SELENON (SEPN1) protects skeletal muscle from saturated fatty acid-induced ER stress and insulin resistance.

Selenoprotein N (SELENON) is an endoplasmic reticulum (ER) protein whose loss of function leads to a congenital myopathy associated with insulin resistance (SEPN1-related myopathy). The exact cause of the insulin resistance in patients with SELENON loss of function is not known. Skeletal muscle is the main contributor to insulin-mediated glucose uptake, and a defect in this muscle-related mechanism triggers insulin resistance and glucose intolerance. We have studied the chain of events that connect the loss of SELENON with defects in insulin-mediated glucose uptake in muscle cells and the effects of this on muscle performance. Here, we show that saturated fatty acids are more lipotoxic in SELENON-devoid cells, and blunt the insulin-mediated glucose uptake of SELENON-devoid myotubes by increasing ER stress and mounting a maladaptive ER stress response. Furthermore, the hind limb skeletal muscles of SELENON KO mice fed a high-fat diet mirrors the features of saturated fatty acid-treated myotubes, and show signs of myopathy with a compromised force production. These findings suggest that the absence of SELENON together with a high-fat dietary regimen increases susceptibility to insulin resistance by triggering a chronic ER stress in skeletal muscle and muscle weakness. Importantly, our findings suggest that environmental cues eliciting ER stress in skeletal muscle (such as a high-fat diet) affect the pathological phenotype of SEPN1-related myopathy and can therefore contribute to the assessment of prognosis beyond simple genotype-phenotype correlations.

Introduction

SELENON is localised in the endoplasmic/sarcoplasmic reticulum (ER/SR), has a thioredoxin reductase-like domain on the ER side of its sequence, and regulates ER calcium levels by means of the redox regulating SERCA2 pump [[1], [2], [3]]. Despite its ubiquitous expression, SELENON loss of function gives rise to a selective muscle pathological phenotype associated with insulin resistance [4]. As the majority of insulin-dependent glucose uptake (75–90%) takes place in skeletal muscle, a defect in skeletal muscle insulin-dependent glucose disposal is widely viewed as being critical for the development of whole-body insulin resistance and type 2 diabetes [5].

Insulin signal transduction is activated in skeletal muscle following the binding of insulin to insulin receptor tyrosine kinase. The activated receptor phosphorylates the downstream docking protein substrates which, as a result of phosphatidylinositol 3-kinase and Akt pathway activation, leads to the translocation of the GLUT4 glucose transporter to the plasma membrane and cellular glucose uptake [6].

Long-chain saturated fatty acid accumulation is lipotoxic in skeletal muscle [7,8] and induces ER stress, the consequent ER stress response [9] that together with mitochondrial dysfunction contributes to the pathogenesis of the muscle insulin resistance by inhibiting glucose transport [[10], [11], [12]]. ER and mitochondria communicate through the mitochondria associated membranes (MAMs), the disruption of which also triggers insulin resistance by inducing ER stress and affecting mitochondrial metabolism [[13], [14], [15]].

We here show that the lack of SELENON in saturated fatty acid-challenged myotubes blunts insulin-dependent glucose uptake (i.e. triggers insulin resistance) by eliciting ER stress, disrupting ER-to-mitochondria communications, and altering mitochondria quality and cell bioenergetics. Importantly, SELENON KO mice fed a high-fat diet are more glucose intolerant, and their skeletal muscles show impaired insulin signalling, strength force, and an increased ER stress. A combination of SELENON loss and a high-fat diet therefore synergistically contribute to the pathogenesis of SEPN1-related myopathy by triggering insulin resistance and impairing muscle performance.

Results

Insulin resistance is part of the phenotype in SEPN1-related myopathy patients

Autosomal recessive mutations of the SELENON gene (also known as SEPN1) cause SEPN1-related myopathy, a rare congenital myopathy typically associated with low body mass index (BMI) [16]. Insulin resistance was first reported in 5 SEPN1-related myopathy patients in 2006 [4]. To confirm the association between SELENON defects and insulin resistance, we evaluated retrospectively follow-up data from eight patients with confirmed SELENON mutations in whom an oral glucose tolerance test (OGTT) had been performed. All patients had congenital muscle weakness more severe in axial muscles, respiratory insufficiency and scoliosis, typical of SEPN1-related myopathy. The results of the OGTT, summarized in Table 1, disclosed abnormal glucose metabolism in 4 of the 8 patients, despite a very low body mass index (<13.1). Patient 1 showed high level of fasting glycemia, without any increase in glycated hemoglobin. Patients 2–4 had normal basal glycemia but altered OGTT. Interestingly, Patient 1 evolved from normal fasting blood glucose and OGGT at age of 37 years to basal hyperglycemia one year later, stressing the need for regular controls of glucose metabolism during the follow-up of SEPN1-related myopathy patients. There was no correlation between abnormal glucose metabolism and patient age or with the type of SELENON mutation (truncating, nonsense or missense). In contrast, insulin-resistance or prediabetes were observed only in patients with extremely low BMI values. These results confirm that paradoxical insulin resistance in very low BMI patients is part of the SEPN1-related myopathy phenotype.

Table 1

Patient	1	2	3	4	5	6	7	8
Sex	M	F	F	F	M	F	M	M
Age years (y)	38	22	52	47	28	17	34	43
SELENON mutation	c.713dupA (p.N238Kfs*63) + c.1397G>A (p.R466Q)	c.713dupA (p.N238Kfs*63) homozygous	c.13_22dup (p.Q8Pfs*78) + c.883G>A (p.E295K)	c.13_22dup (p.Q8Pfs*78) homozygous	c.997_1000del (p.V333Pfs*6) homozygous	c.713dupA (p.N238Kfs*63) homozygous	c.1358G>C (p.W453S) + c.1397G>A (p.R466Q)	c.1A>G (p.M1V) + c.565C>T (p.R189*)
FPG (mmol/L)	<6 at 37y6.7 at 38y	4.8	4.6	4.9	<6	<6	4.6	<6
OGTT	Normal at 37y	Increased 2 h insulin concentration (61.2 mU/l)	Increased 1 h and 2 h plasma glucose (12.3 and 9.8 mmol/L).Increased 2 h insulin (37.74mU/L)	Increased 2 h plasma glucose (9.9 mmol/L)	Normal	Normal	Normal	Normal
BMI (kg/m2)	11.7	12.8	13.1	13	18	15.6	16.6	UK

F: female; M: male; FPG: Fasting plasma glucose (reference range: 4–6 mmol/L); OGTT: Oral glucose tolerance test (reference values: 1 h post-load plasma insulin <80 mU/L, 2 h post-load plasma insulin <14 mU/L, 1 h and 2 h post-load plasma glucose <10 mmol/L and <7.8 mmol/L respectively); BMI: Body Mass Index (reference values: <18.5:underweight; 18.5–24.9: healthy weight; 25–29.9: overweight; >30: obese). UK: unknown.

SELENON signal is clustered in response to a palmitate challenge

We moved to a cell system to study the chain of events that connect SELENON loss with an insulin resistant phenotype. In order to overcome the problems associated with unreliable SELENON antibodies, we used CRISPR/CAS9 technology to insert a green fluorescent protein (GFP) tag at the C-terminal of the SelenoN genomic locus of C2C12 myoblasts, and then selected and genomically sequenced the clones homozygous for the GFP insertion in order to prove the correct insertion (Fig. Sup 1–3). The relatively low fluorescent levels in the vehicle-treated cells indicated poor SELENON-GFP signal, but treatment with the saturated fatty acid palmitate (palm, 100 μM) increased the fluorescence of SELENON-GFP without significantly changing that of the KDEL protein ER markers (Fig. 1A and B). In addition, the SELENON-GFP signal appeared clustered in granular signal rather than showing a more typical tubular ER pattern after palmitate treatment (Fig. 1C and D), thus indicating higher fluorescence and different spatial distribution of SELENON after palmitate.

Fig. 1

Higher SELENON levels in palmitate-treated cells. A) Representative images of GFP immunofluorescence in confocal field of views analysed for vehicle-treated (upper panels) or (100 μM) palmitate-treated (lower panels) C2C12 showing SELENON-GFP signal. Nuclei are in blue, SELENON-GFP in green and KDEL (ER staining) in red. Scale bar 20 μm. B) The fluorescence intensity of SELENON-GFP is increased in palmitate treated cells while that of KDEL does not significantly change. Each dot represents one field of views. C) Representative 100× images of cells treated with vehicle (upper panels) or palmitate 100 μm (lower panels) showing SELENON-GFP clustering. Scale bar 20 μm. The panels on the right show the super-resolution image (SIM) of SELENON-GFP; scale bar 2 μm. D) Quantification of SELENON-GFP signal distribution using a gray-level co-occurrence matrix over the yellow outline of the SIM images revealed increased pixel homogeneity (expressed as inverse difference moment, IDM) in the palmitate-treated cells indicating greater signal clustering. Each dot represents one cell.

SELENON deficiency affects the ER and mitochondria

ER, mitochondria and MAM impairments are involved in the onset of insulin resistance [14,17,18]. In order to analyse the ER, mitochondria and MAMs of palmitate-treated SELENON Knock down (KD) C2C12 cells in detail, we used a combination of specific fluorescent trackers and super-resolution microscopy (Fig. Sup 4). Analysis of the fluorescence of the ER and mitochondria trackers in relation to cell area and their overlapping fluorescent signal showed that the palmitate treatment of SELENONKD cells shrunk the ER area fraction (WT versus SELENON KD and SELENON KD versus SELENON KD, palm.), reduced ER-to-mitochondria contacts (ERmito Area fraction) (WT versus SELENON KD and SELENON KD versus SELENON KD, palm.) and reduced the total mitochondrial content (Total mito area fraction) (SELENON KD versus SELENON KD, palm.) (Fig. 2A and B). In addition, an ad hoc skeletonised analysis of mitochondria morphology showed that palmitate triggered mitochondria fragmentation to a greater extent in SELENON KD cells than in wild-type (WT) cells (Fig. 2C and D). It is worth noting that the palmitate-treated SELENON KD cells had less ATP (Fig. 2E), thus suggesting that both the absence of SELENON and palmitate affect the ER and mitochondrial morphology and compromise cell bioenergetics.

Fig. 2

The absence of SELENON and treatment with palmitate both impair ER and mitochondria. A) Representative SIM images of WT or SELENON KD C2C12 cells treated with vehicle or palmitate (palmitate was used at 100 μM) showing the nuclei (blue), ER (green) and mitochondria (red). Scale bar 2 μm. B) Dot plots representing the ER area fraction (i.e. the area occupied by the ER), the ERmito area fraction (i.e. the mitochondrial signal closer to the ER) and the total mito area fraction (i.e. total mitochondrial signal). C) The mitochondria signal was segmented and skeletonised and the related area calculated. On the right, representation of the area occupied by the skeletonised mitochondria. D) Dot plots representing the skeletonised area fraction. Each dot represents one cell. E) Measurement of the cellular ATP content of WT and SELENON KD cells treated or not with palmitate (n = 4).

SELENON deficiency worsens palmitate-induced lipotoxicity by eliciting ER stress

As the presence of lipid droplets in skeletal muscle is associated with insulin resistance [19], we investigated the content of the lipid droplets in WT and SELENON KD C2C12 cells after treatment with vehicle or palmitate. The fluorescence levels of BODIPY (boron-dipyrromethene, a molecule that fluorescently stains neutral lipids) indicated that the content of the droplets in both WT and SELENON KD C2C12 cells was higher after palmitate treatment than after treatment with the vehicle alone, and higher in SELENON KD cells than in WT cells after both treatments (Fig. 3A and B).

Fig. 3

Palmitate lipotoxicity is associated with ER stress and affects insulin signalling in SELENON KD myotubes. A) BODIPY staining of neutral lipids in vehicle- and palmitate-treated WT and SELENON KD C2C12 cells. Palmitate was used at 100 μM. Scale bar 50 μm and scale bar of the inset 10 μm. B) Quantification of BODIPY fluorescence (each dot represents one cell). C) Metabolic activity (MTS) of WT and SELENON KD C2C12 cells treated with the indicated concentrations of palmitate for 24 h. Metabolic activity is expressed as the relative reduction in MTS in palmitate-exposed cells in comparison with vehicle-treated cells (arbitrarily set at 100%) (n = 4). D) Metabolic activity (MTS) of WT and SELENON KD C2C12 cells treated with the indicated concentrations of tunycamicin for 12 h. Metabolic activity is expressed as the relative reduction in MTS in tunycamicin-exposed cells in comparison with unexposed (DMSO-treated) cells (arbitrarily set at 100%) (n = 4). E) Semi-quantitative, real-time RT-PCR analysis of ER stress response markers in mRNA prepared from WT and SELENON KD C2C12 cells treated with BSA alone or 100 or 200 μM of palmitate (n = 3). F) Metabolic activity (MTS) of WT, ERO1KO, SELENON KD and ERO1KO, SELENONKD C2C12 cells treated with the indicated concentrations of palmitate for 24 h. Metabolic activity is expressed as the relative reduction in MTS in palmitate-exposed cells in comparison with vehicle-treated cells (arbitrarily set at 100%) (n = 4). Below, ERO1 and β-Actin Immunoblots of six different C2C12 clones after CRISPR/CAS9. Four of them (2WT and 2 ERO1KO) were treated with palmitate and analysed for metabolic activity. G) The dot plots indicate the insulin-mediated glucose uptake in vehicle- and palmitate-treated WT and SELENON KD C2C12 myotubes as a percentage of the increased glucose uptake after insulin treatment in comparison with basal glucose uptake in the same cells (n = 4). H) Representative immunoblots of p-AKT and AKT and, on the right, the relative quantification of the bands in arbitrary units (AU) in vehicle- and palmitate-treated WT and SELENON KD C2C12 myotubes. β-actin was used as a loading control (n = 3).

In order to assess whether lipid accumulation affects the metabolic rate of the cells, WT and SELENON KD C2C12 cells were exposed to palmitate at concentrations of 5–500 μM. MTS assays showed SELENON KD cells had lower metabolic rate than WT cells, which suggests the greater lipotoxicity of palmitate in SELENON KD cells (Fig. 3C). Similarly, the ER stressor tunicamycin used at concentrations of 0,5-4 μg/mL impaired the metabolic rate of SELENON KD C2C12 cells to a greater extent than that of WT cells (Fig. 3D), thus suggesting the greater susceptibility of SELENON KD cells to ER stress.

The absence of SELENON and treatment with palmitate both elicit ER stress [3,9,10,20,21], which in turn initiates an ancient multi-signalling pathway known as the ER stress response. The ER stress response usually promotes recovery from ER stress by inducing chaperones and attenuating protein translation by the IRE-1, ATF6 and PERK pathways. IRE-1 splices the mRNA of transcription factor X-box-binding protein 1 (XBP1spliced), which activates the transcription of ER stress response target genes; ATF6 promotes the induction of chaperone BIP; and PERK attenuates protein translation and up-regulates transcription factor ATF4. The PERK branch may also induce pro-apoptotic CHOP, the downstream protein disulfide oxidase ERO1 alpha (henceforth ERO1 [22]), and the phosphatase GADD34, which may be involved in a maladaptive ER stress response causing the failure of ER stress relief and dysfunction [23,24]. Interestingly, the IRE-1 and PERK branches of the ER stress response are also activated by lipotoxic stress due to saturated free fatty acid impairing membrane fluidity and promoting the dimerisation and activation of the IRE-1 and PERK pathways [9,25].

In order to determine whether the lower metabolic rate induced by palmitate in SELENON KD C2C12 cells is due to increased ER stress, we examined the levels of ER stress markers in WT and SELENON KD cells. Interestingly, the levels of BIP and ATF4 and all three maladaptive ER stress response mediators (CHOP, ERO1 and GADD34) were significantly higher in the SELENON KD cells treated with palmitate at two lipotoxic concentrations (100 and 200 μM) (Fig. 3E), thus indicating increased ER stress. Accordingly, the ablation of the maladaptive ERO1 (ERO1KO) in SELENON KD cells significantly increased the metabolic rate of these cells when compared to those with normal ERO1 levels and when the cells were treated with low concentrations of palmitate (50 and 100 μM) (Fig. 3F and Fig. Sup. 5).

SELENON deficiency impairs insulin-dependent glucose uptake

As ER stress may affect insulin-dependent glucose uptake [26], we investigated whether the lack of SELENON increases the susceptibility to insulin resistance of myotubes. To this end, WT and SELENON KD myotubes were tested for insulin-dependent glucose uptake in the presence of vehicle or palmitate (100 μM). As expected, metabolic tracings of 3H-2 deoxy-glucose (2DG) showed that palmitate-treated WT and SELENON KD myotubes had reduced insulin-stimulated 2DG uptake in comparison with their vehicle-treated counterparts. Furthermore, uptake was less in the SELENON KD myotubes than in the WT, thus suggesting that palmitate and the lack of SELENON both contribute to the reduction (Fig. 3G).

Phosphorylation of AKT at Ser-473 triggers Glut4 translocation to the plasma membrane and glucose uptake [6]. In order to substantiate the finding of reduced insulin-dependent glucose uptake in palmitate-treated SELENON KD myotubes, we analysed AKT phosphorylation after insulin treatment. SELENON deficiency had no appreciable effect on the AKT phosphorylation of insulin-treated cells (lanes 3 versus 4 of Fig. 3H) but, together with palmitate treatment, it reduced AKT phosphorylation in comparison with the WT (lanes 7 versus 8 of Fig. 3H), suggesting impaired insulin signalling in palmitate-treated SELENON-devoid myotubes.

The ER stress inhibitor TUDCA partially rescues palmitate-induced lipotoxicity

In order to investigate whether relief from ER stress reduces palmitate-induced lipotoxicity in SELENON KD cells, we examined the effect of TUDCA, an inhibitor of ER stress [27]. To this end, WT and SELENON KD C2C12 cells were pre-conditioned with TUDCA 1 mM (a typical concentration in the literature [28]) for 12 h and then treated with palmitate (100 μM). The pre-conditioning led to a small but consistent improvement in MTS assay results (Fig. 4A) that suggested a higher metabolic rate in both palmitate-treated WT and SELENON KD cells.

Fig. 4

TUDCA attenuates lipotoxicity and ER stress, and improves insulin-mediated glucose uptake in palmitate-treated myotubes. A) Metabolic activity (MTS) of WT and SELENON KD C2C12 cells pre-treated with TUDCA (1 mM) for 12 h, and then treated with palmitate for 24 h. Metabolic activity is expressed as the relative reduction in MTS in palmitate-treated cells in comparison with vehicle-treated cells (arbitrarily set at 100%) (n = 4). B) Semi-quantitative real-time RT-PCR analysis of ER stress response markers in mRNA prepared from WT and SELENON KD C2C12 cells treated with vehicle alone or palmitate 100 μM, or pretreated with TUDCA (1 mM) and then with palmitate 100 μM (n = 3). C) BIP, ERO1 and β-Actin Immunoblots of WT and SELENON KD C2C12 myotubes. D) Percentage improvement in insulin-mediated glucose uptake in WT and SELENON KD C2C12 myotubes pre-treated with TUDCA and then treated with palmitate in comparison with myotubes only treated with palmitate.

As expected, TUDCA reduced the levels of some ER stress response markers (CHOP, XBP spliced and BIP), but their levels were still higher in the SELENON KD than the WT myotubes. TUDCA pre-treatment also reduced the levels of the maladaptive response marker ERO1 in SELENON KD myotubes, thus indicating that it partially prevented ER stress and the consequent response (Fig. 4B). Accordingly, western blot analysis showed that TUDCA pre-treatment decreased the levels of BIP and ERO1 proteins in palmitate-treated WT and SELENON KD C2C12 cells (lanes 7 and 8 versus lanes 9 and 10 in Fig. 4C). It also increased insulin-stimulated 2DG uptake by 10% in the palmitate–treated WT cells, and by 30% in palmitate–treated SELENON KD cells (Fig. 4D), thus indicating that even the partial TUDCA-mediated prevention of palmitate-induced ER stress may limit lipotoxicity in WT and SELENON KD myotubes.

SELENON KO mice are more likely to develop glucose intolerance

In order to study the direct consequences of fatty acid-induced lipotoxicity on SELENON KO mouse metabolism and skeletal muscle, we fed 9-week-old adult male WT and SELENON KO mice a high-fat diet (40% of calories from fat) for nine weeks and compared them with their counterparts fed a standard diet.

The WT and SELENON KO mice fed the standard diet showed no statistically significant difference in weight gain, but the SELENON KO mice on the high-fat diet showed a tendency to gain less weight even though their food intake was similar to that of the WT mice (Fig. 5A).

Fig. 5

SELENON loss affects glucose tolerance. A) Body weight of WT and SELENON KO mice fed a standard or high-fat diet (45% fat) for nine weeks (n = 5 on regular diet and n = 6 on HFD). B) Blood glucose concentrations after a glucose injection in WT and SELENON KO mice fed a standard or high-fat diet for nine weeks. C) Bar graphs showing the area under the curve (AUC) of the glycemic profile. D) Bar graphs showing plasma insulin levels. E) Bar graphs showing the levels of insulin extracted from the pancreas. F) Blood glucose concentrations after a glucose injection in WT, SELENON KO, CHOP KO and DKO (SELENON and CHOP KO) mice fed a high-fat diet for six weeks. G) Bar graphs showing the area under the curve (AUC) of the glycemic profile of the mice with the indicated genotype fed a high-fat diet for six and eleven weeks (n = 6).

Glycemic control was comparable in the SELENON KO and WT mice on the standard diet (Fig. 5B) but, despite their lower weight gain after nine weeks on the high-fat diet, SELENON KO mice showed moderately greater glucose intolerance than the WT mice (Fig. 5B and C). This impaired glucose tolerance in comparison with the WT mice was not associated with a decrease in plasma and pancreas insulin levels but with a trend to an increase, thus suggesting that the defective glucose tolerance of the SELENON KO mice was not due to the lower levels of insulin secreted by the pancreas (Fig. 5D and E). Taken together, these findings suggest that SELENON loss in adult mice causes metabolic alterations such as glucose intolerance in response to a high-fat diet.

In order to investigate whether the glucose intolerance of SELENON KO mice on a high-fat diet improved in the absence of the maladaptive ER stress response mediator CHOP [29], we analysed WT, SELENON KO, CHOP KO and double SELENON/CHOP KO (DKO) mice fed a standard or high-fat diet. The deletion of CHOP improved the glucose tolerance of SELENON KO mice after six weeks on a high-fat diet, but the effect was only transient and completely disappeared after 11 weeks on the diet, possibly because CHOP deletion significantly increased obesity (Fig. 5F and G and Sup. 6).

SELENON KO and a high-fat diet impair insulin signalling and contractile performance in skeletal muscle

As AKT phosphorylation occurs downstream of insulin signalling [30] and is impaired in palmitate-treated SELENON KD myotubes, we analysed AKT phosphorylation in the gastrocnemius muscle of WT and SELENON KO mice fed a high-fat or standard diet. AKT was markedly phosphorylated in the muscles of the control WT mice fed a high-fat diet and much less so in the SELENON KO mice fed a high-fat diet (lanes 3–4 versus lanes 7–8 of Fig. 6A), thus indicating reduced insulin signalling in the muscle of the latter.

Fig. 6

SELENON loss impairs insulin signalling and muscle strength by increasing the ER stress response in skeletal muscle. A) Representative Immunoblots of p-AKT and AKT in the gastrocnemii of WT and SELENON KO mice fed a standard or high-fat diet. GAPDH was used as a loading control. B) Semi-quantitative, real-time RT-PCR analysis of ER stress response markers in mRNA prepared from gastrocnemii (n = 6). C) Real-time PCR quantification of the amount of gastrocnemius mtDNA in relation to that of RNase-P, a nuclear gene used as a standard (n = 6). The bar graphs represent the ratio between mitochondrial content in mice fed a high-fat and a standard diet. D) Representative HE, Oil Red O(ORO), NADH and PAS micrographs of gastrocnemii (scale bar 40 μm). Below, high magnification micrographs (scale bar 20 μm). E) Dot plots representing the weight of each gastrocnemius. F) Force-frequency curves and bar graphs of the tetanic stimulation (stimulation frequency 100 Hz) representing the specific in vivo strength of the gastrocnemii (n = 6).

Subsequently, given the correlation between ER stress and insulin resistance, we analysed the levels of ER stress response markers in the gastrocnemius muscle. In qualitative agreement with our findings in palmitate-treated SELENON KD myotubes, the levels of the maladaptive response markers CHOP, ERO1 and GADD34 were higher in the gastrocnemii of the SELENON KO mice fed a high-fat diet, thus indicating an exacerbated maladaptive ER stress response (Fig. 6B). In addition, the small decrease in mitochondria content (Fig. 6C) indicated that, as in the case of the palmitate-treated C2C12 cells, the combination of a high-fat diet and SELENON loss leads to defects in the gastrocnemius that is not confined to the ER but also affects mitochondria. Despite these defects, the gastrocnemius of the SELENON KO mice fed a high-fat diet did not show any gross histological alterations in HE staining, but there was a substantial defect in NADH staining, more abundant in oxidative fibers, and in PAS staining indicating glycogen levels, which may have been due to impaired insulin signalling inhibiting glycogen synthase [31]. On the contrary, Oil Red O staining showed a sharp increase/accumulation in lipid droplets of high-fat-fed SELENON KO gastrocnemius (Fig. 6D). Despite the absence of muscle atrophy in the SELENON KO mice fed a high-fat diet in comparison with their counterparts fed a standard diet and the WT mice fed a high-fat diet (Fig. 6E), their muscles showed impaired normalised force. In vivo measurements of hind limb muscle force showed that the normalised muscle force of the gastrocnemius was similar in WT and SELENON KO mice on a standard diet, as has been previously shown [20], but force generation in the muscles of the SELENON KO mice fed a high-fat diet was significantly less during tetanic stimulation (100 Hz) (Fig. 6F), thus indicating that a high-fat dietary regimen and the lack of SELENON synergistically elicit ER stress, depress insulin signalling and impair force in skeletal muscle.

Discussion

SEPN1-related myopathy is a congenital muscular disorder arising from loss-of-function mutations in the SELENON gene [32,33]. Here, we show abnormalities in the glucose metabolism of patients with SEPN1-related myopathy that suggest insulin resistance. Interestingly, insulin resistance or prediabetes were observed only in patients with extremely low BMI values pointing to a correlation between severe reduction of the muscle and fat tissue and insulin resistance in SEPN1-related myopathy.

Skeletal muscle is the main contributor to post-prandial glucose uptake in the body, so defects in the availability of glucose in skeletal muscle impair metabolic flexibility and reduce body tolerance to glucose [34].

SELENON expression is responsive to ER stress [3] and impaired SELENON KO muscle shows greater ER stress and ER stress response [35], which can also be activated by the lipotoxic stress caused by a saturated fatty acid overload [9]. While eliciting ER stress and ER stress response, saturated fatty acid impairs insulin-dependent glucose uptake in myotubes [14] and a high-fat diet similarly induces ER stress in skeletal muscle and causes insulin resistance [36]. On the basis of these findings, we explored the hypothesis that SELENON deficiency sensitizes muscle cells to the consequences of ER stress and therefore increases the lipotoxicity of saturated fatty acids impairing insulin sensitivity.

Here we show that SELENON is induced during palmitate treatment of cells suggesting a function of SELENON during this treatment. The lack of SELENON during palmitate treatment not only alters ER homeostasis, but also reduces ER-mitochondria apposition (MAMs) and affects mitochondrial morphology and bioenergetics. Importantly, defects in MAMs and mitochondria are also linked to muscle insulin resistance [14,37].

A lack of SELENON increases palmitate-induced lipotoxicity as a result of fatty acid accumulation, thus eliciting ER stress, the consequent maladaptive ER stress response, and blunting insulin-dependent glucose uptake. Treatment with TUDCA, an ER stress inhibitor [27], reduced ER stress in palmitate-treated WT cells, but only slightly lowered the levels of ER stress response markers in palmitate–treated SELENON KD cells. However, surprisingly, it improved insulin-dependent glucose uptake in SELENON-devoid myotubes, clearly suggesting that ER stress is an important component of insulin resistance in SELENON mutant models.

SELENON deficiency triggers glucose intolerance in mice on a high-fat diet despite their trend towards gaining less weight than their WT counterparts. SELENON KO mice fed a high-fat diet show no overt abnormalities in plasma or pancreatic insulin content, suggesting that the glucose intolerance is not caused by a defect in endocrine pancreatic insulin secretion.

In qualitative agreement with findings in SELENON-devoid myotubes, SELENON deficiency impairs insulin signalling in skeletal muscle, as shown by reduced AKT phosphorylation, and leads to exaggerated ER stress, which suggests a correlation between reduced body glucose tolerance, insulin activity and increased ER stress in the muscles of SELENON KO mice fed a high-fat diet. These abnormalities in SELENON KO mice triggered by a high-fat diet reduce hind limb skeletal muscle strength, which is preserved in these mice fed a standard diet [3,20].

The expression of CHOP in SELENON KO muscle of high-fat-fed mice suggests that the maladaptive ER stress response contributes to the glucose intolerance, muscle insulin resistance and dysfunction. Previous studies have shown that the ablation of the maladaptive ER stress response mediator CHOP restores defective insulin secretion from pancreatic beta cells and glucose tolerance in mouse models of chronic ER stress [38,39]. However, CHOP ablation only temporarily rescues the glucose intolerance of SELENON KO mice fed a high-fat diet, suggesting that ER stress and the consequent response is involved in the phenotype of the insulin resistance of SELENON KO mutants, but also that chronic, ubiquitous ablation of CHOP has only a transient beneficial effect on the glucose tolerance and insulin resistance of SELENON KO models, probably as a result of some opposite effects: i.e. CHOP deletion increases obesity [40].

In brief, we propose a model in which the lack of SELENON sensitizes skeletal muscle to the consequences of chronic ER stress induced by palmitate treatment in cells or a high-fat diet in mice, thus impairing insulin signalling and affecting force-frequency responses in skeletal muscle. What is therapeutically important is that these findings suggest that environmental cues eliciting ER stress in skeletal muscle (such as a high-fat diet) affect the pathological phenotype of SEPN1-related myopathy, and can therefore contribute beyond simple genotype-phenotype correlations to establishing a prognosis.

mGADD34 F: GAGGGACGCCCACAACTTC R: TTACCAGAGACAGGGGTAGGT

mCHOP F: CCACCACACCTGAAAGCAGAA R: AGGTGAAAGGCAGGGACTCA

mBIP F: TCATCGGACGCACTTGGAA R: CAACCACCTTGAATGGCAAGA

mATF4 F: ATGGCCGGCTATGGATGAT R: CGAAGTCAAACTCTTTCAGATCCATT

mERO1 F: CATACTCAGCATCGGGGGAC R: GAATGTGAGCAAGCTGAGCG

mSELENON F: GCTTTCCTGTAGAGATGATG  R:GCCCCGCCGGAGTCCTTC

mXBP1s F: GAGTCCGCAGCAGGTG R: GTGTCAGAGTCCATGGGA

mXBP1 total F: GGAGTGGAGTAAGGCTGGTG R: CCAGAATGCCCAAAGGATA