Vinita G Chittoor-Vinod1, Hannah Bazick1, Adrian G Todd2, Darin Falk2, Kathryn H Morelli3,4, Robert W Burgess3,4, Thomas C Foster1, Lucia Notterpek1. 1. Departments of Neuroscience and Neurology, College of Medicine , McKnight Brain Institute , 1149 Newell Drive , Box 100244, Gainesville , Florida 32610-0244 , United States. 2. Department of Pediatrics, Powell Gene Therapy Center , University of Florida , Gainesville , Florida 32611 , United States. 3. The Graduate School of Biomedical Science and Engineering , University of Maine , Orono , Maine 04469 , United States. 4. The Jackson Laboratory , Bar Harbor , Maine 04609 , United States.
Abstract
Hereditary demyelinating neuropathies linked to peripheral myelin protein 22 (PMP22) involve the disruption of normal protein trafficking and are therefore relevant targets for chaperone therapy. Using a small molecule HSP90 inhibitor, EC137, in cell culture models, we previously validated the chaperone pathway as a viable target for therapy development. Here, we tested five commercially available inhibitors of HSP90 and identified BIIB021 and AUY922 to support Schwann cell viability and enhance chaperone expression. AUY922 showed higher efficacy, compared to BIIB021, in enhancing myelin synthesis in dorsal root ganglion explant cultures from neuropathic mice. For in vivo testing, we randomly assigned 2-3 month old C22 and 6 week old Trembler J (TrJ) mice to receive two weekly injections of either vehicle or AUY922 (2 mg/kg). By the intraperitoneal (i.p.) route, the drug was well-tolerated by all mice over the 5 month long study, without influence on body weight or general grooming behavior. AUY922 improved the maintenance of myelinated nerves of both neuropathic models and attenuated the decline in rotarod performance and peak muscle force production in C22 mice. These studies highlight the significance of proteostasis in neuromuscular function and further validate the HSP90 pathway as a therapeutic target for hereditary neuropathies.
Hereditary demyelinating neuropathies linked to peripheral myelin protein 22 (PMP22) involve the disruption of normal protein trafficking and are therefore relevant targets for chaperone therapy. Using a small molecule HSP90 inhibitor, EC137, in cell culture models, we previously validated the chaperone pathway as a viable target for therapy development. Here, we tested five commercially available inhibitors of HSP90 and identified BIIB021 and AUY922 to support Schwann cell viability and enhance chaperone expression. AUY922 showed higher efficacy, compared to BIIB021, in enhancing myelin synthesis in dorsal root ganglion explant cultures from neuropathicmice. For in vivo testing, we randomly assigned 2-3 month old C22 and 6 week old Trembler J (TrJ) mice to receive two weekly injections of either vehicle or AUY922 (2 mg/kg). By the intraperitoneal (i.p.) route, the drug was well-tolerated by all mice over the 5 month long study, without influence on body weight or general grooming behavior. AUY922 improved the maintenance of myelinated nerves of both neuropathic models and attenuated the decline in rotarod performance and peak muscle force production in C22mice. These studies highlight the significance of proteostasis in neuromuscular function and further validate the HSP90 pathway as a therapeutic target for hereditary neuropathies.
The heat shock (HS) pathway represents
a cellular stress response,
which results in elevated expression of cytoprotective chaperones
or heat shock proteins (HSPs). Activation of chaperones has been shown
to reduce the aggregation of misfolded proteins and alleviate disease
phenotypes in various <span class="Disease">neurodegenerative disease models.[1−3] It has been proposed that an increase in the availability of functional
HSPs aids in the folding and the disaggregation or enhanced degradation
of misfolded proteins.[4−6] The activation of the HS pathway can be achieved
through inhibition of HSP90, which disrupts its interaction with Heat
Shock Factor-1 (HSF-1) leading to transcriptional activation of the
HS response.[7] Although HSP90 inhibitors
have been investigated primarily for their anticancer properties,
when used within a defined concentration range, they can be beneficial
in the treatment of protein misfolding disorders.[8]
Charcot-Marie-Tooth (CMT) diseases comprise a heterogeneous
group
of progressive <span class="Disease">hereditary peripheral neuropathies, most often associated
with overproduction of peripheral myelin protein 22 (PMP22), an aggregation-prone
Schwann cell protein.[9,10] TransgenicC22mice express additional
copies of the wild type (Wt) humanPMP22 and reproduce the phenotypic
traits of the neuropathies, including demyelination of peripheral
nerves, impaired locomotor performance, and age-associated disease
progression.[11−13] Mislocalization and aggregation of mutant PMP22 is
a culprit in early onset, severe neuropathies, modeled by the Trembler
J (TrJ) mouse carrying a spontaneous mutation in the Pmp22 gene.[14] In a previous study, we showed
that activation of the HS pathway using EC137, a synthetic HSP90 inhibitor,
reduced the aggregation of PMP22 and improved myelination in neuron-glia
explant cultures from C22mice.[15] In an
in vivo study of neuropathic TrJ mice, an increase in chaperone expression
through intermittent fasting supported maintenance of nerve myelin
and locomotor performance.[16] In accordance,
enhancement of the stress response by life-long calorie restriction
was beneficial for peripheral nerve integrity in aged rats.[15,17] Recent in vitro work further supports the importance of heat shock
protein 70 (HSP70) in preventing the aggregation of misfolded PMP22
and aiding in its degradation.[18] In related
studies, pharmacological activation of HSP70 was shown to reverse
sensory deficits in diabeticmice[19] and
ameliorate nerve demyelination and motor deficits in an inducible
neuropathicmouse model.[20] Thus, a number
of experimental scenarios indicate that chaperones are critical for
myelin maintenance and peripheral nerve function.
In this study,
we screened five commercially available HSP90 inhibitors
and identified NVP-<span class="Chemical">AUY922 (referred to as AUY922 or AUY from here
on) as the most effective compound in improving myelination in explant
cultures from neuropathicC22mice. This positive response correlated
with the robust induction of chaperones in Schwann cells, in a dose-
and time-dependent manner. In vivo administration of AUY922 preserved
myelinated peripheral nerves in both C22 and TrJ models and attenuated
the decline in neuromuscular performance in neuropathicC22mice.
Results
AUY922
and BIIB021 Are Nontoxic Inducers of the Chaperone Pathway
in Schwann Cells
We tested five commercially available HSP90
inhibitors, including AT13387, <span class="Chemical">AUY922, BIIB021, SNX5422, and STA9090,
on the viability of rat Schwann cells using the MTS assay. After 24
h of exposure, geldanamycin (GA, 50 nM), a well-known inhibitor of
HSP90, significantly decreased cellular viability compared to DMSO
(Figure A), which
is in agreement with previous studies.[21] Among these five tested compounds, lower dosages (50 nM) of AT13387,
BIIB021, and STA9090 were well-tolerated by Schwann cells, while the
higher dosages (500 nM) significantly decreased cellular viability,
compared to DMSO. Surprisingly, neither concentration of AUY922 affected
cell viability, while SNX5422 was toxic at both concentrations and
therefore was excluded from subsequent studies.
Figure 1
Effects of HSP90 inhibitors
on Schwann cells. (A) Cell viability
after treatment (24 h) with DMSO, GA (50 nM), or the indicated five
HSP90 inhibitors (50 and 500 nM) was calculated and graphed, as a
percentage of DMSO (vehicle). (B) HSP70 mRNA levels were quantified
after 24 h of treatment with the indicated compounds (100 nM). GAPDH
(glyceraldehyde-3-phosphate dehydrogenase) was used as an internal
control. (A, B) GA (50 nM) served as a positive control. A.U.: arbitrary
units. Graphs are plotted as means ± SEM; ***P < 0.001; **P < 0.01; *P <
0.05; n.s., nonsignificant; two-tailed unpaired Student’s t-test.
Effects of HSP90 inhibitors
on Schwann cells. (A) Cell viability
after treatment (24 h) with <span class="Chemical">DMSO, GA (50 nM), or the indicated five
HSP90 inhibitors (50 and 500 nM) was calculated and graphed, as a
percentage of DMSO (vehicle). (B) HSP70 mRNA levels were quantified
after 24 h of treatment with the indicated compounds (100 nM). GAPDH
(glyceraldehyde-3-phosphate dehydrogenase) was used as an internal
control. (A, B) GA (50 nM) served as a positive control. A.U.: arbitrary
units. Graphs are plotted as means ± SEM; ***P < 0.001; **P < 0.01; *P <
0.05; n.s., nonsignificant; two-tailed unpaired Student’s t-test.
Next, we determined the
efficiency of these compounds in inducing
the chaperone pathway, by measuring HSP70 expression in nonmyelinating
Schwann cells (Figure B).[22] After 24 h of incubation, <span class="Chemical">AUY922
and BIIB021, each at 100 nM, elicited similar HSP70 transcript levels
as GA (50 nM), the positive control. In comparison, incubation of
the cells with AT13387 and STA9090 lacked positive effects (Figure B). Because AUY922
and BIIB021 elicited minimal Schwann cell toxicity and effectively
induced the HS response, we chose these two compounds for further
testing.
To characterize the influence of the two selected compounds
on
chaperone levels, we performed dosage and time course studies (Figure ). First, nonmyelinating
Schwann cells were treated with 25, 50, or 100 nM of either BIIB021
or <span class="Chemical">AUY922 for 24 h and then analyzed for levels of HSP70 and HSP27
(Figure A). Both compounds
increased HSP70 levels in a dose-dependent fashion, showing peak expression
at 100 nM. Although the levels of HSP27 did not change prominently
with different doses of the test compounds, cells treated with even
the lowest dose showed higher HSP27 expression, as compared to the
DMSO controls. However, AUY922 was more effective in increasing the
levels of HSP70 and HSP27, even at lower doses, as compared to BIIB021.
This finding corresponds with the higher levels of HSP70 mRNA observed
upon AUY922 treatment, as compared to BIIB021 (Figure B). Next, time course experiments were performed
over 4–48 h incubation periods (Figure B). As shown, 100 nM BIIB021 or AUY922 increased
HSP70 levels as early as 4 h, with the expression peaking between
16 and 24 h. To study the sustainability of the induction, Schwann
cells were treated with either 100 nM AUY922 or BIIB021 for 4 h (treat),
followed by wash out and media replacement without drugs (chase) (Figure C). Cells exposed
to BIIB021 or AUY922 for 4 h maintained elevated chaperone expression
for at least 48 h, compared to the DMSO-treated controls. These results
indicate that the exposure of Schwann cells to low concentrations
of AUY922 or BIIB021 elicits robust and sustained chaperone induction,
without significant cellular toxicity.
Figure 2
Treatment with BIIB021
and AUY922 increases chaperone expression
in a dose- and time-dependent manner. (A) Steady-state levels of HSP70
and HSP27 in whole Schwann cell lysates (15 μg/lane) were analyzed
after 24 h of treatment with DMSO, BIIB021, or AUY922, at the specified
doses. GA (50 nM) served as a positive control. (B) HSP70 and HSP27
levels were observed after treatment with 100 nM BIIB021 or AUY922
for the indicated times. (C) Chaperone pathway activation by BIIB021
or AUY922 (100 nM) was studied after 2 or 4 h (treatment), followed
by 4, 24, 32, and 48 h chase time points. (A, B) GAPDH and (C) tubulin
served as protein loading controls. Molecular mass on left, in kDa.
Data shown are representative of n = 3 independent
experiments.
Treatment with BIIB021
and <span class="Chemical">AUY922 increases chaperone expression
in a dose- and time-dependent manner. (A) Steady-state levels of HSP70
and HSP27 in whole Schwann cell lysates (15 μg/lane) were analyzed
after 24 h of treatment with DMSO, BIIB021, or AUY922, at the specified
doses. GA (50 nM) served as a positive control. (B) HSP70 and HSP27
levels were observed after treatment with 100 nM BIIB021 or AUY922
for the indicated times. (C) Chaperone pathway activation by BIIB021
or AUY922 (100 nM) was studied after 2 or 4 h (treatment), followed
by 4, 24, 32, and 48 h chase time points. (A, B) GAPDH and (C) tubulin
served as protein loading controls. Molecular mass on left, in kDa.
Data shown are representative of n = 3 independent
experiments.
Improved Myelin Production
upon Chaperone Induction in Explant
Cultures from Neuropathic Mice
The effects of AUY922 and
<span class="Chemical">BIIB021 on the myelination capacity of peripheral glia were assessed
in dorsal root ganglion (DRG) explant cultures from wild type (Wt)
and neuropathicC22mice.[15] DRG explant
cultures were treated with either vehicle (Veh, DMSO), AUY922 (A,
100 nM), or BIIB021 (B, 100 nM) for 2 weeks, followed by analyses
for chaperone expression and myelin formation (Figure ). As shown (Figure A), the levels of HSP70 are elevated in HSP90
inhibitor-treated (A and B) Wt and C22 cultures, as compared to vehicle
(Veh) controls. Within the same protein lysates, myelin production
was evaluated through the expression levels of myelin protein zero
(P0), which constitutes the majority of peripheral myelin proteins
(Figure A). Both AUY922-
and BIIB021-treated cultures from neuropathicmice show elevated levels
of P0 compared to the vehicle control, and this effect was consistent
across independent culture preparations. To assess the potential contribution
of DRG neurons to the increase in chaperones, we depleted Wt explants
of Schwann cells by antimitotic FUdR treatment[15] (SC-depleted, Figure B). The chaperone response of explant cultures to AUY922
(the more potent HSP90 inhibitor) without Schwann cells is muted,
indicating that the increase in HSP70 expression is predominantly
from the glial cells.
Figure 3
Improved myelin production in DRG explant cultures from
C22 mice
after treatment with AUY922. (A) Steady-state levels of HSP70 and
P0 were analyzed in vehicle (Veh)-, AUY922-(A), or BIIB021 (B)-treated
explant lysates (35 μg/lane). (B) Wt DRG cultures, with (Neuron
+ Schwann cell) and without (depleted) Schwann cells, were treated
with 100 nM AUY922 and analyzed for the indicated chaperones. (A,
B) Tubulin served as a protein loading control. Molecular mass on
left, in kDa. MBP-positive myelin internode lengths in explant cultures
from (C) Wt and (D) C22 mice treated with vehicle, AUY922, or BIIB021
were measured (n = 100–120 segments per group)
and graphed as whisker plots with median (center line), quartiles
(box), and extremes (whiskers); ***P < 0.001;
*P < 0.05; n.s., nonsignificant; two-tailed unpaired
Student’s t-test. (E) Cultures from Wt (top
panel) and C22 (lower panel) mice, treated with the indicated compounds
were stained for MBP (green). Nuclei were visualized with Hoechst
dye (blue). The scale bar is as shown. Data shown are representative
of n = 3–4 independent experiments.
Improved myelin production in DRG explant cultures from
C22 <span class="Species">mice
after treatment with AUY922. (A) Steady-state levels of HSP70 and
P0 were analyzed in vehicle (Veh)-, AUY922-(A), or BIIB021 (B)-treated
explant lysates (35 μg/lane). (B) Wt DRG cultures, with (Neuron
+ Schwann cell) and without (depleted) Schwann cells, were treated
with 100 nM AUY922 and analyzed for the indicated chaperones. (A,
B) Tubulin served as a protein loading control. Molecular mass on
left, in kDa. MBP-positive myelin internode lengths in explant cultures
from (C) Wt and (D) C22mice treated with vehicle, AUY922, or BIIB021
were measured (n = 100–120 segments per group)
and graphed as whisker plots with median (center line), quartiles
(box), and extremes (whiskers); ***P < 0.001;
*P < 0.05; n.s., nonsignificant; two-tailed unpaired
Student’s t-test. (E) Cultures from Wt (top
panel) and C22 (lower panel) mice, treated with the indicated compounds
were stained for MBP (green). Nuclei were visualized with Hoechst
dye (blue). The scale bar is as shown. Data shown are representative
of n = 3–4 independent experiments.
We complemented the biochemical
studies on myelin production with
the direct evaluation of myelin basic protein (<span class="Gene">MBP)-positive internode
segments.[15] Measurement and quantification
of MBP-positive myelin segments in the explant cultures revealed significant
increases in internode lengths in AUY922-treated Wt and C22 cultures,
while the influence of BIIB021 did not reach significance in cultures
from neuropathicmice (Figure C,D). Representative micrographs from each treatment paradigm
are shown and support the positive impact of the two tested compounds
on myelin formation (Figure E), with AUY922 being more efficacious.
AUY922 Supports
Neuromuscular Performance in C22 Mice
To test the effects
of AUY922 on peripheral myelin and the motor
performance of <span class="Disease">neuropathicmice, Wt and C22 littermates were randomly
segregated at 7 weeks of age into vehicle and AUY922 treatment cohorts.
Animals were injected via the peritoneum with 2 mg/kg AUY922 twice
a week, for 20 weeks. Note that this chosen dosing regimen is significantly
distinct from the short-term, daily, 50 mg/kg treatment paradigm used
for tumor reduction in athymic mice.[23] As
shown (Figure A),
the body weight gain of the animals treated with the drug is similar
to that of those injected with vehicle over the period of the study,
implying no adverse effects of the drug on the overall health of the
mice. Effects of AUY922 treatment on the motor performance of Wt and
C22mice were assessed on the accelerating rotarod at the beginning
of the study and monthly thereafter. Since biological sex does not
affect rotarod performance,[24,25] values for male and
female mice were combined. At baseline (7 weeks of age), there is
a significant difference in the ability of Wt and C22mice to stay
on the rotating rod, and this difference becomes more pronounced at
the end of the study, when the vehicle-treated groups are compared
(Figure B,C). This
is in agreement with the progressive nature of this disease in the
C22 model.[13,26] At baseline, the vehicle and
AUY922 treatment groups of C22mice do not differ in their latencies
to fall (Figure B);
however, at the end of the study the AUY922-treated C22mice perform
significantly better than the vehicle-treated group (Figure C). An ANOVA test on latency
for the rotating rod was conducted for baseline and for 2, 6, 10,
14, and 20 weeks of treatment (Figure D). Genotype differences were observed for 2, 6, and
10 weeks of treatment. There was a tendency (P =
0.072) for a genotype difference at week 14, and the main effects
of genotype [F(1, 21) = 9.74, P,
0.01] and treatment [F(1, 21) = 8.49, P, 0.01] were observed for week 20 (Figure D). Post hoc tests indicate that the performance
of C22AUY922mice was not different from that of Wt vehicle-treated
mice for weeks 14 and 20 (Figure C,D). Furthermore, post hoc tests examining treatment
effects in each genotype indicated that the effect was restricted
to C22mice. Finally, a repeated measures ANOVA test between baseline
and week 20 within each genotype and treatment group indicated that
the C22 vehicle-treated mice showed a decreased performance [F(1, 5) = 7.39, P, 0.05] (Figure D).
Figure 4
Treatment with AUY922
improves neuromuscular performance of C22
mice. (A) Mean ± SEM of the body weight of Wt and C22 mice (n = 6–8 mice per group) was plotted over the treatment
period. Performances of individual animals on the accelerating rotarod
(B) at baseline (7 weeks age) and (C) at the end of the treatment
(25 weeks age) are shown. The bars represent the mean for each group.
(D) Mean ± SEM of the rotarod performance of all groups, plotted
over the treatment period. (E) Muscle force, analyzed using an in
situ technique, was recorded and normalized to the animal’s
body weight (mN/g = millinewtons/grams). Each point represents the
mean ± SEM force. (F) Distribution of individual measures of
the cross-sectional area of TA muscle from C22 mice treated with vehicle
or AUY (n = 3–5 mice per group). The bars
represent the mean for each group. For all graphs, # indicates a significant
(#P < 0.05, ##P < 0.01, ###P < 0.001) genotype difference. *P <
0.05, **P < 0.01, and ***P <
0.001 indicate a significant treatment effect for C22 mice.
Treatment with AUY922
improves neuromuscular performance of <span class="Gene">C22mice. (A) Mean ± SEM of the body weight of Wt and C22mice (n = 6–8 mice per group) was plotted over the treatment
period. Performances of individual animals on the accelerating rotarod
(B) at baseline (7 weeks age) and (C) at the end of the treatment
(25 weeks age) are shown. The bars represent the mean for each group.
(D) Mean ± SEM of the rotarod performance of all groups, plotted
over the treatment period. (E) Muscle force, analyzed using an in
situ technique, was recorded and normalized to the animal’s
body weight (mN/g = millinewtons/grams). Each point represents the
mean ± SEM force. (F) Distribution of individual measures of
the cross-sectional area of TA muscle from C22mice treated with vehicle
or AUY (n = 3–5 mice per group). The bars
represent the mean for each group. For all graphs, # indicates a significant
(#P < 0.05, ##P < 0.01, ###P < 0.001) genotype difference. *P <
0.05, **P < 0.01, and ***P <
0.001 indicate a significant treatment effect for C22mice.
Next, to examine the effects of
AUY922 on skeletal muscle strength,
we performed in situ force-frequency contractile analysis on the tibialis
anterior (TA) muscle.[27−29] The absolute maximal <span class="Disease">tetanic force generated by the
TA after sequential single stimulations of the common peroneal nerve
was measured and normalized to the body weight of the animal (Figure E). We found a significant
(∼28%) increase in force generation in C22 animals treated
with AUY922, as compared to the vehicle group. In addition, an assessment
of myofiber cross-sectional area within the same set of TA muscles
revealed a significant improvement, or maintenance, of tissue integrity
when compared to the vehicle group (Figure F).
For the analysis of the bioavailability
of AUY922, blood and liver
tissues were collected at the end of the study. While all samples
were acquired within a 4 h time window of the final injection, <span class="Chemical">AUY922
concentration varied in sera and liver: from 2.78 to 226 ng/mL in
the sera and 101 to 304 ng/g in the liver. Overall, these results
indicate that the AUY922 treatment paradigm is well-tolerated by neuropathicC22mice and results in the attenuation of declining neuromuscular
performance and myofiber atrophy.
AUY922 Treatment Maintains
Myelinated Axons in C22 Neuropathic
Mice
Histopathological defects in peripheral nerves of C22
<span class="Species">mice include repeated demyelination and remyelination of medium to
large axons with onion bulbs and signs of acute myelin breakdown,
with macrophage infiltration[11].[30] Cross-sectional analyses of sciatic nerves from
the C22 vehicle group revealed these characteristics, when compared
to the Wt vehicle group (Figure A). However, in our cohort of mice, the occurrences
of these disease-associated pathological features are notably reduced
compared with the original publication by the Huxley lab.[11] Since the severity of the C22 phenotype depends
on the copy number of the transgene,[26] we
compared archived tissue from ∼2007 to tissue from mice used
in this study. We found no change in transgene copy number by qPCR.
We further analyzed the genetic background and determined that historically
the mice were on a mixed C57BL/6J and C57BL/6N background, but because
of our maintenance breeding scheme, they are now on a predominantly
CBA background. This shift in genetic background likely accounts for
changes in severity from previous reports. Since all the studies described
here use contemporary littermate controls, this should not affect
the interpretation of the results. Indeed, we found that the nerves
from AUY922-treated C22mice contained distinct, well-myelinated axonal
profiles, with a rare occurrence of degenerating fibers and onion
bulbs, compared with the vehicle group (Figure A). We found no apparent differences in the
histology of nerves from Wt mice treated with either vehicle or AUY922.
Figure 5
AUY922
administration supports the maintenance of myelinated axons
in sciatic nerves of C22 mice. (A) Cross-sectional views of nerve
sections from Wt (top panels) and C22 (lower panels) male mice. Micron
bar, 45 μm. (B) The cross-sectional area occupied by nerve fibers
in a 40 μm × 40 μm square (n = 20–25
fibers per animal; n = 6–8 mice per group)
was measured and graphed as shown. Graph plotted as means ± SEM;
***P < 0.001, across the treatment groups; #P < 0.05, across the genotypes; two-tailed unpaired Student’s t-test. Correlative analyses between axon and fiber diameter
measurements were obtained from sciatic nerve cross-sectional areas
from (C) Wt and (D) C22 groups. (E) Comparison of trendlines between
the cohorts in parts C and D. Scatter plots comparing the g-ratios (axon diameter/fiber diameter) of individual fibers
plotted as a function of axon diameters in nerves of (F) Wt and (G)
C22 animals. (C–H) n = 950–1100 fibers
per group. (H) Trendline comparisons of graphs in parts F and G.
AUY922
administ<span class="Species">ration supports the maintenance of myelinated axons
in sciatic nerves of C22mice. (A) Cross-sectional views of nerve
sections from Wt (top panels) and C22 (lower panels) male mice. Micron
bar, 45 μm. (B) The cross-sectional area occupied by nerve fibers
in a 40 μm × 40 μm square (n = 20–25
fibers per animal; n = 6–8 mice per group)
was measured and graphed as shown. Graph plotted as means ± SEM;
***P < 0.001, across the treatment groups; #P < 0.05, across the genotypes; two-tailed unpaired Student’s t-test. Correlative analyses between axon and fiber diameter
measurements were obtained from sciatic nerve cross-sectional areas
from (C) Wt and (D) C22 groups. (E) Comparison of trendlines between
the cohorts in parts C and D. Scatter plots comparing the g-ratios (axon diameter/fiber diameter) of individual fibers
plotted as a function of axon diameters in nerves of (F) Wt and (G)
C22 animals. (C–H) n = 950–1100 fibers
per group. (H) Trendline comparisons of graphs in parts F and G.
We corroborated the microscopic
observations with morphometric
analyses of randomly selected cross-sectional nerve areas from independent
<span class="Species">mice (Figure B–H).
The total area occupied by nerve fibers within a fixed size square
is significantly increased in AUY922-treated C22 animals as compared
to the vehicle group (Figure B). Upon comparison of axon and fiber diameters in Wt groups
(Figure C–E),
we found no deviation in the overall values (coefficient of correlation, r2 = 0.96, in both vehicle and AUY922 groups).
However, in nerves from the C22 neuropathic animals, we found a delineation
between the vehicle (r2 = 0.94) and AUY922
(r2 = 0.96) groups. A similar pattern
is obtained when the g-ratios (axon/fiber diameter)
were analyzed as a function of axon diameter (Figure F–H) in nerves of C22 animals (r2 = 0.03 in vehicle versus r2 = 0.23 in AUY922). This is in contrast to the trend
observed in vehicle- (r2 = 0.29) and AUY922-treated
(r2 = 0.28) Wt samples. A correlative
analysis suggests that an increase in fiber diameter in vehicle-injected
C22 animals is not accompanied by a proportional increase in axon
diameter, and this is reflected in the altered g-ratio
values. However, this signature is rectified with AUY922 treatment
where the patterns are comparable to the Wt cohorts. Together, these
results indicate that biweekly injection of AUY922 supports the maintenance
of myelinated axons in C22 neuropathicmice.
Figure 6
Improved processing of
PMP22 in AUY922-treated C22 mice. (A) Sciatic
nerve lysates (5 μg/lane) were treated with either EndoH (column
H) or PNGaseF (column N) and probed with antihuman PMP22 antibodies.
No enzyme samples served as controls (column C). EndoH-resistant (arrows)
and EndoH-sensitive (arrowheads) PMP22 fractions are marked. (B) Quantification
of EndoH-resistant PMP22 fractions in sciatic nerves. (C) PMP22-positive
aggregates per microscopic field (0.1 mm2) were counted
in longitudinal sections of sciatic nerves. (D) Representative images
of anti-PMP22 antibody stained (red) nerve sections from Wt (insets)
and C22 mice are shown. Arrows mark PMP22-positive aggregates. Hoechst
dye (blue) was used to visualize the nuclei. The scale bars are as
shown. (E) Steady-state levels of HSP70 and HSP27 in vehicle (Veh)-
and AUY922 (AUY)-treated nerve lysates (30 μg/lane) were quantified
from (F, G) independent Western blots. (H) Whole liver lysates (30
μg/lane) were processed for (I, J) HSP70 and HSP27 quantification.
(E–J) GAPDH or tubulin served as a loading control. Molecular
mass on left in kDa. (B, C, F, G, I, J) n = 3–8
mice per group and plotted as means ± SEM; ***P < 0.001; ***P < 0.01; *P < 0.05; n.s., nonsignificant; two-tailed unpaired Student’s t-test.
Improved processing of
PMP22 in <span class="Chemical">AUY922-treated C22mice. (A) Sciatic
nerve lysates (5 μg/lane) were treated with either EndoH (column
H) or PNGaseF (column N) and probed with antihumanPMP22 antibodies.
No enzyme samples served as controls (column C). EndoH-resistant (arrows)
and EndoH-sensitive (arrowheads) PMP22 fractions are marked. (B) Quantification
of EndoH-resistant PMP22 fractions in sciatic nerves. (C) PMP22-positive
aggregates per microscopic field (0.1 mm2) were counted
in longitudinal sections of sciatic nerves. (D) Representative images
of anti-PMP22 antibody stained (red) nerve sections from Wt (insets)
and C22mice are shown. Arrows mark PMP22-positive aggregates. Hoechst
dye (blue) was used to visualize the nuclei. The scale bars are as
shown. (E) Steady-state levels of HSP70 and HSP27 in vehicle (Veh)-
and AUY922 (AUY)-treated nerve lysates (30 μg/lane) were quantified
from (F, G) independent Western blots. (H) Whole liver lysates (30
μg/lane) were processed for (I, J) HSP70 and HSP27 quantification.
(E–J) GAPDH or tubulin served as a loading control. Molecular
mass on left in kDa. (B, C, F, G, I, J) n = 3–8
mice per group and plotted as means ± SEM; ***P < 0.001; ***P < 0.01; *P < 0.05; n.s., nonsignificant; two-tailed unpaired Student’s t-test.
Subcellular Processing
of PMP22 Is Improved in AUY922-Treated
Neuropathic Mice
Previously, we showed impaired trafficking
of the ectopic human <span class="Gene">PMP22, as indicated by a reduction in the endoglycosidase
H (EndoH)-resistant protein fraction, in sciatic nerves of C22mice.[13] To investigate whether the AUY922-associated
improvements in nerve morphology and neuromuscular performance are
linked with improved trafficking of PMP22, we subjected sciatic nerves
to biochemical analyses (Figure A,B). In nerves from Wt mice, the EndoH-resistant fraction
of PMP22 does not change upon AUY922 treatment (83.7 ± 5.7 vs
80.0 ± 7.3). On the other hand, in samples from neuropathicmice,
we observed a significant AUY922-dependent increase (∼11%)
in the EndoH-resistant, membrane-associated PMP22 (54.3 ± 1.5
vs 60.2 ± 1.9), indicating improved subcellular processing.
Mistrafficking of PMP22 within Schwann cells leads to cytosolic protein
aggregation, a cellular phenotype previously observed in nerves from
<span class="Gene">C22 animals.[13,31] To assess the effects of AUY922
administration on intracellular PMP22 aggregation, we stained longitudinal
nerve sections with anti-PMP22 antibodies.[13] Quantification of PMP22-positive protein aggregates within a fixed
field (0.1 mm2) identified an approximately 5-fold increase
in samples from C22 vehicle-treated mice, as compared to the Wt group
(Figure C). The frequency
of protein aggregates is reduced by ∼1.7-fold (5.0 ± 0.7
vs 2.9 ± 0.9) upon AUY922 treatment and is associated with improved
myelin-like localization of PMP22 (Figure C,D). Note that, with AUY922 administration,
the PMP22-like immunostaining appears uniform and is similar to nerves
from Wt animals (insets in upper right corners). These results suggest
that the improvements in nerve morphology are linked, in part, with
enhanced processing of the overproduced PMP22.
Next, we confirmed
the bioactivity of AUY922 by evaluating chaperone
expression in the sciatic nerve (target tissue) and liver, where <span class="Chemical">AUY922
is metabolized.[23] We measured the levels
of HSP70 and HSP27, as they are both regulated by HSF-1 (Figure E–J). In the
sciatic nerves from drug-treated mice, the expressions of HSP70 and
HSP27 are increased, confirming the induction of the chaperone pathway
in the target tissue (Figure E–G). Note that the baseline levels of HSP70 are higher
in neuropathic samples as compared to the Wt group, a finding that
is consistent with previous publications.[13,32] Similar to the nerve, quantification from independent Western blots
identifies significant increases in HSP70 and HSP27 in the liver of
drug-injected mice, compared to the vehicle groups (Figure H–J). Therefore, as
suggested by our previous studies with EC137, and in cells from HSP70-deficient
mice,[15,18] HSP70 likely has a critical role in improving
the processing of PMP22 and nerve morphology in samples from C22mice
(Figures and 6). Together, these results confirm the bioavailability
and bioactivity of AUY922 in the sciatic nerve.
Improved Nerve
Morphology in AUY922-Treated TrJ Neuropathic
Mice
Enhancements of chaperones by intermittent fasting or
curcumin administ<span class="Species">ration have shown benefits in TrJ neuropathicmice.[16,33] Further, functional HSP70 is critical in the delivery of TrJ-PMP22
(L16P mutation) to the lysosomes for degradation.[18] Therefore, we evaluated AUY922 in cohorts of male and female
TrJ mice, starting the drug administration at 6 weeks of age. Nerves
from vehicle-treated neuropathicmice show severe demyelination and
axonal atrophy (Figure A, left), as described previously.[34] In
comparison, samples from the AUY922-treated group contain discernible
myelinated axonal profiles and an improved overall nerve structure
with larger caliber axons (Figure A, right).
Figure 7
AUY922 promotes the maintenance of myelinated
axons in TrJ mice.
(A) Cross-sectional views of nerve sections from vehicle- (left) and
AUY-treated (right) TrJ mice. Micron bar, 20 μm. (B–E)
Morphometric analysis of nerves from vehicle- and AUY-treated TrJ
mice (n = 4 mice, 320 fibers, 30–40 areas
per group). (B) Percent area occupied by fibers, (C) fiber diameter,
(D) myelin sheath thickness, and (E) g-ratios were
graphed. (F) Rotarod performance at the baseline and at the end of
treatment is shown for vehicle- or AUY-treated TrJ mice. (G) Myofiber
cross-sectional area of TA muscle from the indicated groups (n = 5 mice, 695 fibers per group). (H) Sciatic nerve (30
μg/lane) and whole liver lysates (30 μg/lane), with (I,
J) quantification, from vehicle (Veh)- and AUY922 (AUY)-treated TrJ
mice, were assessed for HSP70. (H–J) n = 6–14
mice per group, with GAPDH serving as a loading control. Molecular
mass on left, in kDa. Graphs plotted as means (C, G) ± SEM (B,
F, I, J) or as whisker plots with median (center line), quartiles
(box), and extremes (whiskers) (D, E); ***P <
0.001; **P < 0.01; *P < 0.05;
two-tailed unpaired Student’s t-test.
AUY922 promotes the maintenance of myelinated
axons in TrJ <span class="Species">mice.
(A) Cross-sectional views of nerve sections from vehicle- (left) and
AUY-treated (right) TrJ mice. Micron bar, 20 μm. (B–E)
Morphometric analysis of nerves from vehicle- and AUY-treated TrJ
mice (n = 4 mice, 320 fibers, 30–40 areas
per group). (B) Percent area occupied by fibers, (C) fiber diameter,
(D) myelin sheath thickness, and (E) g-ratios were
graphed. (F) Rotarod performance at the baseline and at the end of
treatment is shown for vehicle- or AUY-treated TrJ mice. (G) Myofiber
cross-sectional area of TA muscle from the indicated groups (n = 5 mice, 695 fibers per group). (H) Sciatic nerve (30
μg/lane) and whole liver lysates (30 μg/lane), with (I,
J) quantification, from vehicle (Veh)- and AUY922 (AUY)-treated TrJ
mice, were assessed for HSP70. (H–J) n = 6–14
mice per group, with GAPDH serving as a loading control. Molecular
mass on left, in kDa. Graphs plotted as means (C, G) ± SEM (B,
F, I, J) or as whisker plots with median (center line), quartiles
(box), and extremes (whiskers) (D, E); ***P <
0.001; **P < 0.01; *P < 0.05;
two-tailed unpaired Student’s t-test.
We quantified these morphological
measurements from vehicle- and
drug-treated TrJ mice and found statistically significant improvements
in the nerve tissue area occupied by fibers, which correlates with
an increase in nerve fiber diameter (Figure B,C). The thickness of myelin around individual
axons is also improved, leading to an overall improvement in nerve myelination as reflected by a reduction
in g-<span class="Species">ratio (Figure D,E). However, we did not observe any obvious improvements
in the motor behavior or locomotion of AUY922-treated TrJ mice. The
rotarod data shown in Figure F are representative of several independent cohorts of mice
and indicate no treatment effect. In agreement, we failed to identify
changes in TA myofiber cross-sectional area upon drug treatment (Figure G).
For each
mouse, we tested the bioactivity of the drug in target
tissues by analyzing the levels of <span class="Gene">HSP70 in the nerve and liver, as
above (Figure E–J).
The levels of HSP70, which are significantly elevated in TrJ neuropathic
nerves as compared with Wt,[16] did not increase
further upon treatment with AUY922 (Figure H,I). In comparison, the liver of injected
mice showed a statistically significant increase in HSP70 upon AUY922
treatment (Figure H,J). Note that all tissues were collected within 4–6 h of
the last drug injection to facilitate the detection of bioactivity.
Overall, the results from TrJ neuropathicmice indicate significant
improvements in nerve morphology, without detectable benefits in neuromuscular
performance or TA myofiber size.
Discussion
In
this study, we show enhanced neuromuscular function and improved
peripheral nerve morphology in AUY922-treated <span class="Disease">C22 neuropathicmice.
These benefits are accompanied by correction in the subcellular processing
of the overexpressed, disease-causing PMP22 protein. In comparison,
in the more severe, PMP22 mutant TrJ neuropathicmice, the improvements
in nerve myelination failed to affect neuromuscular performance. Overall,
the findings presented here agree with other reports on the benefits
of chaperone-inducing compounds in various neurodegenerative conditions.[35,36] Further optimization of compound delivery, including dosage, timing,
and route of administration, may aid in improving drug efficacy in
hereditary peripheral neuropathies.
The benefits of HS pathway
activation have been documented in various
protein misfolding disorders of the CNS;[1−3,37,38] however, there have been fewer
studies in the PNS. Induction of the HS stress pathway, including
increased expression of chaperones by a 5 month long intermittent
fasting regimen in TrJ mice, improved peripheral nerve morphology
and myelination.[16] Significantly, the improvements
in nerve morphology were paralleled with maintenance of motor performance,
despite disease progression in ad libitum fed <span class="Disease">neuropathicmice. A
more direct correlation between the subcellular processing of PMP22
and chaperones is evident from in vitro studies, where EC137, a synthetic
HSP90 inhibitor, successfully activated the HS pathway and improved
myelination by Schwann cells from neuropathicC22mice.[15] Due to the lack of availability of EC137, here
we screened a set of commercially available compounds, with similar
pharmacological properties. Due to their antiproliferative properties,
the potential effects of HSP90 inhibitors on cellular toxicity are
of major concern,[39] particularly when chronic,
long-term administration is needed. However, at lower dosages, these
drugs can robustly activate the stress pathways without cell death,
which is beneficial for protein misfolding diseases.[8]
Identification of the ideal therapeutic compound
for hereditary
peripheral neuropathies poses specific challenges, as within a <span class="Disease">neuropathic
nerve there is a heterogeneous population of Schwann cells, with regards
to the differentiation state.[40] Initially,
we selected low, nanomolar drug concentration ranges in the MTS assay,
which did not affect the viability of nonmyelinating, mitotic Schwann
cells. In the context of myelination, which requires the differentiation
of Schwann cells, we identified AUY922 (100 nM) as the most effective
drug in increasing myelin synthesis, with BIIB021 closely behind (Figure ). We tested both
of these compounds in cohorts of mice and found that oral administration
of BIIB021 in neuropathic animals proved to be a challenge, while
intraperitoneal (i.p.) injections with this compound gave an inconsistent
read out on bioactivity in target nerve tissue. The mechanism for
AUY922-mediated nerve improvement likely involved HSP70, as this specific
chaperone has been shown to alleviate protein aggregation in several
neurodegenerative diseases, including PMP22-associated neuropathies.[4,18,37,38,41] Indeed, HSP70 was robustly induced in the
liver and nerve of drug-treated C22mice. A critical role for HSP70
in our treatment paradigm is further supported by the study where
the crossing of HSP70-knockout with TrJ mice exacerbated the neuropathic
phenotype.[42] Nonetheless, while AUY922
is considered to be a “classical HSP90 inhibitor” that
upregulates HSP70 and HSP27, HSP90α knockdown studies in cultured
cells indicate multiple targets.[43] Therefore,
in addition to the inhibition of HSP90 and upregulation of HSP70 and
HSP27, additional mechanisms may have contributed to the beneficial
effects of AUY922 treatment on neuropathicmice.
As originally
described, C22 <span class="Species">mice used in this study had a strong
phenotype within weeks of birth, including an unsteady gait and sudden
reaction to loud noises.[11] Subsequently,
the mice developed distinct motor disabilities, with nerve demyelination
and muscle atrophy by about 6 months of age.[31,44,45] Our study was initiated at 7 weeks of age,
as only at this age we detected significant impairment of the C22mice on the rotarod, as compared with age-matched Wt littermates (Figure B). In our laboratory,
we have been breeding the C22mice for nearly 15 years, and over time
the animals became less phenotypic and are now similar to what has
been described for the C3 mice.[26] However,
by genotyping we detect the humanPMP22 transgene by PCR; the copy
number is unchanged from tissue banked from mice studied several years
ago, and the human protein is highly expressed.[13] Still, these mildly affected C22mice benefitted from the
AUY922 therapy, which we distinguished by improvements in both nerve
and muscle morphology. In comparison, the more severely affected TrJ
mice only showed improvements in nerve morphology without behavioral
or skeletal muscle benefits. The difference in the response of the
C22 and TrJ mice to AUY922 therapy could be the results of underlying
developmental deficits in the neuromuscular system in TrJ that are
refractory to HSP therapy.[46] The heightened
inflammation in nerves of TrJ mice, as compared to the C22 model,[13,47] could be an additional factor in impacting the response. Furthermore,
at the baseline, nerves from both TrJ and C22mice have elevated levels
of HSP70;[32] however, only in the C22 samples
did we detect a significant increase upon AUY922 treatment. The variance
in drug effectiveness could be the result of differences in drug metabolism,
as well as the genetic defects, and emphasizes the need for optimization
of drug therapies for the various forms of PMP22-linked neuropathies,
in mice and humans.
Albeit the availability of animal models
and advancements in the
understanding of CMT1A pathobiology, the therapeutic options for affected
<span class="Species">patients are limited. One of the promising therapeutic candidates,
ascorbic acid, elicited prominent improvement of the neuropathic phenotype
in C22mice;[12] however, it has failed in
independently conducted clinical trials.[48,49] Progesterone antagonists are another class of therapeutic drugs
which promoted improvements in motor performance in rats that overexpress
PMP22.[50] The high toxicity and potential
side effects of available progesterone antagonists, however, impeded
further testing in human clinical trials.[51] Another small molecule, rapamycin, an activator of autophagy and
an immunosuppressant, improved the myelin structure of TrJ sciatic
nerves without significant benefits in motor performance.[47] The rapamycin study emphasizes the potential
distinct response of nerve and muscle tissue to drugs, when using
systemic administration. Besides natural and engineered drugs, dietary
supplements have been explored to alleviate neuropathic symptoms.
For example, curcumin, and more recently pyruvate supplementation
in conjunction with NT-3 gene therapy, has shown benefits in improving
nerve morphology and motor performance in TrJ mice.[33,52] Curcumin, which is known to work through the HSP70 pathway,[42] could be readily tested as a food supplement
in CMT1A patients. Together, these preclinical studies in rodents
emphasize the need for stringent evaluation of potential drug candidates,
preferably in more than one independent animal model.
As of
today, there have been two human clinical trials for CMT1A,
both using orally available molecules. The first trial tested ascorbic
acid (vitamin C) to correct the expression of the overproduced PMP22;[12,53] however, this multicenter trial with nearly 500 CMT1A patients proved
unsuccessful in providing benefits.[49] A
recent international Phase 3 clinical trial for CMT1A used pleiotropic
drug therapy, including a low dose combination of baclofen, naltrexone,
and D-sorbitol.[54] Formal publication on
the results from this clinical trial has not been made public. In
a recent study, PMP22 antisense oligonucleotides (ASOs) were utilized
to treat C22mice and CMT1A rats, and a 50% reduction was reported
in the PMP22 mRNA, with significant improvements in myelinated axons.[55] Therefore, an additional approach could involve
the combined use of small molecules, gene therapy, dietary supplements
such as curcumin, phospholipids, and/or exercise. While the underlying
subcellular pathogenesis of hereditary demyelinating neuropathies
is complex and might be significantly distinct across the genes involved,
the neuromuscular system has robust plasticity,[56] which aids repair. While optimization of HSP90 inhibitor
drug dosing and the route of administration needs improvement for
efficacy, our results suggest that activation of the chaperone pathway
alone, or in combination with another therapeutic approach, may provide
benefits in ameliorating the neuropathic phenotype in affected individuals.
Methods
Mouse Colonies and Genotyping
A founder pair of C22
<span class="Species">mice (MGI: 2183770) obtained from Dr. Clair Huxley[11] were bred on C57Bl/6 or on CBA/CaJ background for multiple
generations. Heterozygous Trembler J (TrJ, MGI: 1856217) mice on a
C57BL/6J background were bred to wild type C57BL6/J mice, obtained
from Jackson laboratories. All animals were maintained under SPF conditions
within the University of Florida animal care facilities and strictly
in compliance with procedures approved by the Institutional Animal
Care and Use Committee (IACUC). For genotyping C22mice, DNA was obtained
from tail biopsies of less than 8 day old pups and analyzed by PCR
using the following primer sets: C22- 5′ TTCTGCTGCCTGTGAGGAC
3′ and 5′ GGGTGAAGAGTTGGCAGAAG 3′
which yield a 209 bp product. The endogenous mousePMP22 was identified
using the following primers: 5′ GGTTGCCAAACTGGAGTGAT
3′ and 5′ CGGCTCTGTCAAGATTAGCC 3′
yielding a 458 bp product. TrJ mice were genotyped as described.[34] At weaning age, littermates were segregated
by genotype and sex and randomly assigned to vehicle and AUY922 treatment
groups. All efforts were made to reduce the number of animals used
and to minimize their discomfort.
Analysis of Transgene Copy
Number and Genetic Background
To investigate the milder phenotype
observed in our present colony
of C22 <span class="Species">mice, we analyzed the PMP22 transgene copy number and the genetic
background of the mice used in this study, in comparison to archived
material from 10 years ago, when the phenotype more closely matched
previous reports. The liver was used as the source of genomic DNA,
and QPCR was performed for the humanPMP22 transgene
using mousePmp22 as an internal standard, as described.[26] Four archived samples, and four samples from
mice used in the present study, were analyzed. No change in transgene
copy number was detected between the two sets of tissue samples. As
an alternative explanation for the change in phenotype, we also examined
the genetic background of the mice using a panel of 48 SNP markers
spanning the autosomes and X chromosome. These markers are used routinely
for genetic quality control at The Jackson Laboratory. This analysis
revealed that the archived samples were a mix of C57BL/6J and C57BL/6N
genetic backgrounds, whereas the mice used in the current study were
predominantly CBA/Ca but still carried some heterozygous C57BL/6 alleles
on a subset of chromosomes. On the basis of these analyses, we conclude
the change in phenotype is due to the change in genetic background.
However, as all studies described here used contemporaneous littermate
controls and did not rely on historical data for comparison, this
does not influence the interpretation of our results.
Cell Culture
Models
Nonmyelinating Schwann cell cultures
were established from the sciatic nerves of postnatal day 2 rats,
as described.[10] The cells were maintained
in DMEM (Gibco, Thermo Fisher, Waltham, MA) and supplemented with
10% FCS (HyClone, Thermo Fisher), 100 μg/mL <span class="Species">bovine pituitary
extract (Biomedical Technologies Inc., Stoughton, MA), and 5 μM
forskolin (Calbiochem, Millipore, Burlington, MA). Dorsal-root ganglion
(DRG) explants were established from embryonic day 12–13 Wt
and C22 embryos.[15] Briefly, DRGs were dissociated
in 0.25% trypsin (Gibco) and plated onto collagen-coated cell culture
wells. DNA isolated from each embryo was used for genotyping, as described
above. All explants were maintained in MEM (Gibco), 10% FCS (Hyclone),
0.3% glucose (Sigma-Aldrich, St. Louis, MO), 10 mM HEPES (Gibco),
and 100 ng/mL nerve growth factor (Harlan Bioproducts for Science,
Indianapolis, IN) for 7 days. The cultures were then supplemented
with 50 μg/mL ascorbate for an additional 7 days to promote
myelin formation. For Schwann cell-depleted neuronal cultures, explants
were subjected to alternate-day treatment with 5-fluoro-2′-deoxyuridine
(FUdR) for 10 days and then continued on the same paradigm described
above.[15]
In Vitro Pharmacologic
Treatment Paradigms
HSP90 inhibitor
compounds, including AT13387 (S1163), AUY922 (S1069), BIIB021 (S1175),
SNX5422 (S2656), and STA9090 (S1159), were purchased from Selleckchem
(Houston, TX) and stored at a stock concentration of 1 mM in DMSO.
Primary Schwann cells were treated with HSP90 inhibitors at the indicated
concentrations in complete media (see above), 24 h after seeding.
DMSO served as the vehicle control while geldanamycin (GA) was used
as a positive control for heat shock pathway activation. The DRG explant
cultures were maintained for 7 days in ascorbate-containing media
prior to treatment with either DMSO, AUY922 (100 nM), or BIIB021 (100
nM), every third day (72 h apart). Cultures were procured, 24 h after
the third treatment, for either biochemical or immunochemical analyses.[15]
Cell Viability Assay
Schwann cells
were plated at a
seeding density of 104 cells/well in a 96-well plate (Nunc,
Thermo Fisher), coated with poly-l-lysine (Sigma), and treated
with either DMSO or an <span class="Gene">HSP90 inhibitor at the desired concentrations
for 24 h.[15] At the end of the treatment,
cells were incubated in a mixture of MTS (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) (333 μg/mL) and phenazine methosulfate
(25 μM) for 2 h at 37 °C, producing the soluble formazan
product (Promega, Madison, WI). The formazan product was measured
spectrophotometrically at 490 nm and graphed as a percent of DMSO-treated
controls using GraphPad Prism v5.0 software.
Quantitative RT-PCR
Rat Schwann cells, treated with
either <span class="Chemical">DMSO or the selected HSP90 inhibitor compounds (100 nM), were
harvested in TRIzol (Invitrogen, Carlsbad, CA), and RNA was isolated
as per the manufacturer’s instructions. A 1 μg portion
of total RNA was used to synthesize cDNA using the SuperScript III
first strand synthesis kit (Invitrogen). The same volume of undiluted
cDNA from each sample was used for real time (RT)-PCR analysis, using
the SYBR GreenER qPCR kit (Invitrogen) and QuantiTect Primer for HSP70
(QT00370489) or GAPDH (QT00199633). The normalized transcript levels
of HSP70 relative to geldanamycin (GA) were determined using the 2–ΔΔCT method.[57] Values obtained were analyzed and graphed with the help of GraphPad
Prism v5.0 software.
AUY922 Administration, Rotarod Testing, and
Serum and Liver
Analyses
During the course of the study, the body weight
of each mouse was recorded twice per week. Baseline rotarod measurements
were obtained before the start of the compound treatment at 12 weeks
of age for <span class="Gene">C22 and at 6 weeks of age for TrJ mice. The mice were trained
the first 2 days at 5 rpm for 60 s: three trials/day, with 30 min
breaks.[16] On the third day, mice were tested
on the rotarod, accelerating from 16 to 36 rpm in steps of 4 rpm increase/min.[42] The control groups were injected intraperitoneally
(i.p.) twice/week with the vehicle consisting of 10% DMSO, 5% Tween-20,
and 85% saline.[23] The treatment groups
received 2 mg/kg AUY922, using the same route and vehicle for administration.
Dosage for AUY922 was determined on the basis of the half-life of
the compound in plasma[23] and results of
the in vitro experiments (see Figures and 3). Rotarod testing was
done on all groups monthly, where all mice underwent the same 3 day
testing. The time on the rotarod before falling was recorded for each
mouse and graphed. The study was terminated after 20 weeks of drug
treatment. At termination, the mice were sacrificed within 4 h after
the final injection, and blood and tissue samples were collected.
Blood was collected into tubes with clot activator gel (BD 365967,
Franklin Lakes, NJ) and centrifuged at 10 000 rpm for 5 min
to isolate serum. Serum and liver samples were sent to Charles River
Laboratories (Wilmington, MA) for processing and analysis of AUY922
concentration via protein precipitation, followed by LC-MS/MS using
glafenine and carbamazepine as internal standards.
In Situ Isometric
Twitch Torque Analyses
The isometric
twitch torque analysis was performed on the tibialis anterior (TA)
muscle and anterior tibial tendon. Under anesthesia, the skin and
fascia surrounding the distal hindlimb were surgically removed exposing
the TA. A braided (4–0) silk surgical suture (Teleflex Medical,
Wayne, PA) was secured around the anterior tibial tendon before all
tendons to the foot were detached. Mice were positioned in dorsal
recumbence on a preheated physiology table to maintain body tempe<span class="Species">rature
at 37 °C. A clamp was used to secure the hindlimb at 90°
at the knee, and the paw was positioned to the physiology table using
transpore surgical tape (3M). The anterior tibial tendon was secured
to a 300C-LR-FP muscle lever (Aurora Scientific, Aurora, ON, Canada).
Cathode and anode electrodes were inserted distal to the fibular to
stimulate the peroneal nerve. Under control of the Dynamic Muscle
Control (DMC) and Analysis (DMA) Software suite (Aurora Scientific),
optimal electrode placement was determined by repositioning of the
electrodes and stimulating the nerve at 1 Hz until the maximum twitch
amplitude was recorded for a given position. Optimal length-tension
was determined by performing the isometric twitch stimulation at an
increasing range of amplitudes and tensions until the maximum twitch
amplitude was observed. Three successive tetanic stimulations (200
Hz, 100 pulses per train, 60 s between independent stimuli) were performed,
and the muscle was allowed to rest for 5 min. Single stimulations
at 15, 30, 60, 100, 120, 160, and 200 Hz were then performed with
30 s between each successive frequency, and the resulting torque was
recorded and analyzed using DMC and DMA (Aurora Scientific).
Western
Blot Analyses
Cell harvesting and tissue homogenization
were done in sodium dodecyl sulfate (<span class="Chemical">SDS) gel sample buffer (62.5
mM Tris pH 6.8, 10% glycerol, 3% SDS), supplemented with protease
and phosphatase inhibitors.[15] Protein concentrations
were measured using BCA assay (Pierce, Thermo Fisher). Digestions
using endoglycosidase H (EndoH) or N-glycosidase F (PNGaseF) enzymes
(New England Biolabs) were performed to assess the subcellular processing
of PMP22, as described.[58] Equal amounts
of proteins for each experiment were separated on denaturing SDS gels
and transferred to nitrocellulose membrane (0.45 or 0.22 μm
pore size) (Bio-Rad, Hercules, CA). Membranes were blocked in 5% milk
(in Tris-buffered saline with 0.05% Tween-20) and incubated with the
indicated primary antibodies (Table ) overnight at 4 °C. Bound antibodies were detected
with antirabbit, antigoat, antimouse IgG, or antichicken IgY HRP-linked
secondary antibodies (Sigma) and visualized with the chemiluminescence
detection method (PerkinElmer Life Sciences, Waltham, MA). Films were
digitally imaged using a GS-800 densitometer (Bio-Rad) and were formatted
for printing, using Adobe Photoshop.
Table 1
Primary
Antibodies Used in This Studya
dilution
species
antigen
source and
catalog no.
WB
IS
rabbit
HSP70
Stressgen; SPA-812
1:3000
n/a
rabbit
HSP70
Abcam; ab137680
1:2000
n/a
goat
HSP27
Santa Cruz Biotechnology,
Inc.; sc-1049
1:1000
n/a
mouse
GAPDH
Encor Biotechnology, Inc.; MCA-1D4
1:10 000
n/a
rabbit
GAPDH
Encor Biotechnology, Inc.; RPCA-GAPDH
1:8000
n/a
mouse
tubulin
Sigma, St Louis, MO, USA;
T6199
1:2000
n/a
mouse
tubulin
Encor Biotechnology, Inc.; MCA-1B12
1:10 000
n/a
chicken
P0
Encor Biotechnology, Inc.
1:500
n/a
rat
MBP
Chemicon; MAB386
n/a
1:500
rabbit
PMP22
Chittoor et al., 2013
1:1000
1:250
rabbit
laminin
Sigma; L9393
n/a
1:300
WB: Western
blotting. IS: immunostaining.
n/a: not applicable.
WB: Western
blotting. IS: immunostaining.
n/a: not applicable.
Immunostaining
Explant cultures were fixed in 4% paraformaldehyde
(EMS, Hatfield, PA) and permeabilized in 100% ice-cold <span class="Chemical">methanol (Fisher
Scientific, Hampton, NH). After blocking with 5% normal goat serum,
samples were incubated with anti-MBP antibodies, overnight at 4 °C.
Bound antibodies were detected with Alexa Fluor 488goat antirat IgG
(Molecular Probes, Eugene, OR). Coverslips were mounted using the
Prolong Antifade kit (Molecular Probes). Proximal regions of sciatic
nerves were sectioned (5 μm thickness) and processed for immunostaining
with anti-PMP22 antibodies, as described.[13] AlexaFluor 594-conjugated goat antirabbit antibodies were used to
detect the bound primary antibodies. Samples which were processed
in parallel without incubation with primary antibodies served as the
negative controls. Images were obtained using a SPOT digital camera
(Diagnostic Instrumentals, Sterling Heights, MI), with a Nikon Eclipse
E800 or an Olympus DSU spinning disc confocal (Tokyo, Japan) microscope,
using identical exposure settings. Images were processed using Photoshop
(Adobe Systems).
Myelin Internode Length Measurement
DRG cultures were
stained for MBP as described above, to label myelin internode segments.
The MBP-positive internodes were measured using ImageJ software (NIH).
Measurements from three independent experiments, per treatment per
genotype, were graphed using GraphPad Prism software.
Morphometric
Analyses of the Sciatic Nerve
Proximal
ends of sciatic nerves from vehicle- and AUY922-treated groups were
fixed by immersion in ice-cold 2% <span class="Chemical">paraformaldehyde and 2% glutaraldehyde,
in 0.1 M sodium cacodylate buffer at 4 °C.[59] Plastic sections, stained with toluidine blue, were prepared
by the Robert P. Apkarian Integrated Electron Microscopy Core at Emory
University and imaged with a light microscope (Zeiss Axioscop 2 plus).
Axon diameter, fiber diameter, myelin sheath thickness (n = 320–1100 fibers per group), and total area occupied by
nerve fibers (n = 20–40 areas per group) were
measured using ImageJ software (NIH).[16] The g-ratio was calculated as the axon diameter/fiber
diameter, using the respective values. The myelin sheath thickness
was calculated as [(fiber perimeter – axon perimeter)/2π].[60]
Cross-Sectional Area Analyses of TA Muscles
Fresh-frozen
TA muscles from C22 and TrJ <span class="Species">mice, treated with vehicle or AUY922,
were sectioned at 10 μm thickness and immunostained with rabbit
antilaminin antibody to outline the individual myofibers. AlexaFluor
488-conjugated goat antirabbit secondary antibody was used to detect
the bound primary antibody, and Hoechst was used to label nuclei.
Images were captured using a Nikon DS digital camera fitted on a Nikon
Eclipse E800 microscope. Myofiber cross-sectional areas of individual
fibers were measured using ImageJ software (NIH) and exported to GraphPad
Prism v8.0.1 for analysis.
Data Analyses
For all comparisons,
mean ± SEM
was calculated, and statistical differences were determined using
unpaired the two-tailed Student’s t-test. P-values <0.05 (*), <0.01 (**), and <0.001 (***)
were considered to be significant. For in situ torque analysis, significance
was determined using two-way ANOVA with Sidak’s multiple comparison
between individual groups and frequencies. For longitudinal rotarod
analysis, significance was determined using two-way ANOVA with Fisher’s
LSD post hoc test.
Authors: Alexandra N Scurry; Dante J Heredia; Cheng-Yuan Feng; Gregory B Gephart; Grant W Hennig; Thomas W Gould Journal: J Neuropathol Exp Neurol Date: 2016-02-25 Impact factor: 3.685
Authors: Yiqiang Zhang; Alex Bokov; John Gelfond; Vanessa Soto; Yuji Ikeno; Gene Hubbard; Vivian Diaz; Lauren Sloane; Keith Maslin; Stephen Treaster; Samantha Réndon; Holly van Remmen; Walter Ward; Martin Javors; Arlan Richardson; Steven N Austad; Kathleen Fischer Journal: J Gerontol A Biol Sci Med Sci Date: 2013-05-16 Impact factor: 6.053
Authors: Irina Madorsky; Katherine Opalach; Amanda Waber; Jonathan D Verrier; Chelsea Solmo; Thomas Foster; William A Dunn; Lucia Notterpek Journal: Neurobiol Dis Date: 2009-04 Impact factor: 5.996
Authors: Miriam A Hickey; Chunni Zhu; Vera Medvedeva; Renata P Lerner; Stefano Patassini; Nicholas R Franich; Panchanan Maiti; Sally A Frautschy; Scott Zeitlin; Michael S Levine; Marie-Françoise Chesselet Journal: Mol Neurodegener Date: 2012-04-04 Impact factor: 14.195