Jun-Jie Sun1, Hong-Lin Li1, Su-Jie Guo1, Hui Ma1, Shen-Jia Liu1, Dong Liu1, Feng-Xia Xue2. 1. Department of Obstetrics and Gynecology, The Secondary Hospital of Tianjin Medical University, No. 23 Pingjiang Road, Hexi District, Tianjin 300211, China. 2. Department of Gynecology and Obstetrics, Tianjin Medical University General Hospital, No. 154, Anshan Road, He Ping District, Tianjin 300052, China.
Abstract
Cervical cancer is one of the most common malignant neoplasms in gynecology. Protein tyrosine kinase 7 (PTK7) with an inactive kinase domain is an important regulator of multiple Wnt pathways under normal and various pathological conditions and overexpressed in various tumors; however, the clinical and biological significance of PTK7 in cervical cancer is still unknown. In the present study, the protein expression level of PTK7 was detected in clinical cervical cancer patient samples, and the relationship between PTK7 expression and clinicopathological features was analyzed. In addition, the Kaplan-Meier method was performed to estimate the overall survival (OS) and progression-free survival (PFS) of patients to investigate the clinicopathological significance of PTK7 expression. Functional assays demonstrated that knocking down PTK7 might inhibit the ability of cancer cells to proliferate and invade or migrate, both in vivo and in vitro. Thus, PTK7 might serve as a potential target for cervical cancer.
Cervical cancer is one of the most common malignant neoplasms in gynecology. Protein tyrosine kinase 7 (PTK7) with an inactive kinase domain is an important regulator of multiple Wnt pathways under normal and various pathological conditions and overexpressed in various tumors; however, the clinical and biological significance of PTK7 in cervical cancer is still unknown. In the present study, the protein expression level of PTK7 was detected in clinical cervical cancerpatient samples, and the relationship between PTK7 expression and clinicopathological features was analyzed. In addition, the Kaplan-Meier method was performed to estimate the overall survival (OS) and progression-free survival (PFS) of patients to investigate the clinicopathological significance of PTK7 expression. Functional assays demonstrated that knocking down PTK7 might inhibit the ability of cancer cells to proliferate and invade or migrate, both in vivo and in vitro. Thus, PTK7 might serve as a potential target for cervical cancer.
Cervical cancer is one of the most common cancers and the third leading cause of cancer death in women in underdeveloped countries [1]. It is worth noting that cervical cancer is the second leading cause of cancer death in women between 20 and 39 years of age in America according to the cancer statistics report in 2018 [2]. Despite progress in screening and effective surgical or radiotherapy management, the prognosis of patients with cervical cancer remains poor owing to cancer metastasis or recurrence [3-5]. The staging system of the International Federation of Obstetricians and Gynecologists (FIGO), lymph node metastasis status, and invasion are considered to be prognostic factors for cervical cancerpatients in the recent studies [6-8]; however, there is still no efficient biomarkers to identify high-risk patients. Therefore, identifying valid biomarkers for patients with poor prognosis is required in the cervical carcinoma society.Protein tyrosine kinase 7 (PTK7) belongs to the receptor tyrosine kinase family with an inactive kinase domain [9, 10]. It was first found in melanocytes and subsequently found to be overexpressed in colon cancer, conserved in many species [11]. In Xenopus, PTK7 serves as an important modulator of the Wnt/planar cell polarity (PCP) pathway in PTK7-deficient embryos [12]. In mouse, PTK7 shows to interact with Vang-like protein 2 (vangl2), a key Wnt/PCP gene [13, 14]. Accumulated evidence shows PTK7 is a key regulator of multiple Wnt pathways under normal and possible pathological conditions, including cancer. PTK7 is highly overexpressed in a variety of tumors, such as colon cancer, lung adenocarcinoma, acute myelogenous leukemia, and gastric cancer [15-18]; however, the regulation mechanisms of PTK7 in cervical cancer are still unclear.In non-small-cell lung cancer (NSCLC), PTK7 showed to be highly expressed in patient samples, and RNA interference-mediated disruption of PTK7 decreased tumor cell viability, in vitro and in vivo [15]. Consistent with the above observations, we demonstrated overexpression of PTK7 protein in cervical cancerpatient samples and significantly connected with a vicious prognosis outcome. Knockdown of PTK7 indicated that it was crucial for the viability and proliferation of cancer cells. Xenograft studies revealed an important role of PTK7 in tumor growth. All in all, our results revealed PTK7 may be a prognostic biomarker and represents a novel therapeutic target in cervical cancer. In summary, our results revealed that PTK7 might be a biomarker of prognosis and represented a new therapeutic target in cervical cancer.
2. Materials and Methods
2.1. Patients and Samples
85 patients were clinically and pathologically diagnosed with cervical cancer in the Secondary Hospital of Tianjin Medical University from January 2009 to December 2017. Tumor tissues were obtained after the surgical treatment. The clinical and pathological characters such as ages, FIGO stage, differentiation, and tumor size were recorded.
2.2. Immunohistochemistry (IHC) Analysis
Formalin was fixed, and paraffin-embedded patient tissues were cut into 3 mm and mounted on slides. The immunohistochemistry two-step test kit (Beijing ZSGB-BIO Technologies Co.) was performed based on manufacturer's guidelines and recommendations. The primary polyclonal antibody against PTK7 (MAB4499, R&D Systems; 1 : 50) was used. The staining results were evaluated combining the percentage of positive staining and intensity of positively stained tumor cells. The proportion of positively stained tumor cells was scored in 3-point scales (0 for less than 5% positive tumor cells, 1 for 5%–50% positive tumor cells, and 2 for more than 50% positive tumor cells). We used 3-point scales (0 for no staining observed or light staining, 1 for intermediate staining, and 2 for dark staining) to classify the staining intensity. Based on the sum of the staining intensity score and percentage score, we defined the protein expression level of PTK7 as 0-2 (low expression) and 3-4 (high expression). Each case was observed 10 times in a high-power field. Without knowing the pathological grade and clinical data, the immunoreactivity was independently observed by two experienced pathologists.
2.3. Cell Lines and Antibodies
Humancervical cancer cell lines Caski and SiHa were purchased from Cell Bank at the Chinese Academy of Sciences. Cells were maintained in RPMI 1640 medium and Eagle's Minimum Essential Medium (EMEM), respectively. And the fresh complete medium was supplemented with 10% heat-inactivated fetal bovine serum (FBS; Thermo Fisher Scientific Inc.), penicillin, and streptomycin (50 μg/mL each) at 37°C with 5% CO2 atmosphere.The antibodies for Western blot analysis were primary polyclonal antibody against PTK7 (MAB4499, R&D Systems; 1 : 100 dilution), primary monoclonal antibody against β-actin (ab8226, Abcam, 1 : 3000 dilution), primary monoclonal antibody against Ki67 (ab16667, Abcam, 1 : 500 dilution), primary monoclonal antibody against proliferating cell nuclear antigen (PCNA) (ab29, Abcam, 1 : 400 dilution), monoclonal antibody against MMP2 (40994, Cell Signaling Technology, 1 : 800 dilution), and monoclonal antibody against MMP9 (13667, Cell Signaling Technology, 1 : 800 dilution).
2.4. Knockdown of PTK7
Human predesigned targeted short hairpin RNA (shRNA) recombinant virus against PTK7 was purchased from Vigene (target sequence: AACATCAAATGGATTGAGGCAGG; Vigene Biosciences Inc.). Cells were transfected with recombinant virus according to the manufacturer's instructions. Silencing effect was further confirmed by qRT-PCR and Western blot.
2.5. Quantitative Real-Time PCR Analysis
Total RNA was extracted by the TRIzol reagent (Life Technologies) according to the manufacturer's instructions. Total RNA concentration was estimated by absorbance at 260 nm using an ultraviolet spectrophotometer, and its integrity was confirmed by denaturing agarose gel electrophoresis. The first-strand cDNA generation was performed with a DyNAmo cDNA Synthesis Kit (New England Biolabs). Quantitative real-time PCR (qRT-PCR) was carried out with SuperReal PreMix (Tiangen Biotech) in triplicate times. The relative expression level was normalized by internal reference β-actin through the 2-∆∆Ct method.qRT-PCR primers for PTK7 are sense, 5′- catggtaccgttgtatgagca-3′, and antisense, 5′- ttgtctgtcacccactctgg-3′.qRT-PCR primers for β-actin are sense, 5′ -tcccggcatgtgcaaggcc-3′, and antisense, 5′-catctcttgctcgaagtcca-3′.
2.6. Immunoblotting Analysis
Cells were washed by ice-cold DPBS, scraped, and then suspended in cell lysis buffer (50 mM Tris-HCl, pH 7.4, 1% NP-40, 150 mM NaCl, 1 mM EDTA, 0.25% deoxycholic acid). Next, the equal level of protein samples was resolved by SDS-PAGE, transferred onto PVDF membranes, and blocked by 5% nonfat milk in TBS-T. Proper primary antibodies were used followed by the above list and applied at 4°C overnight. The membranes were washed and probed with the proper secondary antibody and detected with an enhanced chemiluminescence system following the manufacturer's protocol (Amersham Life Science).
2.7. Colony Formation Assay
1000 cells/well were seeded onto 6-well plates. Two weeks later, methyl hydrate was used to fix cells, which were then stained by 0.5% crystal violet solution. The assays were performed in triplicate and repeated three times.
2.8. Cell Proliferation Assay
MTT proliferation assay was performed to measure cell viability. Cells were plated in 96-well plates, and MTT solution (30 μL per well, 5 mg/mL) was added and cultured for 24 hours at 37°C with 5% CO2 atmosphere. Then dimethyl sulfoxide (DMSO, 100 μL per well) was added, and absorbance was recorded by a plate reader (Bio-Rad) at 570 nm.
2.9. Cell Scratch Assay
Cells were trypsinized and seeded in a 6-well plate. The next day, the monolayer of cells was scraped by sterile tips in a straight line to create a scratch in the middle of each well. The medium was discarded and replaced with fresh medium, later. The wound closure area was calculated at the indicated time points.
2.10. Migration or Invasion Assay
Cells were trypsinized and seeded into the upper chamber at 6 × 104 concentration. The lower chamber was placed by fresh complete medium, and cells were allowed to migrate for 24 hours at 37°C with 5% CO2 atmosphere. Afterward, the cells that migrated from the lower side of the membrane through the filter pores were fixed and stained. The number of cells in each chamber was counted by a microscope in three random areas.
2.11. Animal Study
All animal studies were approved by the animal experimentation ethics committee of the Secondary Hospital of Tianjin Medical University. Each nude mouse was inoculated at the lower flank with 1.5 million established stable cell lines (Beijing HFK Bioscience Co. Ltd.). Between 2-week injection, tumor volume was calculated every 3 days.
2.12. Statistical Analysis
All data were proceeded by SPSS 22.0 software (SPSS Inc., USA). The Kaplan-Meier curve method was performed to determine the relationship between PTK7 expression and clinical characteristics. Comparisons were analyzed by unpaired two-tailed t-tests. P value <0.05 was considered to be statistically significant.
3. Results
3.1. PTK7 Protein Overexpressed in Cervical Cancer Patients and Associated with Poor Prognosis
To detect the protein expression level of PTK7 in cervical cancerpatients, the IHC assay was performed in our clinical cohort (85 primary cervical squamous cell carcinomapatient tissues and paired tumor-adjacent tissues, Figures 1(a) and 1(b)). As depicted in Figure 1(a), we observed high intensity of PTK7 protein expression in the cytoplasmic compartment of cancer cells in 60 (70.1%) patient samples, while PTK7 protein expression was negative in the paired tumor-adjacent tissues (Figure 1(b)). Furthermore, the cohort was separated into two groups in view of the IHC staining intensity level: high expression group and low expression group (Table 1).
Figure 1
Overexpressed PTK7 expression connected with poor prognosis. (a) Low and high PTK7 protein expressions in the tumor tissues by IHC were shown. (b) The negative PTK7 protein expression in the paired tumor-adjacent tissues by IHC. (c) The overall survival and progression-free survival in our clinical cohort: the high PTK7 protein expression level group was significantly associated with shorter progression-free survival compared to the low expression group (∗P < 0.05, respectively).
Table 1
Relationships of PTK7 and clinicopathological characteristics in 85 patients with cervical cancer.
Feature
All (n = 85)
PTK7 expression
χ2
P
High (n = 60)
Low (n = 25)
Age (year)
0.400
0.708
<40
45
30
15
≥40
40
30
10
FIGO stage
4.896
0.027∗
IB1
42
25
17
IB2-IIB
43
35
8
Differentiation
4.886
0.027∗
Well/moderate
49
30
19
Poor
36
30
6
Tumor size
0.343
0.558
<4 cm
55
40
15
≥4 cm
30
20
10
Particularly, the high PTK7 protein expression level group had a significant connection to the FIGO stage (P < 0.05) and differentiation (P < 0.05) compared with the low expression group and was not related to other clinical pathological features including age (P > 0.05) and tumor size (P > 0.05). Progression-free survival (PFS) means that a group of individuals with cancer after a particular treatment remains free of disease progression [19]. In order to further discuss the clinical significance between PTK7 and cervical cancer, overall survival (OS) and PFS were performed based on the Kaplan-Meier curve method, respectively. Postoperative follow-up data for cervical cancerpatients in our cohort showed that the expression of PTK7 was obviously related to the prognosis of patients, and the high PTK7 protein expression level group tended to gain short progression-free survival compared to the low expression group (P < 0.05, Figures 1(b) and 1(c)).
3.2. Establishing Short Hairpin RNA-Mediated Stable Knockdown of PTK7 Cell Lines
Short hairpin RNA (shRNA) recombinant virus was transfected into two cervical cancer cell lines (Caski and SiHa) to silence PTK7 expression. Further validation was performed by qRT-PCR and the Western blot assay to detect the PTK7 mRNA and protein levels, respectively (P = 0.003 < 0.05 and P = 0.005 < 0.05, Figures 2(a) and 2(b)). Based on the recombinant virus, we generated the stable silencing PTK7 cell lines.
Figure 2
Establishing the stable knockdown of PTK7 cell lines: (a, b) qRT-PCR and Western blot assay. PTK7 mRNA and protein levels were significantly decreased compared to the control. (∗P < 0.05).
3.3. PTK7 Regulated Cell Proliferation by Adjusting Ki67 and PCNA Proteins In Vitro
To further explore the biological effects of PTK7, we performed colony formation assays and MTT proliferation assays to evaluate the possible function in Caski and SiHa cell lines. The results of colony formation demonstrated that in both cells lines, the control showed significantly higher survival fraction than the PTK7 knockdown groups (P < 0.05, Figures 3(a) and 3(b)). This might mean that knocking down PTK7 would reduce the proliferation of cancer cells. Proliferating cell nuclear antigen (PCNA) and Ki67, indexes of cell proliferation, participated in the proliferation mechanism [20-22]. We measured these proliferation-related protein markers by the Western blot assay. Once PTK7 is knocked down, the PCNA and Ki67 protein levels were notably downregulated when compared to the control (P < 0.05, Figures 3(c) and 3(d)). This meant that PTK7 might regulate cell proliferation through affecting Ki67 and PCNA in vitro.
Figure 3
PTK7 regulated cell proliferation by Ki67 and PCNA proteins. (a) Colony formation assay. Results demonstrated that in Caski and SiHa cell lines, the control groups showed significantly higher survival fraction than the PTK7 knockdown groups (∗P < 0.05). (b) MTT proliferation assay. OD values were showed to be significantly lower in the PTK7 knockdown group compared to control groups (∗P < 0.05). (c, d) Western blot assay showed that the Ki67 and PCNA proteins were significantly downregulated in the PTK7 knockdown group compared to the control (∗P < 0.05).
3.4. PTK7 Regulated Cancer Cell Invasiveness, with the Indirect Correlation between PTK7 Expression and MMP2 and MMP9
The cell scratch assay was used to investigate the cell migration. We performed the cell scratch assay to evaluate the possible function of PTK7 for cancer invasiveness. Knocking down PTK7 in vitro showed to have the great scratch gap in both two cervical cancer cell lines than control groups, respectively (P < 0.05, Figure 4(a)). To further evaluate the cancer cell invasion function of PTK7, we generated cell invasion assays in Caski and SiHa cell lines, too. The invasion capabilities were significantly lost in PTK7 silencing groups, compared to control groups, respectively (P < 0.05, Figure 4(b)). It has been confirmed that matrix metalloproteinases 2 (MMP2) and MMP9 have an important effect on metastasis [23-25]. To investigate the mechanism of these observations, the Western blot assay was performed to determine the protein level of MMP2 and MMP9. The results demonstrated that MMP2 and MMP9 protein levels were downregulated in PTK7 silencing groups than in control groups (P < 0.05, Figures 4(c) and 4(d)). In sum, we suggested that knockdown PTK7 was prone to suppress the invasion of cancer cells by affecting the associated proteins.
Figure 4
The role of PTK7 in cell migration and invasion in cervical cancer. (a) Cell scratch assay. The PTK7 knockdown group showed to have a great scratch gap in both two cervical cancer cell lines than control groups, respectively (∗P < 0.05). (b) Cell invasion assay. The number of invasive cells in PTK7 knockdown groups was significantly lower than the control groups (∗P < 0.05). (c, d) Western blot assay showed that MMP2 and MMP9 proteins were significantly downregulated in the PTK7 knockdown group compared to the control (∗P < 0.05).
3.5. Xenografts with PTK7-Depleted Cells Inhibited Cervical Cancer Growth
To better study the biological function of PTK7, we designed the animal study to investigate the above-mentioned observation in vivo. Consistent with in vitro experiments, mice injected with the PTK7 silencing cells showed to have small tumor volume, compared to the control groups (P < 0.05, Figures 5(a) and 5(b)). To validate the disruption of PTK7 in vivo, we performed IHC and immunoblotting assays of xenografts. The PTK7 protein expression level was significantly lower in the PTK7 silencing group than the control (P < 0.05, Figures 5(c) and 5(d)). Taken together, our results suggested that decreasing the expression of PTK7 may exert an inhibitory effect in vivo.
Figure 5
PTK7-depleted cells inhibit cervical cancer growth in vivo. (a, b) Xenograft assay. The tumor volume of the PTK7 knockdown group was significantly smaller than that of the control, after 4 weeks of management (∗P < 0.05). (c, d) PTK7 protein level was dramatically decreased in the PTK7 knockdown group of injected tumor xenografts in nude mice by IHC and Western blot assays (∗P < 0.05).
4. Discussion
The purpose of this study is to explore the functional role of the PTK7 gene in cervical cancer through clinical patient samples and functional assays. PTK7 is a catalytically active receptor tyrosine kinase encoded by the PTK7 gene in a human [11]. It has a variety of biological functions, including embryonic tube formation and pluripotent stem cell function, as well as its controversial function and role in the development of malignant tumors [26-28]. Recent studies have reported that PTK7 has overexpressed levels in various solid tumors, including colon cancer, lung adenocarcinoma, acute myelogenous leukemia, and gastric cancer [15-18], and abnormally high expression of PTK7 often indicated poor prognosis for patients; however, the PTK7 expression level in certain tumors, such as clear cell renal cell carcinoma, melanoma, and epithelial ovarian cancer, was relatively low [29-31]. Our study showed that PTK7 protein showed abnormally high expression mainly on the cell cytoplasm of cervical cancer cells, and this was different from a previous study by Chen et al. which was shown that PTK7, as a target membrane receptor, expression was different on the cell membrane of HeLa cervical cancer cells in comparison with humanleukemia CCRF-CEM cells [32]. And the reasons were perhaps the differences between human tissue and extracorporeal cell lines and the different antibodies used. Of course, the future study should explain the different locations of PTK7 protein expression. Several studies mentioned that the selected control tissues (normal tissues, paracancerous tissues, inflammatory tissues, etc.) might play an important role in comparing PTK7 expression with tumor tissues [33-35]. In the present study, we used the adjacent normal tissues as our control group, though not fully applied to normal cervical tissues, could also reflect the changes of PTK7 protein levels before and after tumorigenesis. In addition, Wang et al. demonstrated that PTK7 protein was decreased and may be a tumor suppressor in epithelial ovarian carcinomas and associated with poor prognosis [36]. In summary, the above findings indicated that the expression level and biological function of PTK7 protein differed upon the specific tumor and related mechanisms.People had not yet formed a unified view of the function of PTK7, and controversial and objectionable conclusions had emerged in many studies with the deepening of the research in different tumors. This might suggest that the same gene may have a completely different role in different types of tumors. Chen et al. reported that high expression of PTK7 may promote the development of malignant tumors by a meta-analysis, and the results showed that PTK7 is abnormally highly expressed in malignant tissues and that this high level of expression suggested a high level of histological grade of the tumor, a shorter disease-free survival, and shorter overall survival. Consistent with the findings above, we reported that highly expressed PTK7 was showed to be associated with lymph node metastasis, tumor stage, and short progression-free survival time in our cervical cancer cohort [33]. Shin et al. found that PTK7 increased cell invasion by activating AP-1 and NF-κB pathways [37]. Liu et al. showed that PTK7 inhibited cell proliferation and tumorigenic potential by modulating the TGF-b/Smad signaling pathway and induces apoptosis in CD44-high glioma cells [38]. Compared to tumor cells with low levels of PTK7 expression, tumor cells with high expression levels exhibited stronger proliferation, DNA synthesis, invasion, and migration capabilities. However, Golubkov et al. reported that PTK7 might inhibit the invasion and migration of cancer cells [39-41]. While the present study showed that in cervical cancer cell lines, PTK7 might promote the proliferation via affecting the expression level of proliferation-related factors (Ki67 and PCNA), promoted the invasion via affecting the expression level of invasion-related factors (MMP2 and MMP9) and participated in the development of cervical cancer by promoting the mechanism of tumor cell proliferation and invasion in cervical cancer tissues, and produced a series of biological effects, which in turn affected cervical cancer FIGO stage, and differentiation resulting in poor prognosis of patients. Therefore, specific functions and mechanisms of PTK7 in different tumors still needed to be further studied.All in all, our results suggest that overexpressed PTK7 is associated with malignant clinicopathological features of cervical carcinoma, suggesting shorter progression-free survival. In addition, we demonstrated that PTK7 could serve as a potential biomarker to predict the malignant progression of cervical cancer. Functional assays demonstrated that knocking down PTK7 may inhibit the ability of cancer cells to proliferate and invade or migrate, in vivo and in vitro. Therefore, PTK7 may become a potential new target for anticancer treatment.
Authors: Ana Paula Arévalo; Romina Castelli; Manuel Ibarra; Martina Crispo; Victoria Calzada Journal: Int J Mol Sci Date: 2022-02-23 Impact factor: 5.923