Phylogeography of Borrelia spirochetes in Ixodes pacificus and Ixodes spinipalpis ticks highlights differential acarological risk of tick-borne disease transmission in northern versus southern California.

The common human-biting tick, Ixodes pacificus, is the primary vector of the Lyme disease spirochete, Borrelia burgdorferi sensu stricto (ss) in western North America and has been found to harbor other closely-related spirochetes in the Borrelia burgdorferi sensu lato (sl) complex. Between 2008-2015, 11,066 adult and 3,815 nymphal I. pacificus and five adult and 144 nymphal Ixodes spinpalpis, a commonly collected wildlife tick, were collected from 42 California counties. Borrelia burgdorferi sl was detected in 1.2% and 3.8% I. pacificus adults and nymphs, respectively. Results from this study indicate genetic diversity and geographic structure of B. burgdorferi sl in California I. pacificus ticks, by sequence comparison of the16S rRNA gene, with B. burgdorferi ss, the agent of Lyme disease, found only in I. pacificus collected from the north and central coastal and Sierra Nevada foothill regions; B. burgdorferi ss was not detected in ticks tested from southern California. In contrast, Borrelia bissettiae, a member of the B. burgdorferi sl complex, was detected in both I. pacificus and I. spinipalpis, in the coastal region of both northern and southern California, but was absent from ticks in the Sierra Nevada foothills. In a similar pattern to B. bissettiae, Borrelia americana (a member of the B. burgdorferi sl complex) was detected in a single adult I. pacificus from the north coast and two I. spinipalpis nymphs from south-coastal California. This study highlights that the geographic area of Lyme disease acarological risk in California is the north-central and Sierra Nevada foothill regions of the state with little to no risk in the southern regions of the state.

Introduction

There is considerable diversity in the Borrelia burgdorferi sensu lato (sl) complex. Worldwide, members of the B. burgdorferi sl complex include at least 22 named genospecies worldwide, of which ten genospecies have been identified to date in North America: Borrelia burgdorferi sensu stricto (ss), B. americana, B. andersoni, B. bissettiae, B. californiensis, B. carolinensis, B. garinii, B. kurtenbachii, B. laneii, and B. mayonii [1-4]. In California, only B. burgdorferi ss, B. americana, B. bissettiae, B. californiensis, and B. lanei have been described in Ixodes pacificus ticks, along with currently-uncharacterized Borrelia species [2, 5, 6]. While B. burgdorferi ss is the primary etiologic agent of Lyme disease in North America, and B. mayonii causes Lyme disease in the upper Midwest, recent studies suggest that B. bissettiae, a known human pathogen in Europe [7-9], may also infect people in the southeastern United States [10] and California [11].

The recognition of variation within the B. burgdorferi sl complex has direct public health implications. By considering all B. burgdorferi sl positive ticks “positive,” the prevalence for infection, and thus the acarological index of Lyme disease risk, has been overestimated [12]. Furthermore, genospecies other than B. burgdorferi ss may cause human disease, which could manifest with potentially different etiologies.

In this study, molecular methods were used to characterize the Borrelia genospecies of B. burgdorferi sl-positive I. pacificus and I. spinipalpis to investigate large-scale spatial patterns of Borrelia genospecies present in California. Previous studies have identified B. burgdorferi sl and B. miyamotoi in California I. pacificus but did not further resolve B. burgdorferi to genospecies [12]. Ixodes pacificus is a common human-biting tick found along the Pacific Coast of the United States and is the primary vector of Lyme disease to people in this region (https://www.cdc.gov/ticks/geographic_distribution.html). These data enabled us to clarify the relative acarological risk of human exposure to pathogenic Borrelia in a heavily populated state in western North America.

Materials and methods

Tick collection

The California Department of Public Health (CDPH), Vector-Borne Disease Section performs routine surveillance and testing of sylvatic Ixodes ticks for Borrelia spp. spirochetes. This includes relapsing fever group Borrelia (e.g., B. miyamotoi) and members of the B. burgdoferi sl complex [12]. Ixodes pacificus adults and nymphs were collected throughout the state of California from 2008 to 2015. Ticks were collected from low vegetation, leaf litter, or other substrates (e.g., rocks or downed logs) by CDPH and county public health agencies using 1-m2 white double nap flannel “flag” attached to a 1.5-m wooden dowel. In most instances, ticks were collected from public lands such as regional or state parks. Ticks were collected all months of the year, with adult ticks most commonly collected in the winter months and the nymphs in the spring and summer months. Adult and nymphal I. spinipalpis ticks were collected opportunistically by flagging, during the same collection events; this tick species rarely attaches to people but parasitizes wildlife such as woodrats (Neotoma fuscipes and N. macrotis) and may be an important bridge vector for B. burgdorferi sl. Ticks were either maintained alive within 37-mL polystyrene containers (Fisher Scientific, USA) in sealed plastic bags with moistened paper toweling at 3°C or retained in 70% ethanol within 1.5-mL microcentrifuge snap-cap tubes.

Tick preparation

Ticks were tested individually by direct florescence antibody assay (DFA), using Borrelia generic fluorescent-labeled antibodies to detect Borrelia species spirochetes. Live ticks were dissected onto etched microscope slides and stained with FITC-labeled BacTrace Anti-Borrelia Species Antibody (KPA) [13, 14]. Half of each dissected tick was transferred to a 2-mL snap cap tube that contained 20ul sterile PBS and stored at -80°C for later use. At least 100 visual fields were examined at 400X magnification for the presence of Borrelia spirochetes.

Ticks that tested positive for Borrelia spirochetes by DFA were further analyzed to determine the Borrelia genospecies. DNA from frozen tick tissues was extracted using QIAGEN DNeasy Blood and Tissue Kit (Hercules, CA) according to manufacturer’s instructions.

Molecular analyses

DNA from DFA-positive ticks was screened for B. miyamotoi and B. burgdorferi sl using a TaqMan assay [15]. Forward and reverse primers were, respectively, 5’GCTGTAAACGATGCACACTTGGT3’ and 5′GGCGGCACACTTAACACGTTAG 3’ targeting a 1130bp 16S rRNA sequence as described [15]. The probes used were 6FAM-TTCGGTACTA ACTTTTAGTTA corresponding to B. burgdorferi sl and VIC-CGGTACTAACCTTTCGAT TA corresponding to B. miyamotoi with the 3’ ends modified with a minor groove binding protein. All reactions were performed in a final volume of 25 ul on a BioRad CFX96 Real-Time Detection System containing 2x SooFast Probes SuperMix (BioRad), primers (900 nM), and probes (200 nM) per reaction. Thermal cycling conditions were as follows: 95°C for 2 min, 45 cycles of 95°C for 5 sec, and 63°C for 30 sec.

A 1130bp section of the 16S rRNA gene was amplified from TaqMan positive B. burgdorferi sl ticks. Forward and reverse primers were, respectively 5’CTGGCAGTGCGTCTTAAGCA3’ [16] and 5’GACTTATCACCGGCAGTCTTA3’ [17]. PCRs were performed in 25ul volumes with final concentrations of 0.2uM for forward and reverse primers, 200uM dNTPs, and 0.625 units of Taq DNA polymerase per reaction. Thermal cycling conditions were: 94°C for 1 min, 45 cycles of 94°C for 1 min, 61.2°C for 30 sec, and 72°C for 90 sec, followed by final extension of 72°C for 7 min. The PCR products were visualized on a 2% Life Technologies E-gel stained with SYBRgreen (Carlsbad, CA).

PCR product was purified using either Affymatrix ExoSAP-IT (Santa Clara, CA) or QIAquick PCR Purification Kit, according to manufacturer’s instructions, respectively. Samples were sequenced by Quintara (http://www.quintarabio.com/). For each sample, forward and reverse sequences were obtained. The forward and reverse reads were aligned using ClustalOmega (http://www.ebi.ac.uk/Tools/msa/clustalo/) and edited manually. Electropherograms were examined for the presence of conflicting base calls using ApE (http://biologylabs.utah.edu/jorgensen/wayned/ape/) to address the possibility that a tick was co-infected with more than one genospecies of B. burgdorferi sl. In instances where a sample seemed to produce more than one PCR product, suggesting multiple B. burgdorferi sl infections, PCR products were cloned using a Qiagen PCR Cloning Kit. Inserts from 3–5 colonies were then Sanger sequenced as described above.

The acquired 16S rRNA sequences were aligned with 16S rRNA sequences from other Borrelia genospecies retrieved from GenBank. Sequences were aligned using ClustalOmega (http://www.ebi.ac.uk/Tools/msa/clustalo/). The 16S rRNA sequence from B. miyamotoi (Genbank accession number AB904793.1) served as the outgroup. After manual refinement, conserved regions were identified using the Gblocks feature of the Phylogeny.fr suite [18, 19]. The HKY+G nucleotide substitution model was selected using TOPALiv2’s model selection feature [20]. TOPALi was then used to launch MrBayes to construct a phylogenetic tree [21-23]. The tree was generated using two runs of 9,000,000 generations with 35% burn in and trees sampled every 1000 generations.

Results

In total, 11,066 I. pacificus adults, collected from 2008 to 2015, were screened for Borrelia spp. by DFA. Of these, 228 adults (2.1%) were DFA positive for Borrelia spirochetes and, of these, 128 (1.2%) were B. burgdorferi sl positive and 96 (0.9%) were B. miyamotoi positive when tested by TaqMan assay; four positive ticks were not able to amplify. A subset of 27 of the B. burgdorferi sl-positive adult ticks were characterized to genospecies by sequence comparison. This subset of positive ticks was selected to optimize the number of ticks tested from different regions of the state. Borrelia burgdorferi ss was detected in 11 counties, B. bissettiae was detected in two counties, and B. americana was detected from one county (Table 1).

Table 1

Adult and nymphal Ixodes pacificus and Ixodes spinipalpis collected in California and tested for Borrelia spp., 2008–2015.

Region	County	Tick species	Life stage	# tested	# samples positive for B. burgdorferi s.l.	% prevalence of B. burgdorferi s.l.	# in subset with B. burgdorferi s.l. genomospecies determined a	B. americana	B. bissettiae	B. burgdorferi ss
Central Coast
	Monterey	Ixodes pacificus	Adult	140	0	0.0
		Ixodes pacificus	Nymphs	35	0	0.0
	San Benito	Ixodes pacificus	Adult	47	0	0.0
		Ixodes pacificus	Nymphs	4	0	0.0
	San Luis Obispo	Ixodes pacificus	Adult	298	1	0.3	1			1
		Ixodes pacificus	Nymphs	0	0
Central Valley
	Colusa	Ixodes pacificus	Adult	13	0	0.0
		Ixodes pacificus	Nymphs	0	0
	Glenn	Ixodes pacificus	Adult	171	2	1.2
		Ixodes pacificus	Nymphs	0	0
	Kern	Ixodes pacificus	Adult	57	0	0.0
		Ixodes pacificus	Nymphs	0	0
	Sacramento	Ixodes pacificus	Adult	88	3	3.4
		Ixodes pacificus	Nymphs	190	18	9.5	1			1
		Ixodes spinipalpis	Nymphs	11	1	9.1
	San Joaquin	Ixodes pacificus	Adult	13	0	0.0
		Ixodes pacificus	Nymphs	3	0	0.0
	Stanislaus	Ixodes pacificus	Adult	211	0	0.0
		Ixodes pacificus	Nymphs	0	0
	Yuba	Ixodes pacificus	Adult	424	7	1.7
		Ixodes pacificus	Nymphs	30	0	0.0
North Coastal
	Alameda	Ixodes pacificus	Adult	466	5	1.1
		Ixodes pacificus	Nymphs	29	0	0.0
	Contra Costa	Ixodes pacificus	Adult	285	0	0.0
		Ixodes pacificus	Nymphs	264	4	1.5	1			1
		Ixodes spinipalpis	Nymphs	1	0	0.0
	Humboldt	Ixodes pacificus	Adult	30	0	0.0
		Ixodes pacificus	Nymphs	2	0	0.0
	Lake	Ixodes pacificus	Adult	253	2	0.8	2			2
		Ixodes pacificus	Nymphs	492	14	2.8	7			7
	Marin	Ixodes pacificus	Adult	682	14	2.1	4		1	3
		Ixodes pacificus	Nymphs	331	24	7.3	10			10
	Mendocino	Ixodes pacificus	Adult	61	0	0.0
		Ixodes pacificus	Nymphs	19	0	0.0
	Napa	Ixodes pacificus	Adult	385	3	0.8
		Ixodes pacificus	Nymphs	342	3	0.9
	San Mateo	Ixodes pacificus	Adult	620	15	2.4	6	1	2	3
		Ixodes spinipalpis	Adult	1	0	0.0
		Ixodes pacificus	Nymphs	96	4	4.2
		Ixodes spinipalpis	Nymphs	5	1	20.0
	Santa Clara	Ixodes pacificus	Adult	182	3	1.6	3			3
		Ixodes pacificus	Nymphs	134	9	6.7	6			6
	Santa Cruz	Ixodes pacificus	Adult	893	3	0.3	1			1
		Ixodes pacificus	Nymphs	476	16	3.4	6		1	5
		Ixodes spinipalpis	Nymphs	4	1	25.0
	Solano	Ixodes pacificus	Adult	121	0	0.0
		Ixodes pacificus	Nymphs	0	0
	Sonoma	Ixodes pacificus	Adult	216	1	0.5
		Ixodes pacificus	Nymphs	337	3	0.9	1			1
	Trinity	Ixodes pacificus	Adult	56	0	0.0
		Ixodes pacificus	Nymphs	0	0
Sierra-Nevada Foothills
	Amador	Ixodes pacificus	Adult	256	3	1.2
		Ixodes pacificus	Nymphs	116	7	6.0
	Butte	Ixodes pacificus	Adult	441	8	1.8	1			1
		Ixodes pacificus	Nymphs	309	17	5.5	3			3
	Calaveras	Ixodes pacificus	Adult	537	7	1.3	1			1
		Ixodes pacificus	Nymphs	30	0	0.0
	El Dorado	Ixodes pacificus	Adult	312	10	3.2	5			5
		Ixodes pacificus	Nymphs	233	21	9.0	2			2
		Ixodes spinipalpis	Nymphs	12	3	25.0
	Inyo	Ixodes pacificus	Adult	2	0	0.0
		Ixodes pacificus	Nymphs	0	0
	Mariposa	Ixodes pacificus	Adult	181	1	0.6	1			1
		Ixodes pacificus	Nymphs	15	0	0.0
	Nevada	Ixodes pacificus	Adult	551	7	1.3	1			1
		Ixodes pacificus	Nymphs	173	6	3.5
	Placer	Ixodes pacificus	Adult	10	1	10.0
		Ixodes pacificus	Nymphs	40	0	0.0
	Shasta	Ixodes pacificus	Adult	460	26	5.7
		Ixodes pacificus	Nymphs	90	0	0.0
	Sierra	Ixodes pacificus	Adult	28	0	0.0
		Ixodes pacificus	Nymphs	0	0
	Siskiyou	Ixodes pacificus	Adult	13	0	0.0
		Ixodes pacificus	Nymphs	0	0
	Tuolumne	Ixodes pacificus	Adult	64	0	0.0
		Ixodes pacificus	Nymphs	3	0	0.0
Southern Region
	Los Angeles	Ixodes pacificus	Adult	360	0	0.0
		Ixodes pacificus	Nymphs	11	0	0.0
	Orange	Ixodes pacificus	Adult	659	2	0.3
		Ixodes spinipalpis	Adult	4	1	25.0	1		1
		Ixodes pacificus	Nymphs	0	0
		Ixodes spinipalpis	Nymphs	111	20	18.0	8	2	6
	Riverside	Ixodes pacificus	Adult	180	0	0.0
		Ixodes pacificus	Nymphs	1	0	0.0
	San Bernardino	Ixodes pacificus	Adult	678	3	0.4
		Ixodes pacificus	Nymphs	1	0	0.0
	San Diego	Ixodes pacificus	Adult	58	0	0.0
		Ixodes pacificus	Nymphs	0	0
	Santa Barbara	Ixodes pacificus	Adult	496	1	0.2
		Ixodes pacificus	Nymphs	9	0	0.0
	Ventura	Ixodes pacificus	Adult	68	0	0.0
		Ixodes pacificus	Nymphs	0	0

a Due to screening a subset of samples positive for B. burgdorferi s.l., a true prevalence of genospecies by county could not be determined.

Similarly, 204 of the 3,815 nymphal I. pacificus were positive for Borrelia spp. by DFA. Of these, 146 (3.8%) of DFA-positive nymphs tested positive for B. burgdorferi sl and 52 (1.4%) tested positive for B. miyamotoi by TaqMan assay; six positive ticks were not able to amplify. Of the 37 Borrelia-positive I. pacificus nymphs that were genotyped, 36 were positive for B. burgdorferi ss from nine counties, and one was positive for B. bissettiae (Table 1).

Five I. spinipalpis adult ticks were collected from two counties; a single female from Orange County was positive for B. bissettiae (Table 1). In addition, 144 I. spinipalpis nymphs were tested from six counties. Of these 26 (18.1%) I. spinipalpis nymphs that were B. burgdorferi sl positive, two (1.4%) were B. americana positive, and six (4.2%) were B. bissettiae positive (Table 1). None of the I. spinipalpis adults or nymphs tested positive for either B. burgdorferi ss or B. miyamotoi.

The 16S rRNA sequence fragments obtained from sequencing a subset of positive amplicons (27 from adult ticks, 45 from nymphal ticks) were used to construct a phylogenetic tree (Table 2). Borrelia spp. from Ixodes ticks clustered into three clades, each containing a sequence from a GenBank-obtained Borrelia genospecies (Fig 1). The clade that contained B. burgdorferi ss was the largest with 58 samples and two controls (CA4 and CA8). The clade that included a B. bissettiae control (CA389) also included 11 tick-derived samples from along the northern and southern coastal regions of the state. In northern California, B. bissettiae was detected in I. pacificus whereas in southern California, B. bissettiae was detected in I.spinipalpis only. The B. americana clade included two positive I. spinipalpis nymphs from Orange County in southern California, one positive I. pacificus adult from the north-coastal county of San Mateo, and GenBank-derived sequence controls from Charleston County South Carolina (accession numbers HM802226, EU081286) (Table 2). Branch lengths are non-informative.

Table 2

Summary of California Borrelia positive ticks.

Borrelia spp.	County	Tick species	Life stage/sex	Tick no.	GenBank Accession No.	Latitude, Longitude
Borrelia americana	Orange	I. spinipalpis	Nymph	12–0751	MH781136	33.573899, -117.839928
Borrelia americana	Orange	I. spinipalpis	Nymph	12–0785	MH781137	33.573899, -117.839928
Borrelia americana	San Mateo	I. pacificus	Female	12–0040	KY563151	37.363597, -122.246426
Borrelia americana	Charleston, South Carolina	I. minor		Control	HM802226.1
Borrelia americana	Charleston, South Carolina	I. minor		Control	EF015630.1
Borrelia bissettiae	Marin	I. pacificus	Female	08–0745	KY563181	37.835500, -122.478300
Borrelia bissettiae	Orange	I. spinipalpis	Nymph	12–0780	KY563143	33.573899, -117.839928
Borrelia bissettiae	Orange	I. spinipalpis	Female	12–0438	MH781138	33.573899, -117.839928
Borrelia bissettiae	Orange	I. spinipalpis	Nymph	12–0776	MH781139	33.573899, -117.839928
Borrelia bissettiae	Orange	I. spinipalpis	Nymph	12–0743	KY563141	33.573899, -117.839928
Borrelia bissettiae	Orange	I. spinipalpis	Nymph	12–0454	KY563140	33.573899, -117.839928
Borrelia bissettiae	Orange	I. spinipalpis	Nymph	12–0451	MH781140	33.573899, -117.839928
Borrelia bissettiae	Orange	I. spinipalpis	Nymph	12–0755	KY563142	33.573899, -117.839928
Borrelia bissettiae	San Mateo	I. pacificus	Female	13–1009	KY563199	37.390048, -122.257426
Borrelia bissettiae	San Mateo	I. pacificus	Female	13–1040	KY563201	37.390048, -122.257426
Borrelia bissettiae	Santa Cruz	I. pacificus	Nymph	11–1420	KY563139	37.014408, -122.084290
Borrelia bissettiae	Contra Costa	I. pacificus		CA389—Control	NR148750.1
Borrelia burgdorferi ss	Butte	I. pacificus	Nymph	11–1646	KY563178	39.52121, -121.44802
Borrelia burgdorferi ss	Butte	I. pacificus	Nymph	11–1702	KY563179	39.52121, -121.44802
Borrelia burgdorferi ss	Butte	I. pacificus	Nymph	11–1735	KY563180	39.52121, -121.44802
Borrelia burgdorferi ss	Butte	I. pacificus	Female	12–1336	KY563153	39.52121, -121.44802
Borrelia burgdorferi ss	Calaveras	I. pacificus	Male	11–1827	KY563174	38.022044, -120.549008
Borrelia burgdorferi ss	Contra Costa	I. pacificus	Nymph	08–1104	KY563182	37.900529, -122.256376
Borrelia burgdorferi ss	El Dorado	I. pacificus	Nymph	09–0752	KY563185	38.801096, -120.893394
Borrelia burgdorferi ss	El Dorado	I. pacificus	Nymph	10–0518	KY563134	38.770251, -121.040021
Borrelia burgdorferi ss	El Dorado	I. pacificus	Female	10–0556	KY563135	38.770251, -121.040021
Borrelia burgdorferi ss	El Dorado	I. pacificus	Male	11–0460	KY563159	38.770251, -121.040021
Borrelia burgdorferi ss	El Dorado	I. pacificus	Female	11–0480	KY563162	38.770251, -121.040021
Borrelia burgdorferi ss	El Dorado	I. pacificus	Female	11–0489	KY563163	38.770251, -121.040021
Borrelia burgdorferi ss	El Dorado	I. pacificus	Male	11–0570	KY563164	38.801096, -120.893394
Borrelia burgdorferi ss	Lake	I. pacificus	Female	09–0426	KY563183	38.910458, -122.592294
Borrelia burgdorferi ss	Lake	I. pacificus	Male	09–0671	KY563187	38.961918, -122.741246
Borrelia burgdorferi ss	Lake	I. pacificus	Nymph	11–1019	KY563168	39.017000, -122.813000
Borrelia burgdorferi ss	Lake	I. pacificus	Nymph	11–1073	KY563169	39.017000, -122.813000
Borrelia burgdorferi ss	Lake	I. pacificus	Nymph	13–0797	KY563191	39.262280, -122.950110
Borrelia burgdorferi ss	Lake	I. pacificus	Nymph	13–0800	KY563192	39.262280, -122.950110
Borrelia burgdorferi ss	Lake	I. pacificus	Nymph	13–0916	KY563194	39.262280, -122.950110
Borrelia burgdorferi ss	Lake	I. pacificus	Nymph	13–0937	KY563196	39.017000, -122.813000
Borrelia burgdorferi ss	Lake	I. pacificus	Nymph	13–0963	KY563198	39.017000, -122.813000
Borrelia burgdorferi ss	Marin	I. pacificus	Nymph	10–0106	KY563126	38.006443, -122.494629
Borrelia burgdorferi ss	Marin	I. pacificus	Nymph	10–0112	KY563127	38.006443, -122.494629
Borrelia burgdorferi ss	Marin	I. pacificus	Nymph	10–0113	MH781141	38.006443, -122.494629
Borrelia burgdorferi ss	Marin	I. pacificus	Nymph	10–0120	KY563128	38.006443, -122.494629
Borrelia burgdorferi ss	Marin	I. pacificus	Nymph	10–0682	KY563129	38.006443, -122.494629
Borrelia burgdorferi ss	Marin	I. pacificus	Nymph	10–0853	KY563136	38.006443, -122.494629
Borrelia burgdorferi ss	Marin	I. pacificus	Nymph	10–1031	MH781142	38.006443, -122.494629
Borrelia burgdorferi ss	Marin	I. pacificus	Nymph	10–1045	KY563130	38.006443, -122.494629
Borrelia burgdorferi ss	Marin	I. pacificus	Nymph	11–2405	KY563156	38.006443, -122.494629
Borrelia burgdorferi ss	Marin	I. pacificus	Nymph	11–2530	MH781143	38.006443, -122.494629
Borrelia burgdorferi ss	Marin	I. pacificus	Male	11–2554	KY563154	38.006443, -122.494629
Borrelia burgdorferi ss	Marin	I. pacificus	Female	12–0166	KY563149	38.006443, -122.494629
Borrelia burgdorferi ss	Marin	I. pacificus	Male	12–1134	KY563150	38.006443, -122.494629
Borrelia burgdorferi ss	Mariposa	I. pacificus	Male	10–1001	KY563171	37.292633, -120.147953
Borrelia burgdorferi ss	Nevada	I. pacificus	Female	10–0719	KY563170	39.330100, -120.986900
Borrelia burgdorferi ss	Sacramento	I. pacificus	Nymph	11–2083	KY563157	38.653200, -121.210900
Borrelia burgdorferi ss	San Luis Obispo	I. pacificus	Female	15–0797	MH781147	35.422511, -120.739472
Borrelia burgdorferi ss	San Mateo	I. pacificus	Female	A13-0477	KY563202	37.277536, -122.223845
Borrelia burgdorferi ss	San Mateo	I. pacificus	Male	12–0051	KY563148	37.363597, -122.246426
Borrelia burgdorferi ss	San Mateo	I. pacificus	Male	13–0194	KY563189	37.472000, -122.280000
Borrelia burgdorferi ss	Santa Clara	I. pacificus	Female	11–0326	KY563158	37.325300, -122.178900
Borrelia burgdorferi ss	Santa Clara	I. pacificus	Nymph	11–1358	KY563172	37.324000, -122.176000
Borrelia burgdorferi ss	Santa Clara	I. pacificus	Nymph	11–1673	KY563144	37.186126, -121.537900
Borrelia burgdorferi ss	Santa Clara	I. pacificus	Nymph	11–1685	KY563145	37.186126, -121.537900
Borrelia burgdorferi ss	Santa Clara	I. pacificus	Nymph	11–1686	MH781144	37.186126, -121.537900
Borrelia burgdorferi ss	Santa Clara	I. pacificus	Nymph	11–1688	KY563146	37.186126, -121.537900
Borrelia burgdorferi ss	Santa Clara	I. pacificus	Nymph	11–2111	KY563147	37.186126, -121.537900
Borrelia burgdorferi ss	Santa Clara	I. pacificus	Female	11–2322	KY563155	37.405632, -122.305901
Borrelia burgdorferi ss	Santa Clara	I. pacificus	Female	13–0855	KY563193	37.277758, -122.151275
Borrelia burgdorferi ss	Santa Cruz	I. pacificus	Female	09–0532	KY563184	37.014408, -122.084290
Borrelia burgdorferi ss	Santa Cruz	I. pacificus	Nymph	10–0146	KY563131	37.014408, -122.084290
Borrelia burgdorferi ss	Santa Cruz	I. pacificus	Nymph	10–0172	KY563132	37.014408, -122.084290
Borrelia burgdorferi ss	Santa Cruz	I. pacificus	Nymph	10–0201	KY563133	37.014408, -122.084290
Borrelia burgdorferi ss	Santa Cruz	I. pacificus	Nymph	11–1429	KY563175	37.014408, -122.084290
Borrelia burgdorferi ss	Santa Cruz	I. pacificus	Nymph	11–1514	KY563177	37.014408, -122.084290
Borrelia burgdorferi ss	Sonoma	I. pacificus	Nymph	09–0824	KY563186	38.343912, -122.547333
Borrelia burgdorferi ss	Sonoma	I. pacificus		CA4—Control	MH781145
Borrelia burgdorferi ss	Sonoma	I. pacificus		CA8—Control	MH781146
Borrelia burgdorferi ss	Westchester, New York	I. scapularis		N40—Control	CP002228.1

Fig 1

Borrelia genospecies detected in Ixodes pacificus and Ixodes spinipalpis ticks in California counties, 2008–2015.

Discussion

This is the first study that characterizes the genetic diversity and large-scale geographic sub-structuring of B. burgdorferi sl over a large region of western North America. Borrelia burgdorferi sl includes B. burgdorferi ss, the agent of Lyme disease in North America, as well as other closely related spirochetes that have not yet been implicated as human pathogens, such as B. bissettiae and B. americana.

Borrelia burgdorferi sensu stricto

Previous studies in western North America have highlighted northwestern California and the western slopes of the northern Sierra Nevada foothills as regions with moderate to high risk of exposure to the Lyme disease bacteria, B. burgdorferi ss. In northern California, I. pacificus nymphal tick infection prevalence average is 5% [12], but can be as high as 20 to 40% in some localities [24-26]. This prevalence is similar to many regions highly endemic for Lyme disease in the eastern and mid-western United States [27, 28]. Nevertheless, while I. pacificus ticks are found in many areas of western North America and present a risk of transmitting Lyme disease to people, this risk is not uniform throughout the region. For example, despite thousands of ticks tested to date, the only ticks found positive for B. burgdorferi ss from southern California are one adult I. pacificus and two Dermacentor occidentalis from Los Angeles County [29], and a single Ixodes peromysci nymph from Santa Barbara County [30]. Although D. occidentalis attaches to humans, it is not a competent vector of B. burgdorferi ss [31]. Ixodes peromysci is an uncommon tick that feeds predominately on Peromyscus spp. mice, and previously has been considered to be endemic only to the Channel Islands, off the coast of southern California [32]. To date, only a single I. pacificus has tested positive for B. burgdorferi ss from southern California. Our current findings further indicate that the acarological risk of acquiring Lyme disease in southern California is exceedingly low [29].

Borrelia bissettiae

Borrelia bissettiae (formerly B. bissettii) [6, 33] is a potential human pathogen in the United States and in Europe. In the Czech Republic, B. bissettiae was detected by PCR from sera of seven patients suspected to have Lyme borreliosis [8]. This spirochete was detected also by PCR from cardiac-valve tissue from a patient with endocarditis and aortic valve stenosis [7] and from a lymphocytomic breast tissue lesion from a Slovenian patient [9]. In the United States, B. bissettiae was detected by PCR from plasma cultured from a resident of southeastern North America [10]. In northwestern California, serum specimens from three residents of a rural community at high risk of tick-exposure and who were PCR positive for B. burgdorferi sl, were found to have been infected with B. bissettiae by sequence analysis [11]. However, none of those individuals had a clinical history compatible with Lyme disease [11, 34].

In this present study, B. bissettiae was detected in I. pacificus and I. spinipalpis adults and nymphs in coastal regions of both northern and southern California. This spirochete was first isolated from an adult I. pacificus from Del Norte County in the far north-coastal quadrant of California [33, 35]. Subsequently, it was detected in I. pacificus and I. spinipalpis in a few other regions of western North America [6, 36]. Recent studies have detected B. bissettiae in wild rodents and Ixodes spp. ticks in the midwestern and southeastern United States, Europe, and recently in South America [37-40]. Interestingly, B. bissettiae is recorded rarely from the northeastern United States, a region that harbors a remarkably high tick-infection prevalence with B. burgdorferi ss.

In California, B. bissettiae is found commonly in association with dusky-footed woodrats (Neotoma fuscipes), big-eared woodrats (Neotoma macrotis), Allen’s chipmunks (Neotamias senex), and I. spinipalpis [5, 36, 41, 42]. In addition, B. bissettiae has been detected in the bird tick Ixodes auritulus [14] and in sylvatic bird blood samples [43]. Genetic sub-structuring of Californian B. burgdorferi sl has been reported on a finer-scale within a single California county: B. burgdorferi ss was found in ticks from inland areas with higher than average temperatures whereas B. bissettiae was found in ticks from coastal areas with cooler temperatures [5]. These local regional differences in tick diversity may align with habitat types (e.g., chaparral, riparian, oak-woodland), which in turn can support different host species and potential reservoirs for different Borrelia genospecies [5].

Borrelia americana

Borrelia americana was first isolated from Ixodes minor nymphs and birds in South Carolina as well as from I. pacificus from California [44]. Since then, it has been detected from ticks outside the United States, with recent detections in Ixodes persulcatus in China [45]. The pathogenic status of this spirochete is unclear but B. americana-like DNA reportedly has been amplified from patients with Lyme disease–like symptoms from the southern United States [46]. The first detection of B. burgdorferi sl in southern California was an isolate from an I. pacificus tick collected in Orange County [47], later named CA-29-91 [48], and ultimately renamed B. americana [44]. More recently, B. americana was detected in I. pacificus from Los Angeles and Alameda counties [5, 29]. In the current study, it is notable that B. americana was detected in both the north-coastal (San Mateo County) and south-coastal (Orange County) regions of the state, as well as in two tick species, e.g., an I. pacificus adult from San Mateo County and two I. spinipalpis nymphs from Orange County (Table 1).

Borrelia miyamotoi

Other Borrelia spp. that cause human disease in North America include relapsing fever Borrelia that are molecularly and clinically distinct from B. burgdorferi sl infections. While most relapsing fever Borrelia, such as B. hermsii, are typically associated with argasid (soft) ticks in the genus Ornithodoros, B. miyamotoi is vectored by Ixodes species ticks in Europe, North America, and Asia. This spirochete recently was identified as an emerging pathogen in Russia, the Netherlands, Japan, and northeastern United States, and is associated with an acute febrile illness and subsequent relapsing fevers if left untreated [49]. Although no human cases of B. miyamotoi infection have been confirmed in California, serological, ecological, and epidemiological data offer presumptive evidence that B. miyamotoi occasionally infects people in northwestern California [50]. Molecular strain differences among B. miyamotoi appears to align with its associated tick species, with little geographic substructuring [51]. Similar to a 1% infection prevalence in other Ixodes ticks (both adults and nymphs) in surveillance conducted in the United States, Canada,and in Europe [15, 52, 53], B. miyamotoi is found in approximately 1% of I. pacificus nymphs and adults in California [12, 54]. While there is evidence of B. miyamotoi in rodents [15, 55], this similarity of infection prevalence among geographic regions, with diverse vectors and potential reservoir hosts, suggests a strong reliance on transovarial transmission to maintain infection in an area. Unlike B. burgdorferi sl, B. miyamotoi can be maintained transovarially and can be found in larval I. pacificus [12, 56]. In California, B. miyamotoi was detected primarily in I. pacificus from the northern region of the state, and was rarely detected in southern Californian I. pacificus [12]. To date, B. miyamotoi has not been found in I. spinipalpis nor any other wildlife tick in western North America.

Conclusion

Our findings demonstrate large-scale geographic structuring of the B. burgdorferi sl complex in western North America with concomitant differential acarological risk of exposure to Lyme borreliosis spirochetes. In southern California, people are at an exceeding low acarological risk of exposure to B. burgdorferi ss, the agent of Lyme disease in North America. In this study, ticks infected with B. burgdorferi ss were found in the Sierra Nevada foothills, north coastal, and central coastal regions of California, as far south as San Luis Obispo County. The geographic distribution of B. burgdorferi ss in California coincides with epidemiological findings, with the highest incidence of Lyme disease reported in northern California [57]. Notably, only a single I. pacificus has tested positive for B. burgdorferi ss from southern California, despite decades of testing and thousands of ticks tested [CDPH, unpublished data; 21]. While the risk of acquiring Lyme disease may be low in southern California, the risk of exposure to other tick-borne pathogens, such as spotted-fever group rickettsia may be higher in this region of the state [58]. Public health education messages should highlight this differential risk of tick-borne diseases to health care providers and the public.

While people are not at acarological risk of exposure to B. burgdorferi ss in southern California, this study did find three other Borrelia in ticks from this region: B. bissettiae, B. americana, and B. miyamotoi. Likewise, the acarological risk of exposure to B. bissettiae is variable among California regions, with an evident association with coastal regions of the state, including coastal areas of southern California. Of note, no I. pacificus from the Sierra Nevada foothills were positive for B. bissettiae, while B. burgdorferi ss is found commonly in I. pacificus from that region.

This study provides an assessment of acarological risk for known human tick-borne disease pathogens as well as potentially novel human pathogenic Borrelia species over a broad geographic area. Prior understanding of regional risk of known and potential tick-borne disease agents can assist with advancing diagnostics and epidemiologic investigations of human tick-borne disease cases. Results from this study indicate that additional research is warranted to evaluate fine scale landscape or reservoir host distribution range and tick-borne disease prevalence in California.