 2,644 putative TF‐encoding genes in this work were assigned to 58 TF families, of which MYB members (337) were over‐represented, followed by MYB‐related (270), AP2‐EREBP (211), bHLH (134), and WRKY family members (120). In addition, we discovered 381 TF‐encoding genes that were differentially expressed, with the majority being up‐regulated in hexaploid cytotypes. Notably, among these differentially expressed TF‐encoding genes, almost all the members of the bHLH group were found to be up‐regulated (12/15 genes) in hexaploid cytotypes. In addition, MYB (32/53), MYB‐related (31/47), ARF (10/16) and Trihelix (9/12) members exhibited a similar trend. However, the majority of TF‐encoding genes belonging to the WRKY (18/26) and NAC (13/17) families were down‐regulated in hexaploid cytotypes (Figure 3). These TF genes had differential expression patterns, implying a variety of regulatory modes.
Figure 3

A bar graph representing the differential expression of TF‐encoding genes in diploid and hexaploid cytotypes of S. canadensis. Yellow indicates the up‐regulated genes and blue down‐regulated genes in hexaploid cytotypes

A bar graph representing the differential expression of TF‐encoding genes in diploid and hexaploid cytotypes of S. canadensis. Yellow indicates the up‐regulated genes and blue down‐regulated genes in hexaploid cytotypes

Functional and pathway analysis of ploidy‐responsive unigenes in S. canadensis

To better understand the functionality of unigenes differentially expressed in response to ploidy, we mapped the above‐mentioned DEUs to the GO and KEGG databases to perform functional analyses and found that a total of 4,545 (35.24%) unigenes from the 12,897 DEUs were successfully classified into three major functional categories: biological process (3,171), molecular function (3,536), and cellular component (2,764). Then, the three major categories were further assigned to 50 terms (Figure A4a in Appendix), including 21 terms in the biological process, 14 terms in the molecular function, and 15 terms in the cellular component categories. The most abundant GO term related to biological process was “metabolic process” represented by 2,374 DEUs, followed by “cellular process,” “single‐organism process,” “localization,” “biological regulation,” and “response to stimulus” represented by 2,243, 1,741, 568, 501, and 462 DEUs, respectively. In the molecular function category, the two main representative distributions were “catalytic activity” (2,501) and “binding” (1,904). Other GO terms, such as “transporter activity,” “enzyme regulator activity,” “structural molecule activity,” “antioxidant activity,” “receptor activity” and “channel regulator activity,” associated with the biosynthesis of secondary metabolites were also enriched. With respect to the cellular component category, a large proportion of DEUs were clustered in “cell” (1,824), “cell part” (1,808), “membrane” (1,516), and “organelle” (1,264).
Figure A4

GO‐based functional annotation of differentially expressed unigenes (a) and predicted targets of differentially expressed miRNAs (b)

In addition, we also found that 8,666 DEUs were assigned to 133 unique KEGG pathways, with 5,705 representing metabolism pathways, 2,006 pathways in genetic information processing, 469 pathways in cellular process, 418 pathways in environmental information processing, and 415 pathways in organismal systems (Figure A5 in Appendix). Notably, there were only two pathways that were significantly over‐represented under “organismal systems,” that is, “circadian rhythm‐plant” and “plant‐pathogen interaction.” The most represented pathway in DEUs was “metabolic pathways,” followed by “biosynthesis of secondary metabolites,” “plant‐pathogen interaction,” “RNA transport,” and “spliceosome.” Subsequently, the hypergeometric distribution was calculated to identify significantly enriched pathways in which DEUs were involved. A total of eight pathways associated with metabolism were significantly enriched, with a Q value ≤0.05 (Table A3 in Appendix). It was conspicuous that unigenes related to “metabolic pathways (Pathway ID: ko01100)” were significantly enriched among the DEUs, implying that they may operate in the metabolic adaptation mechanism of hexaploid cytotypes. Additionally, unigenes for carbohydrate metabolism of “pentose and glucuronate interconversions (Pathway ID: ko00040)” were enriched. Moreover, unigenes for lipid metabolism of “fatty acid degradation (Pathway ID: ko00071)” were enriched. Additionally, DEUs involved in the metabolism of terpenoids and polyketides, particularly “carotenoid biosynthesis (Pathway ID: ko00906),” and “sesquiterpenoid and triterpenoid biosynthesis (Pathway ID: ko00909)” were enriched. Finally, “biosynthesis of secondary metabolites (Pathway ID: ko01110),” “isoflavonoid biosynthesis (Pathway ID: ko00943),” and “flavone and flavonol biosynthesis (Pathway ID: ko00944)” were enriched, signifying considerable modulation of unigenes responsible for the regulation of plant secondary metabolites.
Figure A5

Number of unigenes in each clade of the KEGG pathway maps. The unigenes were assigned 133 KEGG pathways within 19 clades under 5 major categories

Table A3

KEGG pathway enrichment analysis of differentially expressed unigenes

No.PathwayDEU number Q valuePathway IDLevel 1
1Biosynthesis of secondary metabolites1,217 (14.04%)9.11E−06ko01110Metabolism
2Carotenoid biosynthesis63 (0.73%)4.40E−05ko00906Metabolism
3Metabolic pathways2,022 (23.33%)1.73E−04ko01100Metabolism
4Sesquiterpenoid and triterpenoid biosynthesis45 (0.52%)1.61E−02ko00909Metabolism
5Fatty acid degradation70 (0.81%)1.79E−02ko00071Metabolism
6Pentose and glucuronate interconversions141 (1.63%)4.00E−02ko00040Metabolism
7Isoflavonoid biosynthesis42 (0.48%)4.00E−02ko00943Metabolism
8Flavone and flavonol biosynthesis44 (0.51%)4.00E−02ko00944Metabolism
9Steroid biosynthesis49 (0.57%)6.31E−02ko00100Metabolism
10Nitrogen metabolism53 (0.61%)6.31E−02ko00910Metabolism
11Anthocyanin biosynthesis22 (0.25%)6.31E−02ko00942Metabolism
12Tryptophan metabolism61 (0.7%)6.31E−02ko00380Metabolism
13Amino sugar and nucleotide sugar metabolism162 (1.87%)6.48E−02ko00520Metabolism
14Tyrosine metabolism59 (0.68%)6.77E−02ko00350Metabolism
15Monobactam biosynthesis28 (0.32%)6.77E−02ko00261Metabolism
16Glutathione metabolism62 (0.72%)7.37E−02ko00480Metabolism
17Arginine and proline metabolism72 (0.83%)9.97E−02ko00330Metabolism
18Lysine biosynthesis28 (0.32%)9.97E−02ko00300Metabolism
19Flavonoid biosynthesis63 (0.73%)9.97E−02ko00941Metabolism
20Indole alkaloid biosynthesis11 (0.13%)1.19E−01ko00901Metabolism
21Ubiquinone and other terpenoid‐quinone biosynthesis57 (0.66%)1.24E−01ko00130Metabolism
22Butanoate metabolism30 (0.35%)1.28E−01ko00650Metabolism
23Degradation of aromatic compounds18 (0.21%)1.30E−01ko01220Metabolism
24Circadian rhythm—plant85 (0.98%)1.36E−01ko04712Organismal Systems
25Valine, leucine and isoleucine degradation80 (0.92%)1.50E−01ko00280Metabolism
26Vitamin B6 metabolism22 (0.25%)1.50E−01ko00750Metabolism
27C5‐Branched dibasic acid metabolism18 (0.21%)1.88E−01ko00660Metabolism
28Nonhomologous end‐joining11 (0.13%)2.09E−01ko03450Genetic Information Processing
29alpha‐Linolenic acid metabolism59 (0.68%)2.09E−01ko00592Metabolism
30Porphyrin and chlorophyll metabolism62 (0.72%)2.09E−01ko00860Metabolism
31Arachidonic acid metabolism32 (0.37%)2.09E−01ko00590Metabolism
32Fatty acid metabolism83 (0.96%)2.09E−01ko01212Metabolism
33Phenylalanine metabolism45 (0.52%)2.09E−01ko00360Metabolism
34Stilbenoid, diarylheptanoid and gingerol biosynthesis63 (0.73%)2.09E−01ko00945Metabolism
35Ether lipid metabolism45 (0.52%)2.14E−01ko00565Metabolism
36Limonene and pinene degradation55 (0.63%)2.27E−01ko00903Metabolism
37Brassinosteroid biosynthesis15 (0.17%)2.27E−01ko00905Metabolism
38Mismatch repair131 (1.51%)2.27E−01ko03430Genetic Information Processing
39Ascorbate and aldarate metabolism68 (0.78%)2.29E−01ko00053Metabolism
40Fatty acid biosynthesis36 (0.42%)2.73E−01ko00061Metabolism
41Glycolysis/ Gluconeogenesis185 (2.13%)2.75E−01ko00010Metabolism
42Isoquinoline alkaloid biosynthesis31 (0.36%)3.55E−01ko00950Metabolism
43ABC transporters122 (1.41%)3.71E−01ko02010Environmental Information Processing
44Pentose phosphate pathway93 (1.07%)3.78E−01ko00030Metabolism
45Nucleotide excision repair151 (1.74%)4.22E−01ko03420Genetic Information Processing
46Riboflavin metabolism19 (0.22%)4.22E−01ko00740Metabolism
47Pantothenate and CoA biosynthesis36 (0.42%)4.33E−01ko00770Metabolism
48Homologous recombination138 (1.59%)4.33E−01ko03440Genetic Information Processing
49Valine, leucine, and isoleucine biosynthesis31 (0.36%)4.33E−01ko00290Metabolism
50Phenylalanine, tyrosine, and tryptophan biosynthesis42 (0.48%)4.36E−01ko00400Metabolism
51Histidine metabolism27 (0.31%)4.36E−01ko00340Metabolism
52Alanine, aspartate, and glutamate metabolism61 (0.7%)4.56E−01ko00250Metabolism
53Folate biosynthesis18 (0.21%)4.75E−01ko00790Metabolism
54Glycerolipid metabolism103 (1.19%)4.86E−01ko00561Metabolism
55Galactose metabolism96 (1.11%)4.88E−01ko00052Metabolism
56Carbon fixation in photosynthetic organisms93 (1.07%)5.74E−01ko00710Metabolism
57DNA replication135 (1.56%)5.80E−01ko03030Genetic Information Processing
58Glycine, serine, and threonine metabolism67 (0.77%)6.39E−01ko00260Metabolism
59Insulin resistance76 (0.88%)6.90E−01ko04931Human Diseases
60Starch and sucrose metabolism248 (2.86%)6.91E−01ko00500Metabolism
61Arginine biosynthesis46 (0.53%)6.91E−01ko00220Metabolism
62Sphingolipid metabolism66 (0.76%)6.95E−01ko00600Metabolism
63Biosynthesis of unsaturated fatty acids38 (0.44%)6.95E−01ko01040Metabolism
64Biosynthesis of amino acids277 (3.2%)8.15E−01ko01230Metabolism
65Proteasome45 (0.52%)8.16E−01ko03050Genetic Information Processing
66 N‐Glycan biosynthesis50 (0.58%)8.32E−01ko00510Metabolism
67Terpenoid backbone biosynthesis57 (0.66%)8.94E−01ko00900Metabolism
68Other types of O‐glycan biosynthesis15 (0.17%)9.08E−01ko00514Metabolism
69Fructose and mannose metabolism70 (0.81%)9.12E−01ko00051Metabolism
70RNA transport299 (3.45%)9.24E−01ko03013Genetic Information Processing
71SNARE interactions in vesicular transport26 (0.3%)9.52E−01ko04130Genetic Information Processing
72Phenylpropanoid biosynthesis125 (1.44%)9.88E−01ko00940Metabolism
73Other glycan degradation77 (0.89%)9.88E−01ko00511Metabolism
74Lysine degradation46 (0.53%)9.88E−01ko00310Metabolism
75Citrate cycle (TCA cycle)48 (0.55%)9.88E−01ko00020Metabolism
76Synthesis and degradation of ketone bodies4 (0.05%)9.88E−01ko00072Metabolism
77Zeatin biosynthesis32 (0.37%)9.88E−01ko00908Metabolism
78Cysteine and methionine metabolism94 (1.08%)9.88E−01ko00270Metabolism
79Nicotinate and nicotinamide metabolism26 (0.3%)9.88E−01ko00760Metabolism
80Glycerophospholipid metabolism110 (1.27%)9.88E−01ko00564Metabolism
81Base excision repair52 (0.6%)9.88E−01ko03410Genetic Information Processing
82Carbon metabolism285 (3.29%)9.88E−01ko01200Metabolism
83Pyruvate metabolism107 (1.23%)9.88E−01ko00620Metabolism
84Basal transcription factors54 (0.62%)9.88E−01ko03022Genetic Information Processing
85Tropane, piperidine, and pyridine alkaloid biosynthesis27 (0.31%)1.00E+00ko00960Metabolism
86Propanoate metabolism40 (0.46%)1.00E+00ko00640Metabolism
872‐Oxocarboxylic acid metabolism70 (0.81%)1.00E+00ko01210Metabolism
88Fatty acid elongation21 (0.24%)1.00E+00ko00062Metabolism
89beta‐Alanine metabolism49 (0.57%)1.00E+00ko00410Metabolism
90Benzoxazinoid biosynthesis6 (0.07%)1.00E+00ko00402Metabolism
91Lipoic acid metabolism3 (0.03%)1.00E+00ko00785Metabolism
92mRNA surveillance pathway177 (2.04%)1.00E+00ko03015Genetic Information Processing
93Sulfur metabolism36 (0.42%)1.00E+00ko00920Metabolism
94Phosphatidylinositol signaling system73 (0.84%)1.00E+00ko04070Environmental Information Processing
95Monoterpenoid biosynthesis19 (0.22%)1.00E+00ko00902Metabolism
96One carbon pool by folate11 (0.13%)1.00E+00ko00670Metabolism
97Aminoacyl‐tRNA biosynthesis73 (0.84%)1.00E+00ko00970Genetic Information Processing
98Selenocompound metabolism17 (0.2%)1.00E+00ko00450Metabolism
99RNA polymerase51 (0.59%)1.00E+00ko03020Genetic Information Processing
100Glycosaminoglycan degradation25 (0.29%)1.00E+00ko00531Metabolism
101Taurine and hypotaurine metabolism2 (0.02%)1.00E+00ko00430Metabolism
102RNA degradation172 (1.98%)1.00E+00ko03018Genetic Information Processing
103Regulation of autophagy49 (0.57%)1.00E+00ko04140Cellular Processes
104Biotin metabolism9 (0.1%)1.00E+00ko00780Metabolism
105Glyoxylate and dicarboxylate metabolism68 (0.78%)1.00E+00ko00630Metabolism
106Oxidative phosphorylation85 (0.98%)1.00E+00ko00190Metabolism
107Inositol phosphate metabolism53 (0.61%)1.00E+00ko00562Metabolism
108Glycosphingolipid biosynthesis—ganglio series16 (0.18%)1.00E+00ko00604Metabolism
109Protein export25 (0.29%)1.00E+00ko03060Genetic Information Processing
110Glucosinolate biosynthesis14 (0.16%)1.00E+00ko00966Metabolism
111Caffeine metabolism1 (0.01%)1.00E+00ko00232Metabolism
112Ribosome161 (1.86%)1.00E+00ko03010Genetic Information Processing
113Ribosome biogenesis in eukaryotes129 (1.49%)1.00E+00ko03008Genetic Information Processing
114Photosynthesis—antenna proteins11 (0.13%)1.00E+00ko00196Metabolism
115Sulfur relay system9 (0.1%)1.00E+00ko04122Genetic Information Processing
116Glycosphingolipid biosynthesis—globo series6 (0.07%)1.00E+00ko00603Metabolism
117Purine metabolism170 (1.96%)1.00E+00ko00230Metabolism
118Peroxisome92 (1.06%)1.00E+00ko04146Cellular Processes
119Linoleic acid metabolism15 (0.17%)1.00E+00ko00591Metabolism
120Photosynthesis24 (0.28%)1.00E+00ko00195Metabolism
121Diterpenoid biosynthesis28 (0.32%)1.00E+00ko00904Metabolism
122Pyrimidine metabolism120 (1.38%)1.00E+00ko00240Metabolism
123Ubiquitin mediated proteolysis124 (1.43%)1.00E+00ko04120Genetic Information Processing
124Phagosome55 (0.63%)1.00E+00ko04145Cellular Processes
125Glycosylphosphatidylinositol(GPI)‐anchor biosynthesis9 (0.1%)1.00E+00ko00563Metabolism
126Thiamine metabolism3 (0.03%)1.00E+00ko00730Metabolism
127Endocytosis279 (3.22%)1.00E+00ko04144Cellular Processes
128Plant‐pathogen interaction330 (3.81%)1.00E+00ko04626Organismal Systems
129Spliceosome299 (3.45%)1.00E+00ko03040Genetic Information Processing
130Protein processing in endoplasmic reticulum261 (3.01%)1.00E+00ko04141Genetic Information Processing
131Cyanoamino acid metabolism50 (0.58%)1.00E+00ko00460Metabolism
132Cutin, suberine and wax biosynthesis25 (0.29%)1.00E+00ko00073Metabolism
133Plant hormone signal transduction223 (2.57%)1.00E+00ko04075Environmental Information Processing

miRNA expression profiling in diploid and hexaploid cytotypes of S. canadensis

A total of 179.9 M 50‐base pair (bp) single‐end raw reads were produced and subjected to Seq‐QC collating, which resulted in 166.6 M (92.6%) clean reads with lengths ranging from 18 to 30 nt (Table A4 in Appendix). The sRNA length distribution in six libraries showed that the majority of reads were distributed between 20 and 24 nt in length, which corresponds to the size from Dicer‐like digestion products. In addition, the most abundant sequence in all six libraries was 24 nt sRNA (average 37.24% vs. 42.31% in D vs. H), followed by 21 nt sRNA (average 20.06% vs. 23.11% in D vs. H) (Figure A6 in Appendix), which was in agreement with the typical size distribution of sRNAs reported in other plant species, such as Arabidopsis (Rajagopalan, Vaucheret, Trejo, & Bartel, 2006), Oryza sativa (Morin et al., 2008), and Citrus trifoliata (Song et al., 2010).
Table A4

Summary of high‐throughput sequencing results of S. canadensis small RNAs

TypesD1D2D3H1H2H3
Total reads29,794,25029,769,38230,089,53129,659,43230,538,66430,082,793
High quality28,662,00828,616,22129,119,62128,456,34829,785,81229,129,419
3′ adapter null857,422939,693774,556955,551942,1211,149,111
Insert null4,8844,4353,1613,29611,65823,691
5′ adapter contaminants20,93618,48725,61125,32926,54330,913
Length small than 18 nt82,118249,833384,77297,260332,130167,214
Poly A9003,6161,1913,2172,4632,386
Clean reads27,695,74827,400,15727,930,33027,371,69528,470,89727,756,104
Figure A6

Size distribution of sRNAs in diploid and hexaploid cytotypes of S. canadensis

We identified 186 miRNAs belonging to 44 miRNA families in two cytotypes of S. canadensis and found that the identified families included a changing count of miRNA members (Supporting Information Table S2). Among the detected miRNAs, the miR166 family possessed the largest number of members, with 26 members that were discriminated by the divergences in nucleotide sequences, followed by miR171, miR167, miR168, miR396, miR156, miR169, miR159, miR319, miR164, miR393, and miR160 families, with 14, 12, 11, 11, 10, 10, 8, 8, 6, 6, and 5 members, respectively. miR398, miR399, and miR858 included four members, and miR390, miR395, and miR403 included three members. Of the remaining 26 miRNA families, 12 families, such as miR157, miR161, and miR162 families, comprised two members, and 14 miRNA families were represented only by a single member each. A further analysis showed that 59 miRNAs were differentially expressed, of which 38 miRNAs were up‐regulated and 21 miRNAs were down‐regulated in hexaploid cytotypes relative to their diploids. Among the DEMs, sca‐miR395c, sca‐miR8155, and sca‐miR6173 were markedly down‐regulated with log2fold‐change values of −3.23 (q = 1.53e−42), −3.15 (q = 1.40e−04) and −2.45 (q = 6.35e−11), respectively, and sca‐miR166p, sca‐miR528, and sca‐miR396a were markedly up‐regulated with log2fold‐change values of 5.16 (q = 7.39e−12), 5.13 (q = 9.36e−07), and 5.04 (q = 5.30e−11), respectively. Notably, for the miR160 and miR169 family, sca‐miR160e, sca‐miR169b, sca‐miR169e, sca‐miR169f, sca‐miR169g, and sca‐miR169h were up‐regulated specifically in hexaploid cytotypes, while sca‐miR160b and sca‐miR169d were up‐regulated specifically in diploid cytotypes. These observations suggested that different members from the same miRNA family had different regulatory modes, probably associated with the cooperative and redundant regulation activity of miRNAs. qRT‐PCR analysis performed for six DEMs confirmed the miRNA changes detected by sRNA‐seq (Figure A7 in Appendix). In addition, correlation between qRT‐PCR results and sequencing results were also calculated. We acquired a significant Pearson “r” close to 0.85 (p < 0.001) (Figure A8 in Appendix), which strongly suggested that our transcriptome and sRNA sequencing data were credible.
Figure A7

Real‐time qRT‐PCR analyses of miRNAs in diploid and hexaploid cytotypes of S. canadensis. The miRNA levels in diploid cytotypes were arbitrarily set as 1. Error bars represent the standard deviations of three qRT‐PCR replicates

Figure A8

Pearson correlation scatter plot of comparisons of log2fold‐change in expression obtained by HiSeq and qRT‐PCR data for unigenes and miRNAs. “r” represents the Pearson correlation coefficient

Unigenes involved in growth‐related pathways are targeted by DEMs

Our analysis revealed 1,801 unigenes from 116,801 assembled S. canadensis “All‐Unigene” were predicted as targets of 184 miRNAs, of which 884 putative targets were predicted to be cleaved by 58 DEMs. Moreover, a meticulous inspection of the DEMs and their corresponding targets indicated that (a) miR5139a had the highest target abundance (179), and (b) the genes such as CL10163.Contig1_All, CL13112.Contig1_All, and Unigene2861_All had the highest miRNA abundance (4). To understand in depth the group of unigenes targeted by DEMs, GO functional analysis of the predicted targets was carried out. Under the biological process category of GO classification, unigenes involved in terms such as “cellular process,” “metabolic process,” “single‐organism process,” “response to stimulus,” etc. were abundantly enriched as the targets of DEMs. Under the molecular function category, unigenes displaying “catalytic activity,” “binding,” “transporter activity,” etc. were targeted by miRNAs. Moreover, “cell,” “membrane,” “organelle,” etc. related unigenes were discovered to be clustered into the cellular component category as targets (Figure A4b in Appendix). In further pathway analysis of 884 putative targets, “cutin, suberin and wax biosynthesis (Pathway ID: ko00073),” “protein processing in endoplasmic reticulum (Pathway ID: ko04141),” “plant hormone signal transduction (Pathway ID: ko04075),” “selenocompound metabolism (Pathway ID: ko00450)” and “cysteine and methionine metabolism (Pathway ID: ko00270)” pathways were significantly enriched with a Q value ≤0.05. These results suggest that miRNAs were more likely to activate plant primary metabolism and make contributions to the improved vigor shown by hexaploid cytotypes, as it has been noted earlier that hexaploid cytotypes typically exhibited enhanced growth in comparison with diploids.

Integrative analysis of gene and miRNA expression confirms that environmental adaptation‐related unigenes are centrally targeted

To detect which biological processes or pathways within a cell were most likely regulated by miRNAs, we integrated overall gene and miRNA expression data to identify miRNA‐target interacting pairs that were negatively correlated in log2fold‐change between DEMs and target mRNA expression. As a result, 83 miRNA‐target interacting pairs with the involvement of 24 DEMs and 69 targets were visualized by Cytoscape. For each such pair, we then classified 83 miRNA‐target interacting pairs into two categories depending on the expression patterns of DEMs as either up‐regulated or down‐regulated, respectively, for 47 miRNA‐target pairs involved in 10 down‐regulated miRNAs and 34 up‐regulated targets; or 36 miRNA‐target pairs involved in 14 up‐regulated miRNA and 35 down‐regulated targets (Figure 4). Furthermore, we have also taken note that the coherent miRNA targets included (a) several TFs that were predicted to be targeted by miRNA regulators, for example, sca‐miR164d targets FAR1, sca‐miR530 targets MYB, sca‐miR396a targets Trihelix, and sca‐miR5139a targets VOZ1‐like, suggesting that these miRNAs may operate to enhance the adaptation of hexaploid cytotypes through an integrative miRNA‐TF‐mRNA regulatory network; (b) receptor‐like protein kinases (RLKs) that were predicted to be targets of multiple miRNAs such as sca‐miR161a, sca‐miR5139a, sca‐miR5139b, and sca‐miR8155. This target is an important enzyme gene and functions in regulating plant growth, development, signal transduction, immunity, and stress responses (Sun, Li, Wang, Zhang, & Wu, 2017). Notably, these RLK genes were remarkably up‐regulated in hexaploid cytotypes, suggesting that their regulator miRNAs may play key roles in the environmental adaptation of hexaploid cytotypes; (c) unigenes associated with methylation and ubiquitination processes, such as histone‐lysine N‐methyltransferase (CL7649.Contig3_All), ubiquitin‐protein ligase (CL2235.Contig13_All), U‐box domain‐containing protein (CL2207.Contig4_All), and F‐box protein (Unigene1223_All), that were predicted to be targets of sca‐miR396d, sca‐miR444a, sca‐miR393d, and sca‐miR5139a, suggesting that these unigenes may be subjected to miRNA‐mediated DNA methylation and ubiquitination; and (d) two dirigent protein genes (CL6884.Contig1_All and CL6884.Contig3_All) that were predicted to be targets of sca‐miR169d. This target was an unspecific oxidizing enzyme gene for radical formation that functions in lignan biosynthesis, which was previously reported to be an integral regulator of plant secondary metabolism (Effenberger et al., 2015). Notably, these dirigent protein genes were remarkably up‐regulated in hexaploid cytotypes, suggesting that its regulator sca‐miR169d may play key roles in plant secondary metabolism (Table A5 in Appendix).
Figure 4

miRNA‐gene interaction network of S. canadensis. In this network, oval nodes represented unigenes and triangle nodes represented miRNAs. The negative correlation was denoted by a line. The yellow and blue color mean up‐regulation and down‐regulation and the highest to lowest fold changes are marked from yellow to blue

Table A5

List of oppositely regulated miRNA‐target pairs in the transcriptome and sRNA sequencing

MiRNA familyMiRNAMiRNA log2 FCTarget locationTarget log2 FCTarget function
miR156sca‐miR156a−1.12CL14854.Contig4_All3.86Unknown
miR160sca‐miR160e4.90CL5636.Contig1_All−2.93Uncharacterized protein LOC104216279 isoform X3
miR161sca‐miR161a−1.39CL11073.Contig3_All2.62ATP sulfurylase 2
Unigene3240_All7.45Receptor‐like protein kinase FERONIA
miR164sca‐miR164d4.07Unigene3688_All−2.14FAR1
Unigene13166_All−4.50Wall‐associated receptor kinase‐like 6
miR165sca‐miR165a1.16CL3766.Contig4_All−2.83Homeobox‐leucine zipper protein REVOLUTA
CL3766.Contig1_All−3.40Homeobox‐leucine zipper protein REVOLUTA
CL3766.Contig6_All−8.43Homeobox‐leucine zipper protein REVOLUTA
miR166sca‐miR166p5.16Unigene5410_All−7.61Hypothetical protein AMTR_s00109p00105850
CL4387.Contig1_All−3.45Unknown
CL2373.Contig3_All−3.51Ribosomal protein L5
miR169sca‐miR169d−1.24CL6884.Contig3_All6.65Dirigent protein 21
CL6884.Contig1_All6.50Dirigent protein 21
CL12537.Contig3_All6.35Nuclear transcription factor Y subunit A−1
CL4633.Contig1_All2.43Nuclear transcription factor Y subunit A−8
CL12537.Contig2_All5.95Nuclear transcription factor Y subunit A−9
sca‐miR169e4.35CL16645.Contig3_All−4.51Calcium‐dependent protein kinase 4
CL2545.Contig2_All−2.57Probable UDP−3‐O‐acylglucosamine N‐acyltransferase 2
miR171sca‐miR171c2.79Unigene25276_All−5.07Ras‐related protein Rab7
CL11323.Contig2_All−4.39U‐box superfamily protein
miR393sca‐miR393d2.48Unigene1223_All−2.53F‐box protein
CL3203.Contig2_All−2.48Transport inhibitor response 1‐like protein
sca‐miR393e1.72CL3203.Contig2_All−2.48Transport inhibitor response 1‐like protein
miR396sca‐miR396a5.04CL2872.Contig4_All−2.13DEAD‐box ATP‐dependent RNA helicase 42
CL3408.Contig3_All−2.20Glutamate synthase 1
CL3408.Contig1_All−6.58Glutamate synthase 1
CL6266.Contig7_All−2.93Trihelix transcription factor GT−1
sca‐miR396d3.50CL7649.Contig3_All−3.28DNA (cytosine−5)‐methyltransferase 1A
CL7649.Contig4_All−5.17DNA (cytosine−5)‐methyltransferase 1A
Unigene30116_All−5.53DNA (cytosine−5)‐methyltransferase 1A
Unigene21625_All−6.75DNA (cytosine−5)‐methyltransferase 1A
CL7984.Contig4_All−4.01Structural maintenance of chromosomes protein 5
miR444sca‐miR444a4.18CL5553.Contig1_All−2.05ABC transporter B family member 27
CL2235.Contig13_All−7.14Probable E3 ubiquitin ligase SUD1
CL2235.Contig14_All−7.31Probable E3 ubiquitin ligase SUD1
CL6747.Contig1_All−7.57Transcription factor IIIB 90 kDa subunit
CL5418.Contig5_All−5.63Uncharacterized protein ycf45
CL5418.Contig11_All−7.72Uncharacterized protein ycf45
sca‐miR444b3.88CL1135.Contig2_All−4.92Cysteine proteinase RD21a
CL1135.Contig6_All−6.70Hypothetical protein EUGRSUZ_H026191, partial
CL1135.Contig5_All−6.98Unnamed protein product
miR5048sca‐miR5048a3.48Unigene14872_All−2.57Auxin‐binding protein T85
miR5139sca‐miR5139a−2.10Unigene17742_All2.48Gamma‐glutamyl hydrolase 2
Unigene7716_All6.64HA383 clone BAC 0148N20, complete sequence
Unigene15641_All6.64LRR receptor‐like serine/threonine‐protein kinase
Unigene5583_All3.96Unknown
CL2157.Contig2_All4.05Oryza sativa genomic DNA
CL5222.Contig1_All2.77Retrovirus‐related Pol polyprotein from transposon TNT 1–94
CL17163.Contig1_All2.05Retrovirus‐related Pol polyprotein from transposon TNT 1–94
CL1303.Contig1_All5.73Transcription factor VOZ1‐like
CL2207.Contig4_All6.41U‐box domain‐containing protein 30
sca‐miR5139b−1.87Unigene26373_All3.19Anthocyanidin 5,3‐O‐glucosyltransferase
Unigene7716_All6.64HA383 clone BAC 0148N20, complete sequence
Unigene15641_All6.64LRR receptor‐like serine/threonine‐protein kinase
CL2157.Contig2_All4.05Oryza sativa genomic DNA
CL17163.Contig1_All2.05Retrovirus‐related Pol polyprotein from transposon TNT 1–94
CL2207.Contig4_All6.41U‐box domain‐containing protein 30
miR530sca‐miR530−1.13Unigene14091_All5.08Probable disease resistance protein
CL1613.Contig1_All5.74Transcription factor MYB1R1
miR6173sca‐miR6173−2.45CL13158.Contig1_All3.25Protein YLS9
miR6300sca‐miR6300−1.02Unigene8614_All2.59Flowering time control protein FCA
CL3059.Contig5_All5.32Gag‐pol polyprotein
Unigene7996_All4.80Laccase−15
miR8155sca‐miR8155−3.15Unigene4360_All3.97ABC transporter D family member 1
Unigene16624_All5.45ABC transporter G family member 31
CL4044.Contig2_All3.13Cysteine synthase
Unigene2778_All6.69Delta−1‐pyrroline−5‐carboxylate dehydrogenase 1 protein
Unigene6077_All4.95Delta−1‐pyrroline−5‐carboxylate dehydrogenase 1 protein
Unigene17742_All2.48Gamma‐glutamyl hydrolase 2
Unigene7716_All6.64HA383 clone BAC 0148N20, complete sequence
Unigene15641_All6.64LRR receptor‐like serine/threonine‐protein kinase
Unigene5583_All3.96Unknown
CL2157.Contig2_All4.05Oryza sativa genomic DNA
CL10305.Contig2_All9.88Probable pyridoxal biosynthesis protein PDX1.2
CL3399.Contig2_All7.36Protein ECERIFERUM 3
CL5222.Contig1_All2.77Retrovirus‐related Pol polyprotein from transposon TNT 1–94
CL17163.Contig1_All2.05Retrovirus‐related Pol polyprotein from transposon TNT 1–94
CL2207.Contig4_All6.41U‐box domain‐containing protein 30
miR894sca‐miR894−2.09CL732.Contig5_All6.38Hypothetical protein MTR_4g131890
CL732.Contig8_All6.12Hypothetical protein MTR_4g131890
CL732.Contig4_All7.09Unknown
miR9662sca‐miR9662a3.45CL14321.Contig1_All−3.13Mitochondrial import inner membrane translocase subunit TIM10
miRNA‐gene interaction network of S. canadensis. In this network, oval nodes represented unigenes and triangle nodes represented miRNAs. The negative correlation was denoted by a line. The yellow and blue color mean up‐regulation and down‐regulation and the highest to lowest fold changes are marked from yellow to blue

DISCUSSION

A large number of works have investigated ecological and evolutionary elements responsible for successful invasion (Hahn et al., 2012; Thébault et al., 2011). However, research into the molecular basis for invasiveness in invasive plants is just getting started. Here, we found 12,897 unigenes and 59 miRNA regulators with divergences in expression between diploid and hexaploid cytotypes. Intriguingly, among them were an over‐representation of unigenes and coherent miRNA targets relevant to metabolism, plant growth and development, and stress responses, implying that these modified genetic and epigenetic attributes may harbor both biochemical and ecological advantages that were beneficial to the successful invasion of hexaploid cytotypes.

Unique gene and miRNA expression characteristics might have contributed to the invasiveness of hexaploid cytotypes

In Arabidopsis thaliana, only 0.1% differences in gene expression between diploid and autotetraploid were detected (Yu et al., 2010). In newly synthesized autotetraploid Paspalum notatum, 0.6% of genes were differentially expressed compared to its diploid (Martelotto et al., 2005). Similarly, the analysis of 21,081 genes in Citrus limonia autotetraploids revealed less than 1.1% differences in comparison with diploids (Allario et al., 2011). In contrast, many researchers have observed a more noticeable transcriptomic divergence between allopolyploids and their parents in several plants (Li et al., 2014; Ye et al., 2016). Remarkably, here we detected >10% transcriptomic differences as a consequence of hexaploid cytotype formation. Two factors may account for this dramatic change. First, S. canadensis is a polyploid, and assembling its transcriptome has been exceedingly difficult because it principally comprises highly similar repeats, thereby causing several contigs that often represent nonoverlapping fragments of the same unigene. Second, given that polyploid effects on gene expression might be induced by genome doubling and/or hybridization, we speculate that the expression pattern of hexaploid cytotypes of S. canadensis should be that of an allohexaploid. Furthermore, a significant caveat in the interpretation of these results is that we have only sequenced one population per ploidy level, and genetic differentiation among different geographic populations of the same ploidy could also be contributing to gene and miRNA expression differences. Thus, further work is essential to explore the genetic relationship between cytotypes. Furthermore, to test whether the invasiveness difference between plants was reflected in the changes of their gene expression patterns, we examined evidence for successful invasion in introduced populations across multiple invasive plants. Here, common‐garden studies comparing native and introduced populations of Cirsium arvense, Centaurea diffusa, and Mikania micrantha, as well as comparisons between S. canadensis and invasive taxa of the Asteraceae, have been performed, and obvious similarities have emerged (Guggisberg, Lai, Huang, & Rieseberg, 2013; Guo et al., 2018; Hodgins et al., 2015; Turner, Nurkowski, & Rieseberg, 2017). In these studies, introduced populations notably differ from their native populations with regard to stress response. In line with this observation, the significantly different regulation of stress response genes, such as receptor‐like proteins, is of particular interest between introduced and native populations because these genes mediate plant cellular defense pathways. Similar, several stress response genes associated with secondary metabolism, such as the cytochrome P450 gene family, were also found to be significantly expressed in the present work. Therefore, it is reasonable to speculate that these stress response genes might have crucial functions in invasive characteristics. However, we also noticed that genes involved in photosynthesis were exclusively enriched in M. micrantha (Guo et al., 2018). Hence, it seems that the pattern of gene expression across different invasive plants is dependent on a specific plant, and thus, it is difficult to generalize a rule of gene expression during invasion. Likewise, the relative amount of miRNAs was higher in a derived hexaploid wheat (BBAADD) than in the parental tetraploid Triticum turgidum ssp. durum (BBAA) and diploid Aegilops tauschii (DD) (Kenan‐Eichler et al., 2011). Analogously, the number of miRNA or miRNA families in cultivated allotetraploid cotton G. hirsutum (AADD) was markedly greater than those in its two diploid ancestors, G. raimondii (DD), and G. arboreum (AA) (Xie & Zhang, 2015). Ghani et al. (2014) also reported that the percentages and expression levels of miRNAs increased in allodiploid (AB) and allotetraploid (AABB) relative to the parents Brassica rapa (AA) and Brassica nigra (BB). In the present work, the number and expression levels of miRNAs in hexaploid cytotypes were greater than those in their diploids, which was consistent with the findings of the above‐mentioned studies. These results suggest that an increase in ploidy was generally coupled with an obvious increase in the percentages and expression levels of miRNAs.

Several regulatory mechanisms seem to operate gene expression properly in hexaploid cytotypes

How does hexaploid cytotypes regulate the differential expression of unigenes? Several mechanisms could be associated with this regulation. miRNAs work as regulators for controlling target‐gene expression, thereby affecting a variety of aspects of phenotype, growth, development, and stress response (Ha et al., 2009). Here, we showed a subset of key candidate miRNA regulators within diploid and hexaploid cytotypes and used these DEMs to predict putative targets using two different target‐prediction software. To shed light on the regulatory action of these DEMs, we compared these predicted targets with DEUs based on GO functional classification (Figure A4a,b in Appendix) and found that biological processes were highly likely to be regulated by miRNAs, such as (a) a considerable proportion of the enriched unigenes were clustered in “biological process”; (b) processes such as “metabolic” and “cellular” were abundantly enriched; and (c) “single‐organism,” “localization,” “biological regulation,” and “response to stimulus” were also adequately reflected. Such observations suggested that unigenes described in the above‐mentioned terms were most likely targeted by miRNAs. However, unigenes associated with “cell killing,” “locomotion,” and “rhythmic process” were enriched only in DEUs, implying that although unigenes associated with the foregoing processes were differentially expressed, this regulation of gene expression cannot be attributed to the miRNA‐induced cleavage of targets. In contrast, no term was only enriched under the same category for the targets of DEMs. These observations suggested that few specific biological processes were regulated by miRNAs. Similarly, “channel regulator activity” and “electron carrier activity” enriched in the “molecular function” category were only amid DEUs. In addition, under the category of “cellular component,” unigenes related to terms “cell,” “membrane” and “organelle” were overwhelming in this comparison, whereas no unigene associated with terms “nucleoid,” “virion,” and “virion part” was enriched among the targets of DEMs, indicating that these unigenes are closely regulated at the transcriptional level and may not be prominently influenced by miRNA‐induced gene silencing. In addition to miRNAs, other accessional regulation manners, such as DNA methylation, may also function to regulate gene expression. There is impressive evidence that an allopolyploid's intergenomic interactions between two divergent genomes were projected to incur DNA methylation changes, eventually causing the differential expression of genes, which can potentially lead to profound phenotypic consequences (Chen, 2007; Salmon & Ainouche, 2010). DNA methylation changes between an allopolyploid and its parents have been very well reported. For instance, in Spartina allopolyploids, a high level of epigenetic regulation might explain the morphological plasticity and its larger ecological amplitude (Salmon, Ainouche, & Wendel, 2005). Additionally, Madlung et al. (2002) reported that changes in DNA methylation would result in the development of altered morphologies in synthetic allotetraploids. Although DNA methylation alterations are principally observed in allopolyploids, activation, or repression of gene expression has also been shown to correlate with DNA methylation variation in autopolyploid Arabidopsis (Yu et al., 2010) and Cymbopogon (Lavania et al., 2012). In the present work, a large number of DEUs related to epigenetic regulation were investigated in two cytotypes of S. canadensis (Supporting Information Table S3). In particular, transcriptome analysis defined eleven unigenes (annotated as DNA (cytosine‐5)‐methyltransferase1 gene, for example, CL12526.Contig3_All, CL5231.Contig1_All, and CL5231.Contig2_All) that displayed striking changes in gene expression. Interestingly, almost all the DNA (cytosine‐5)‐methyltransferase1 genes were found to be significantly down‐regulated (10/11 genes) in hexaploid cytotypes, and these observations should be further investigated because such genes could potentially participate in the maintenance of CG methylation. Additionally, to answer developmental and environmental alterations, chromatin composed of DNA and histones in eukaryotic cell nuclei is modulated by several histone modifications. Among these modifications, histone demethylation regulates gene expression mainly by demethylating histone lysine residues (Shi & Tsukada, 2013). Recent studies have identified Jumonji (JmJ) proteins to be involved in histone demethylation and closely related to the reproductive process. The loss‐of‐function mutations of the rice gene JmJ706 resulted in spikelet development defects (Sun & Zhou, 2008). Here, a total of eight DEUs (e.g., CL1566.Contig6_All, CL1566.Contig9_All, and CL1566.Contig12_All) were annotated as JmJ genes, and all of them were up‐regulated in hexaploid cytotypes, which might partly suggest that the JmJ histone demethylase unigenes may alter the expression of a large number of target genes and contribute to the variation in physiology, biochemistry and phenotype between diploid and hexaploid cytotypes. However, further study is needed. Taken together, these data clearly state that complicated and overlapping gene expression regulatory mechanisms may have evolved in hexaploid cytotypes to guarantee suitable transcriptional control in response to environmental stimuli.

Potential roles of transcriptional alterations in the successful invasion of hexaploid cytotypes

Polyploids play recognized roles in driving organ size and growth of plants. The leaf is the main photosynthetic organ, and its size strongly affects the energy capture, photosynthetic capacity, and physiological activities of plants (Baute et al., 2017; Niinemets, Portsmuth, & Tobias, 2006). The coordination of cell proliferation and expansion is a crucial determinant that serves a critical function in precisely controlling leaf size and growth caused by cell ploidy (Baute et al., 2017; Marshall et al., 2012; Sugiyama, 2005), which have been previously suggested to be regulated by a number of genes encoding transcription factors, modification proteins, plant hormones, and cell wall protein. The Growth‐Regulating‐Factor (GRF) protein, a plant‐specific transcription factor, has been confirmed to affect leaf growth by positively regulating cell proliferation, cell expansion, and adaxial‐abaxial patterning (Omidbakhshfard, Proost, Fujikura, & Mueller‐Roeber, 2015). In addition, the GRF protein has also been shown to perform transcription regulation functions by interacting with GRF‐Interacting Factor (GIF) protein (Debernardi et al., 2014). In this work, five unigenes (unigene52239_All, CL15674.Contig2_All, CL8349.Contig2_All, CL1635.Contig4_All, and CL1635.Contig1_All) annotated as GRF and two unigenes (Unigene15938_All and CL6058.Contig2_All) annotated as GIF were found to be differentially expressed and may form functional complexes potentially implicated in leaf size and growth. Furthermore, other transcription factors, such as the TCP transcription factor (e.g., CL7816.Contig2_All, CL9341.Contig3_All), were also identified as regulators of leaf size. Except for TFs, regulatory proteins act as important regulators of leaf size and growth by influencing cell proliferation. EBP1, an ortholog of ErbB3‐binding protein from humans, regulates leaf size and growth by cell proliferation. Some studies highlight that the expression of EBP1 correlates with plant organ size, growth, and stress tolerance (Cao et al., 2009; Horváth et al., 2006). In the present work, one ortholog of EBP1, CL16506.Contig4_All, was found to be significantly up‐regulated in hexaploid cytotypes, which may be responsible for the larger leaves, faster growth, and better stress resistance of hexaploid cytotypes. Similarly, F‐box proteins, which are members of regulatory protein families that affects leaf size (Baute et al., 2017), are abundantly expressed. Moreover, earlier studies showed that auxin mediated the expression of multiple genes (e.g., ARGOS and ARF) to affect plant organ size and growth (Schruff et al., 2006; Wang, Zhou, Xu, & Gao, 2010). Auxin‐Regulated Gene involved in Organ Size (ARGOS), a gene deeply induced by auxin, participate in organ size regulation. Wang, Zhou, et al. (2010) also pointed out that overexpression of a Chinese cabbage (Brassica rapa) BrARGOS gene in Arabidopsis elevates the size of plant organs. In this work, an ortholog of BrARGOS, CL15040.Contig2_All was detected, and the up‐regulated expression may have similar functions in the organ giantism observed in hexaploid cytotypes. Auxin Response Factor (ARF), a transcription factor, functions in plant size, growth, and stress adaptation by transcriptionally activating and repressing the expression of auxin response genes (Zhao, Zhang, Ma, & Wang, 2016). Here, 16 ARF encoding genes were found to be differentially expressed, which might contribute to invasiveness differences between diploid and hexaploid cytotypes. Lastly, abundant studies have shown correlations between expansin gene expression and cell wall remodeling, growth and stress response, and phenotype changes in plants (Goh, Sloan, Malinowski, & Fleming, 2014; Lee & Choi, 2005; Li et al., 2013), which supports the roles for expansin as an important cell wall protein in plant cell wall modification, growth promotion, and stress tolerance. As expected, the overexpression of expansin genes has remodeled leaf structure, which confers them enhanced tolerance to abiotic stresses (Cho & Cosgrove, 2000; Kwon et al., 2008). In the present work, thirteen unigenes encoding expansins were differentially expressed, and eleven of them were more highly expressed in hexaploid cytotypes of S. canadensis than in diploid cytotypes. These results suggested that the activation of expansins may be a rapid growth and adaptation mechanism of hexaploid cytotypes in novel heterogeneous environments. Furthermore, polyploids can also profoundly affect plant metabolism qualitatively and quantitatively, furnishing the chance for increased metabolic activity through transcriptional divergence, which eventually results in alterations in the levels of secondary metabolites (Fasano et al., 2016). There are multiple studies on the induction of polyploids to promote the production of specific secondary metabolites. For instance, autotetraploids of Catharanthus roseus produced more vindoline, catharanthine, and vinblastine than their diploids (Xing et al., 2011). Echinacea purpurea autotetraploids showed that the induction of polyploids resulted in higher caffeic acid derivatives and alkamides (Xu et al., 2014). Evidence of the influence of polyploids on chemical profiles has also been recorded in allopolyploids. Banyai et al. (2010) reported that allotetraploid Artemisia annua produced more terpenoids or triterpene‐type compounds than diploids. Supporting the role of plant secondary metabolism in polyploid‐mediated invasiveness differences “biosynthesis of secondary metabolites (Pathway ID: ko01110)” was found to be the most significantly enriched pathway with a Q value far below 0.05 in the pathway enrichment analysis of DEUs in the present work. Taking the above into account, we propose that polyploids are more likely to remodel the transcriptome and metabolome in hexaploid cytotypes, resulting in ploidy‐specific metabolic adaptation. Moreover, a marked number of DEUs encoding enzymes related to plant metabolism were observed, which further supports this plausible explanation. The synthesis of secondary metabolites primarily contains the oxidation, reduction, and cyclization steps, in which unigenes encoding enzymes of cytochrome P450 (CYPs) and uridine diphosphate glucuronosyl transferases (UGTs) play crucial roles in catalyzing these reactions (Zhang et al., 2016). Based on the functional annotation of DEUs, a total of 120 core enzyme unigenes encoding CYPs were differentially expressed (Table A6 in Appendix). In addition, CYPs are one of the largest superfamilies of enzyme proteins (Darabi, Seddigh, & Abarshahr, 2017). A large number of CYPs are involved in a wide range of biosynthetic reactions and biochemical pathways, leading to the synthesis of UV protectants (flavonoids and anthocyanins), defensive compounds (isoflavonoids, phytoalexins, hydroxamic acids, and terpenes), fatty acids, hormones (gibberellins and brassinosteroids), signaling molecules (oxylipins, salicylic acid, and jasmonic acid), accessory pigments (carotenoids), and structural polymers such as lignins (Darabi et al., 2017; Schuler & Werck‐Reichhart, 2003). In the present work, many CYP‐related unigenes were identified, such as CYP93A (e.g., CL361.Contig6_All, CL1330.Contig7_All, CL16738.Contig1_All), CYP76B (e.g., CL3689.Contig2_All, CL1852.Contig2_All), and CYP71 (e.g., CL6714.Contig2_All, Unigene23159_All, CL15279.Contig1_All), which respectively participated in the biosynthesis of isoflavonoids, flavonoids, and sesquiterpenoids and triterpenoids, which may act as defensive compounds that protect against oxidative damage under abiotic stress. Furthermore, a great deal of UGT genes that participated in flavonoid biosynthesis, such as UGT73, UGT74, UGT76, UGT83, UGT85, and UGT89, were also identified (Table A7 in Appendix). Given these findings, it is attractive to investigate the potential model whereby polyploids impact the metabolome in hexaploid cytotypes of S. canadensis.
Table A6

List of differentially expressed unigenes associated with CYPs

UnigeneIDPlausible metabolic pathwayD_FPKMH_FPKMLog2 FCUp/down
CL7441.Contig4_AllCYP590.8552.825.95Up
Unigene11828_AllCYP19‐420.74380.994.20Up
CL13176.Contig1_AllCYP19‐416.40165.243.33Up
CL10739.Contig3_AllCYP19‐467.91477.412.81Up
CL13176.Contig2_AllCYP19‐4133.9827.73−2.27Down
Unigene6217_AllCYP19‐4174.0622.41−2.96Down
Unigene30406_AllCYP19‐433.843.09−3.45Down
CL10739.Contig1_AllCYP19‐4216.001.45−7.22Down
CL9185.Contig2_AllCYP285.284,912.785.85Up
CL9185.Contig1_AllCYP26,998.33984.99−2.83Down
CL10739.Contig2_AllCYP20‐330.984.35−2.83Down
CL9682.Contig2_AllCYP21‐3122.8828.86−2.09Down
CL2380.Contig5_AllCYP4015.43261.524.08Up
Unigene2002_AllCYP4016.4371.432.12Up
CL7441.Contig2_AllCYP5989.4417.15−2.38Down
Unigene29249_AllCYP6324.860.67−5.22Down
Unigene22411_AllCYP704C1Stilbenoid, diarylheptanoid, and gingerol biosynthesis86.831,208.253.80Up
Unigene22213_AllCYP704C1Stilbenoid, diarylheptanoid, and gingerol biosynthesis17.65214.893.61Up
CL1310.Contig1_AllCYP704C1Cutin, suberine, and wax biosynthesis78.69914.183.54Up
Unigene22236_AllCYP704C1Stilbenoid, diarylheptanoid, and gingerol biosynthesis144.7919.62−2.88Down
Unigene5770_AllCYP704C1Stilbenoid, diarylheptanoid, and gingerol biosynthesis121.735.83−4.38Down
CL14169.Contig2_AllCYP710A168.67319.202.22Up
CL4539.Contig3_AllCYP711A151.234.49−3.51Down
CL2023.Contig1_AllCYP716B1631.0832.09−4.30Down
CL2023.Contig3_AllCYP716B11,621.0831.09−5.70Down
CL2023.Contig7_AllCYP716B215.011,730.376.85Up
Unigene12692_AllCYP71A1Flavone and flavonol biosynthesis;Flavonoid biosynthesis90.378.93−3.34Down
Unigene15825_AllCYP71A2Stilbenoid, diarylheptanoid, and gingerol biosynthesis2.13140.716.05Up
CL8060.Contig1_AllCYP71A2Stilbenoid, diarylheptanoid, and gingerol biosynthesis898.298,213.103.19Up
CL977.Contig3_AllCYP71A4Stilbenoid, diarylheptanoid, and gingerol biosynthesis183.011,254.692.78Up
CL977.Contig2_AllCYP71A4Stilbenoid, diarylheptanoid, and gingerol biosynthesis32.82197.652.59Up
CL977.Contig5_AllCYP71A4Stilbenoid, diarylheptanoid, and gingerol biosynthesis143.64776.662.43Up
Unigene26266_AllCYP71A4Stilbenoid, diarylheptanoid, and gingerol biosynthesis80.862.90−4.80Down
Unigene17018_AllCYP71A4275.494.65−5.89Down
CL15273.Contig1_AllCYP71A6Stilbenoid, diarylheptanoid, and gingerol biosynthesis5.13620.226.92Up
CL15955.Contig1_AllCYP71A8Stilbenoid, diarylheptanoid, and gingerol biosynthesis2.73331.816.92Up
CL8060.Contig3_AllCYP71AJ1Stilbenoid, diarylheptanoid, and gingerol biosynthesis19.87827.245.38Up
Unigene23908_AllCYP71AV123.880.29−6.36Down
CL6714.Contig2_AllCYP71AV8Sesquiterpenoid and triterpenoid biosynthesis0.2728.546.71Up
CL6714.Contig1_AllCYP71AV8Sesquiterpenoid and triterpenoid biosynthesis82.831.05−6.30Down
CL9888.Contig1_AllCYP71BL326.090.29−6.48Down
Unigene23159_AllCYP71D55Sesquiterpenoid and triterpenoid biosynthesis64.868.37−2.95Down
CL15279.Contig1_AllCYP71D55Sesquiterpenoid and triterpenoid biosynthesis715.1475.17−3.25Down
CL9608.Contig2_AllCYP71D55Sesquiterpenoid and triterpenoid biosynthesis423.2228.36−3.90Down
CL5543.Contig2_AllCYP72A1547.85200.644.67Up
Unigene27925_AllCYP72A2190.2315.616.09Up
Unigene22475_AllCYP72A2192.6185.745.04Up
CL4064.Contig5_AllCYP72A21927.03389.023.85Up
Unigene6002_AllCYP72A21939.16198.432.34Up
CL10015.Contig2_AllCYP72A219370.6391.20−2.02Down
Unigene6055_AllCYP72A2191,306.33209.38−2.64Down
Unigene5550_AllCYP72A2191,484.0776.13−4.29Down
CL553.Contig1_AllCYP72A21917.500.65−4.76Down
CL4046.Contig2_AllCYP749A22Brassinosteroid biosynthesis0.3077.928.00Up
CL4046.Contig8_AllCYP749A22Brassinosteroid biosynthesis0.2518.516.21Up
CL4046.Contig1_AllCYP749A22Brassinosteroid biosynthesis8.29138.164.06Up
CL14877.Contig1_AllCYP749A22Brassinosteroid biosynthesis38.24315.953.05Up
CL4046.Contig5_AllCYP749A22Brassinosteroid biosynthesis24.460.32−6.26Down
CL4046.Contig6_AllCYP749A22Brassinosteroid biosynthesis203.051.08−7.55Down
CL37.Contig2_AllCYP75B2Flavone and flavonol biosynthesis;Flavonoid biosynthesis1.58630.708.64Up
CL8453.Contig3_AllCYP75B2465.2690.17−2.37Down
CL37.Contig1_AllCYP75B2Flavone and flavonol biosynthesis;Flavonoid biosynthesis708.3923.03−4.94Down
CL1605.Contig12_AllCYP76AD1118.7426.26−2.18Down
CL2830.Contig3_AllCYP76B1Flavonoid biosynthesis;Stilbenoid, diarylheptanoid and gingerol biosynthesis;Phenylpropanoid biosynthesis3.6782.104.48Up
CL3689.Contig2_AllCYP76B6Flavone and flavonol biosynthesis;Flavonoid biosynthesis3.7965.454.11Up
CL1852.Contig2_AllCYP76B6Flavone and flavonol biosynthesis;Flavonoid biosynthesis42.67171.062.00Up
CL4701.Contig3_AllCYP76C132.81195.062.57Up
Unigene28192_AllCYP76C193.38421.322.17Up
CL7793.Contig1_AllCYP76C1136.81560.212.03Up
CL7793.Contig2_AllCYP76C11,323.87213.51−2.63Down
CL4701.Contig5_AllCYP76C124.441.49−4.04Down
CL4701.Contig4_AllCYP76C179.490.33−7.89Down
CL14510.Contig2_AllCYP77A2Stilbenoid, diarylheptanoid, and gingerol biosynthesis59.18900.013.93Up
CL5637.Contig1_AllCYP79D1Glucosinolate biosynthesis1.5843.174.77Up
CL8279.Contig1_AllCYP79D1Glucosinolate biosynthesis39.876.14−2.70Down
CL2748.Contig1_AllCYP80B21.4630.684.40Up
CL9352.Contig4_AllCYP81D1Stilbenoid, diarylheptanoid, and gingerol biosynthesis57.618.79−2.71Down
CL8387.Contig2_AllCYP81E1Stilbenoid, diarylheptanoid, and gingerol biosynthesis90.1915.56−2.54Down
CL13045.Contig1_AllCYP81E1Stilbenoid, diarylheptanoid, and gingerol biosynthesis39.391.06−5.22Down
CL13045.Contig2_AllCYP81E1Stilbenoid, diarylheptanoid, and gingerol biosynthesis54.590.67−6.36Down
Unigene7285_AllCYP82A3Stilbenoid, diarylheptanoid, and gingerol biosynthesis0.2748.547.47Up
Unigene5205_AllCYP82A3Stilbenoid, diarylheptanoid, and gingerol biosynthesis0.2643.787.40Up
Unigene4201_AllCYP82A3Stilbenoid, diarylheptanoid, and gingerol biosynthesis0.2524.186.58Up
Unigene4771_AllCYP82A3Stilbenoid, diarylheptanoid, and gingerol biosynthesis0.8839.345.47Up
CL14937.Contig5_AllCYP82A3Stilbenoid, diarylheptanoid, and gingerol biosynthesis30.52375.553.62Up
CL10835.Contig1_AllCYP82A3Stilbenoid, diarylheptanoid, and gingerol biosynthesis4.9955.933.49Up
CL2495.Contig1_AllCYP82A3Stilbenoid, diarylheptanoid, and gingerol biosynthesis5.8763.333.43Up
CL17044.Contig1_AllCYP82A3Stilbenoid, diarylheptanoid, and gingerol biosynthesis795.11168.53−2.24Down
Unigene25796_AllCYP82A3Stilbenoid, diarylheptanoid, and gingerol biosynthesis500.0365.44−2.93Down
CL8654.Contig1_AllCYP82A3Stilbenoid, diarylheptanoid, and gingerol biosynthesis94.7710.61−3.16Down
CL3118.Contig2_AllCYP82G1Diterpenoid biosynthesis23.593,287.457.12Up
CL3531.Contig2_AllCYP83B1Glucosinolate biosynthesis0.70110.507.29Up
Unigene28320_AllCYP84A1Phenylpropanoid biosynthesis453.5878.83−2.52Down
CL2645.Contig3_AllCYP85A1Brassinosteroid biosynthesis1.9031.874.07Up
CL16982.Contig1_AllCYP85A1Brassinosteroid biosynthesis68.522.80−4.62Down
CL16982.Contig2_AllCYP85A1Brassinosteroid biosynthesis32.060.30−6.74Down
Unigene9790_AllCYP86A8Cutin, suberine, and wax biosynthesis8.85121.083.77Up
CL13254.Contig3_AllCYP86B1Cutin, suberine, and wax biosynthesis4.35472.956.76Up
Unigene17254_AllCYP86B1Cutin, suberine, and wax biosynthesis32.44167.272.37Up
CL2327.Contig3_AllCYP87A326.150.33−6.31Down
CL6582.Contig6_AllCYP89A2Stilbenoid, diarylheptanoid, and gingerol biosynthesis4.48267.015.90Up
CL10339.Contig2_AllCYP90A1Brassinosteroid biosynthesis7.2180.633.48Up
CL10339.Contig3_AllCYP90A1Brassinosteroid biosynthesis456.50107.30−2.09Down
CL361.Contig6_AllCYP93A1Isoflavonoid biosynthesis46.894.48−3.39Down
CL1330.Contig3_AllCYP93A3Isoflavonoid biosynthesis0.5741.796.20Up
CL16738.Contig3_AllCYP93A3Isoflavonoid biosynthesis70.10924.853.72Up
CL16738.Contig1_AllCYP93A3Isoflavonoid biosynthesis46.85269.172.52Up
CL1330.Contig7_AllCYP93A3Isoflavonoid biosynthesis120.6212.75−3.24Down
CL1330.Contig6_AllCYP93A3Isoflavonoid biosynthesis148.2812.08−3.62Down
CL7523.Contig2_AllCYP94A1Stilbenoid, diarylheptanoid, and gingerol biosynthesis1.22142.266.87Up
CL2760.Contig1_AllCYP94C1Cutin, suberine, and wax biosynthesis2.94163.005.79Up
CL5348.Contig1_AllCYP94C133.970.30−6.82Down
CL5348.Contig2_AllCYP94C176.680.34−7.84Down
CL4017.Contig2_AllCYP953.1468.854.45Up
Unigene35557_AllCYP97A3Carotenoid biosynthesis0.35469.9010.40Up
Unigene9891_AllCYP97B2Carotenoid biosynthesis53.06508.173.26Up
Unigene9890_AllCYP97B2Carotenoid biosynthesis219.0447.55−2.20Down
CL3333.Contig5_AllCYP97B2Carotenoid biosynthesis78.7313.35−2.56Down
Unigene21607_AllCYP97B2Carotenoid biosynthesis428.640.41−10.04Down
CL1848.Contig1_AllCYP98A2Flavonoid biosynthesis;Stilbenoid, diarylheptanoid and gingerol biosynthesis;Phenylpropanoid biosynthesis44.293.11−3.83Down
Table A7

List of differentially expressed unigenes associated with UGTs

UnigeneUnigene descriptionIDD_FPKMH_FPKMLog2 FCUp/down
CL3889.Contig1_AllAnthocyanidin 3‐O‐glucosyltransferaseRT121.765.30−4.52Down
CL3889.Contig2_AllAnthocyanidin 3‐O‐glucosyltransferaseRT297.224.92−5.92Down
CL3889.Contig3_AllAnthocyanidin 3‐O‐glucosyltransferaseRT232.972.63−6.47Down
CL3889.Contig4_AllAnthocyanidin 3‐O‐glucosyltransferaseRT321.723.03−6.73Down
CL373.Contig2_AllAnthocyanidin 5,3‐O‐glucosyltransferaseRhGT163.22381.102.59Up
CL373.Contig1_AllAnthocyanidin 5,3‐O‐glucosyltransferaseRhGT159.30241.432.03Up
Unigene19820_AllScopoletin glucosyltransferaseTOGT1174.28754.952.12Up
CL6939.Contig2_AllSterol 3‐beta‐glucosyltransferaseUGT80B1396.4484.58−2.23Down
CL5245.Contig8_AllSterol 3‐beta‐glucosyltransferase UGT80A2UGT80A20.3747.226.98Up
Unigene16792_AllSterol 3‐beta‐glucosyltransferase UGT80A2UGT80A20.2720.826.27Up
Unigene16787_AllSterol 3‐beta‐glucosyltransferase UGT80A2UGT80A213.9775.972.44Up
Unigene16789_AllSterol 3‐beta‐glucosyltransferase UGT80A2UGT80A235.832.35−3.93Down
Unigene16790_AllSterol 3‐beta‐glucosyltransferase UGT80A2UGT80A281.300.33−7.93Down
CL6939.Contig1_AllSterol 3‐beta‐glucosyltransferase UGT80B1UGT80B19.07181.654.32Up
CL6939.Contig5_AllSterol 3‐beta‐glucosyltransferase UGT80B1UGT80B118.82138.672.88Up
CL9172.Contig2_AllUDP‐glucose flavonoid 3‐O‐glucosyltransferase 6GT64.2982.324.26Up
CL13096.Contig1_AllUDP‐glycosyltransferase 73C3UGT73C3470.8656.54−3.06Down
Unigene795_AllUDP‐glycosyltransferase 73C3UGT73C333.303.70−3.17Down
CL5682.Contig4_AllUDP‐glycosyltransferase 73C5UGT73C5101.331,257.383.63Up
Unigene22107_AllUDP‐glycosyltransferase 73C5UGT73C51,799.31358.74−2.33Down
Unigene748_AllUDP‐glycosyltransferase 73C6UGT73C633.10190.302.52Up
CL12706.Contig2_AllUDP‐glycosyltransferase 74B1UGT74B11.82233.317.00Up
CL3968.Contig2_AllUDP‐glycosyltransferase 74E2UGT74E21.5065.685.46Up
CL3968.Contig1_AllUDP‐glycosyltransferase 74E2UGT74E210.66158.423.89Up
CL307.Contig2_AllUDP‐glycosyltransferase 76C1UGT76C124.061,960.826.35Up
CL307.Contig1_AllUDP‐glycosyltransferase 76C1UGT76C180.06376.712.23Up
CL4544.Contig1_AllUDP‐glycosyltransferase 76C1UGT76C145.199.01−2.33Down
Unigene240_AllUDP‐glycosyltransferase 76C2UGT76C21.2148.705.33Up
CL14018.Contig2_AllUDP‐glycosyltransferase 76C3UGT76C32.4730.653.64Up
Unigene24228_AllUDP‐glycosyltransferase 76E4UGT76E40.3399.328.21Up
Unigene52237_AllUDP‐glycosyltransferase 76E4UGT76E40.70125.567.49Up
CL2638.Contig3_AllUDP‐glycosyltransferase 76E4UGT76E40.3432.576.57Up
Unigene37400_AllUDP‐glycosyltransferase 76E4UGT76E41.0744.555.39Up
CL10124.Contig2_AllUDP‐glycosyltransferase 83A1UGT83A149.76303.612.61Up
CL10124.Contig1_AllUDP‐glycosyltransferase 83A1UGT83A135.29211.302.58Up
CL11684.Contig1_AllUDP‐glycosyltransferase 83A1UGT83A1520.6099.07−2.39Down
CL4313.Contig2_AllUDP‐glycosyltransferase 83A1UGT83A1384.9852.03−2.89Down
CL11650.Contig2_AllUDP‐glycosyltransferase 83A1UGT83A170.326.45−3.45Down
CL3790.Contig2_AllUDP‐glycosyltransferase 85A1UGT85A133.94139.572.04Up
CL7944.Contig1_AllUDP‐glycosyltransferase 85A2UGT85A20.3296.908.26Up
CL12789.Contig1_AllUDP‐glycosyltransferase 85A2UGT85A26.2781.533.70Up
CL9178.Contig2_AllUDP‐glycosyltransferase 85A2UGT85A216.84145.433.11Up
CL12789.Contig2_AllUDP‐glycosyltransferase 85A2UGT85A233.460.68−5.62Down
CL10565.Contig2_AllUDP‐glycosyltransferase 85A3UGT85A375.20312.182.05Up
CL9310.Contig2_AllUDP‐glycosyltransferase 85A5UGT85A549.8211.55−2.11Down
CL3105.Contig3_AllUDP‐glycosyltransferase 85A5UGT85A556.9610.49−2.44Down
Unigene14793_AllUDP‐glycosyltransferase 87A2UGT87A20.61158.978.02Up
Unigene10460_AllUDP‐glycosyltransferase 89B1UGT89B13.80102.434.75Up
Unigene4493_AllUDP‐glycosyltransferase 91A1UGT91A130.28245.033.02Up
CL14041.Contig1_AllUDP‐glycosyltransferase 92A1UGT92A1190.2231.04−2.62Down
CL8978.Contig2_AllZeatin O‐xylosyltransferaseZOX1358.9477.03−2.22Down
In conclusion, important candidate unigenes and miRNA regulators that contributed to the successful invasion of hexaploid cytotypes of S. canadensis have been investigated in the current work, and we have also further inferred ploidy‐related regulation of DNA methylation as an additional modulatory event that occurs to modulate transcriptome reprogramming to drive invasion success. Furthermore, a model for depicting the events involved in ploidy alteration in S. canadensis is summarized in Figure 5. Collectively, this work not only describes which molecular processes and functional pathways are likely vital in the successful invasion of polyploids but also offers a valuable dataset for future functional experiments aiming to determine which of these candidate unigenes and miRNA regulators truly underlie the differences in invasiveness between diploid and hexaploid cytotypes.
Figure 5

Graphical summary of molecular responses to ploidy alteration in S. canadensis. Dotted lines and dashed boxes represent the putative regulations

Graphical summary of molecular responses to ploidy alteration in S. canadensis. Dotted lines and dashed boxes represent the putative regulations

CONFLICT OF INTEREST

None declared.

AUTHOR CONTRIBUTIONS

C.C.X. collected plants, performed greenhouse experiment, analyzed the collected data, and wrote this manuscript; Y.M.G. participated in data analysis; J.B.W. conceived the research and contributed to data interpretation and revisions of this manuscript. Click here for additional data file. Click here for additional data file. Click here for additional data file. Click here for additional data file.
  5 in total

Review 1.  Epigenetics and the success of invasive plants.

Authors:  Jeannie Mounger; Malika L Ainouche; Oliver Bossdorf; Armand Cavé-Radet; Bo Li; Madalin Parepa; Armel Salmon; Ji Yang; Christina L Richards
Journal:  Philos Trans R Soc Lond B Biol Sci       Date:  2021-04-19       Impact factor: 6.671

2.  Integrated analysis of mRNA-seq and miRNA-seq reveals the advantage of polyploid Solidago canadensis in sexual reproduction.

Authors:  Miao Wu; Huiyuan Liu; Bingbing Li; Tao Zhu
Journal:  BMC Plant Biol       Date:  2021-10-11       Impact factor: 4.215

3.  Responses of Sphagneticola trilobata, Sphagneticola calendulacea and Their Hybrid to Drought Stress.

Authors:  Qilei Zhang; Jundong Huang; Weiqian Ke; Minling Cai; Guangxin Chen; Changlian Peng
Journal:  Int J Mol Sci       Date:  2021-10-19       Impact factor: 5.923

4.  High-quality chromosome-scale de novo assembly of the Paspalum notatum 'Flugge' genome.

Authors:  Zhenfei Yan; Huancheng Liu; Yu Chen; Juan Sun; Lichao Ma; Aihua Wang; Fuhong Miao; Lili Cong; Hui Song; Xue Yin; Qi Wang; Yayun Gong; Guofeng Yang; Zengyu Wang
Journal:  BMC Genomics       Date:  2022-04-11       Impact factor: 3.969

5.  Elevated Temperature Induced Adaptive Responses of Two Lupine Species at Early Seedling Phase.

Authors:  Sigita Jurkonienė; Jurga Jankauskienė; Rima Mockevičiūtė; Virgilija Gavelienė; Elžbieta Jankovska-Bortkevič; Iskren Sergiev; Dessislava Todorova; Nijolė Anisimovienė
Journal:  Plants (Basel)       Date:  2021-05-29
  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.