Liang Zhao1, Baofang Tian1, Qing Xu2, Cunxin Zhang3, Luo Zhang1, Haolin Fang4. 1. Department of Emergency Trauma Surgery, Jining NO.1 People's Hospital, Affiliated Jining NO.1 People's Hospital of Jining Medical University, Jining Medical University, Jining, Shandong 272000, China. 2. Department of Anesthesia Surgery, Jining NO.1 People's Hospital, Affiliated Jining NO.1 People's Hospital of Jining Medical University, Jining Medical University, Jining, Shandong 272000, China. 3. Department of Spine Surgery, Jining NO.1 People's Hospital, Affiliated Jining NO.1 People's Hospital of Jining Medical University, Jining Medical University, Jining, Shandong 272000, China. 4. Department of Emergency Trauma Surgery, Jining NO.1 People's Hospital, Affiliated Jining NO.1 People's Hospital of Jining Medical University, Jining Medical University, Jining, Shandong 272000, China dochaolinfang0119@163.com.
Abstract
Background: Mechanical load contributes a lot to the initiation and progression of disc degeneration. Annulus fibrosus (AF) cell biology under mechanical tension remains largely unclear.Objective: The present study was aimed to investigate AF cell senescence under mechanical tension and the potential role of autophagy. Methods: Rat AF cells were cultured and experienced different magnitudes (5% elongation and 20% elongation) of mechanical tension for 12 days. Control AF cells were kept static. Cell proliferation, telomerase activity, cell cycle fraction, and expression of senescence-related molecules (p16 and p53) and matrix macromolecules (aggrecan and collagen I) were analyzed to evaluate cell senescence. In addition, expression of Beclin-1 and LC3, and the ratio of LC3-II to LC3-I were analyzed to investigate cell autophagy. Results: Compared with the control group and 5% tension group, 20% tension group significantly decreased cell proliferation potency and telomerase activity, increased G1/G0 phase fraction, and up-regulated gene/protein expression of p16 and p53, whereas down-regulated gene/protein expression of aggrecan and collagen I. In addition, autophagy-related parameters such as gene/protein expression of Beclin-1 and LC3, and the ratio of LC3-II to LC3-I, were obviously suppressed in the 20% tension group. Conclusion: High mechanical tension promotes AF cell senescence though suppressing cellular autophagy. The present study will help us to better understand AF cell biology under mechanical tension and mechanical load-related disc degeneration.
Background: Mechanical load contributes a lot to the initiation and progression of disc degeneration. Annulus fibrosus (AF) cell biology under mechanical tension remains largely unclear.Objective: The present study was aimed to investigate AF cell senescence under mechanical tension and the potential role of autophagy. Methods:Rat AF cells were cultured and experienced different magnitudes (5% elongation and 20% elongation) of mechanical tension for 12 days. Control AF cells were kept static. Cell proliferation, telomerase activity, cell cycle fraction, and expression of senescence-related molecules (p16 and p53) and matrix macromolecules (aggrecan and collagen I) were analyzed to evaluate cell senescence. In addition, expression of Beclin-1 and LC3, and the ratio of LC3-II to LC3-I were analyzed to investigate cell autophagy. Results: Compared with the control group and 5% tension group, 20% tension group significantly decreased cell proliferation potency and telomerase activity, increased G1/G0 phase fraction, and up-regulated gene/protein expression of p16 and p53, whereas down-regulated gene/protein expression of aggrecan and collagen I. In addition, autophagy-related parameters such as gene/protein expression of Beclin-1 and LC3, and the ratio of LC3-II to LC3-I, were obviously suppressed in the 20% tension group. Conclusion: High mechanical tension promotes AF cell senescence though suppressing cellular autophagy. The present study will help us to better understand AF cell biology under mechanical tension and mechanical load-related disc degeneration.
Low back pain is a common worldwide disease contributing to suffering and distress of individuals and leads to an enormous cost on social healthycare system [1]. According to an epidemiologic study, the medical cost is more than $40 billion and the total number of cases is more than 52 million each year in the United States [2]. Among those risk factors of low back pain, intervertebral disc degeneration (IDD) is considered as a major contributor [3]. Surgical intervention is effective to alleviate pain syndrome if the conservative therapies fail [4]. However, surgical approaches have some non-negligible risk of complications and can not biologically regenerate the degenerative disc tissue [5].Anatomically, the intervertebral disc is a fibrocartilaginous organ consisting of two vertebral endplates, a central gelatinous nucleus pulposus (NP) region and a surrounding lamellar annulus fibrosus (AF) tissue [6]. Together, these three structurally connected parts facilitate to weight bearing and spinal flexibility. Changes in disc tissue matrix negatively affect disc biomechanical and structural properties, which ultimately lead to loss of normal spine function [6]. During past years, considerable progress has been made to understand NP biology and regenerate degenerative NP tissue, but much less has been achieved in that of AF tissue.The AF tissue is an important supporting component to confine NP tissue and ultimately to maintain biomechanical function of the disc. During daily activities, the AF tissue is mainly subjected to lateral tension due to compressive deformation of NP tissue that is resulted from various mechanical compressions [7]. Previous studies have indicated that tears and fissures of AF tissue are closely related with onset and aggravation of disc degeneration [8,9]. Currently, mechanical tension is regarded as a reason for AF structural destruction [7]. Hence, further investigation on AF biology under mechanical stimulation is important to understand pathogenesis of disc degeneration and develop biological strategies to regenerate AF tissue.Cell senescence is a classical character within the degenerative disc tissue, and it positively correlates with the degree of disc degeneration [10,11]. Senescent disc cells often exhibit a matrix catabolism profile with declined ability to synthesize matrix macromolecules, which will ultimately make disc tissue easy to be injured [12]. Importantly, mechanical overload often induces disc NP cells senescence [13-16]. However, few studies investigated disc AF cell senescence under mechanical stimuli. In addition, as a self-renewal mechanism, cell autophagy is reported to alleviate cell senescence under stimulation of different pathological factors [17,18]. Therefore, the present study was aimed to study disc AF cell senescence under different magnitudes of mechanical tension, as well as the potential role of cell autophagy in this process.
Materials and methods
Ethical statement
For animal experiments, 34 male Sprague–Dawley rats (12 weeks old, 380–400 g weight) were approved by the Guidelines of Ethics Committee of Jining No.1 People’s Hospital Affiliated to Jining Medical University (SWFK [LU] 2054-0016).
AF cell isolation and culture
Briefly, an AF tissue was separated using a pair of ophthalmic scissors under a dissecting microscope. AF tissue was digested using 0.02% Type I collagenase (Sigma-Aldrich, U.S.A.) overnight at 37°C. The isolated AF cell pellets were resuspended in DMEM/F12 medium containing 10% fetal bovine serum (FBS, Gibco, U.S.A.) and 1% (v/v) penicillin–streptomycin (Gibco, U.S.A.). When at 80–90% confluence, the second or third passage AF cells were collected to use in each assay. To study the effects of mechanical tension on AF cell senescence, three groups were designed: (I) The control group in which AF cells were kept static; (II) The 5% tension group in which AF cells experienced 5% elongation at a frequency of 1 Hz for 8 h per day; (III) The 20% tension group in which AF cells experienced 20% elongation at a frequency of 1 Hz for 8 h per day. Before mechanical tension using a FX-5000T Flexercell tension plus system (Flexcell International Corp.), AF cells in these three groups were first seeded on the flexible silicone membrane of the culture chamber (2 × 105 cells/chamber) and then incubated with DMEM/F12 medium without serum for synchronization before reaching 60% confluence. Previously, our preliminary study has investigated responses of AF cell apoptosis to different magnitudes (1, 5, 10, 15, and 20% elongations) of mechanical tension, and found that the mechanical tension of 20% elongation significantly promoted AF cell apoptosis compared with the mechanical tension of 5% elongation (unpublished). Therefore, the magnitudes of mechanical tension, 5% elongation and 20% elongation, were respectively designed as low and high mechanical tension according to our own experience. After 12 days of mechanical tension, AF cells were collected and used in each assay.
Cell proliferation
Cell proliferation potency was evaluated using a CCK-8 assay kit (Beyotime, China). Briefly, after mechanical tension, NP cells were collected by digestion with trypsin and seeded in the 96-well cell culture plate (4 × 103 cells per well). After cell adherence, the CCK-8 reagent was added into the fresh culture medium with a ratio of 1:10 (volume ratio). Then, the absorbance value at a wavelength of 450 nm was measured on days 1 and 3 using an automatic microplate reader (Thermo, U.S.A.).
Telomerase activity measurement
Telomerase activity was analyzed using a rat telomerase ELISA Kit according to the manufacturer’s instructions (Elabscience Biotechnology Co., Ltd, Wuhan, China). Briefly, AF cells were washed with sterile phosphate buffer solution. Then, the protein supernatant was collected after AF cells were lysed by RIPA lysis buffer (Beyotime, China). Thereafter, a 100 μl sample in each group was used for measuring telomerase activity. Finally, telomerase activity expressed as telomerase concentration (pg/ml) was calculated according to the established standard curve and the optical density (OD) at a wavelength of 450 nm.
Cell cycle fraction analysis
Cell cycle fraction was analyzed using a flow cytometry (BD Biosciences, U.S.A.). Briefly, AF cells were washed with PBS and fixed with 70% ice ethanol overnight at 4°C. Then, they were incubated with 50 μg/ml PI solution (Beyotime, China) for 30 min under dark condition. Finally, the fraction of each cell cycle (G0/G1, G2/M, and S) was analyzed by FlowJo software (FlowJo LLC, Ashland, OR, U.S.A.).
Real-time PCR analysis
Briefly, total RNA was extracted from collected AF cells using TriPure Isolation Reagent (Roche, Switzerland) and reverse-transcribed into cDNA using a PrimeScript™ 1st Strand cDNA Synthesis Kit. After a reaction mixture containing cDNA, SYBR Green Mix (Toyobo, Japan) and specific primers (Table 1) was created, it was subjected to a real-time PCR machine (CFX96 Real-Time System, Bio-Rad). The thermal cycling for PCR was as follows: 5 min at 95°C, followed by 35 amplification cycles of 10 s at 95°C, 10 s at 55°C, and 10 s at 72°C. Finally, relative gene expression normalized to the internal reference (GAPDH) was calculated using the 2−△△Ct method.
Table 1
Primers of target genes
Gene
Forward (5’-3’)
Reverse (5’-3’)
GAPDH
GGCACAGTCAAGGCTGAGAATG
GGTGGTGAAGACGCCAGTA
Aggrecan
CTTCCCAACTATCCAGCCAT
TCACACCGATAGATCCCAGA
Collagen I
ATGTTCAGCTTTGTGGAC
GGATGCCATCTTGTCCAG
Beclin-1
CGGAATTCTATGGAAGGGTCTA
CGGGATCCTCATTTGTTATAAAATT
LC3
CAGGATCCATGCCGTCCCAGAAGACC
GTCCCTTTTTGCCTTGGTAG
P53
GGGAATCTTCTGGGACGGGACA
CTGGTGGGCAGTGCTCTCTTTG
P16
CGTCGTGCGGTATTTGCGGTAT
GCGTTGCCAGAAGTGAAGCCA
Western blot analysis
Briefly, after mechanical tension, total protein was extracted using RIPA lysis solution (Beyotime, China) and protein concentration was determined using a BCA Protein Assay Kit (Beyotime, China). Then, protein sample was separated by SDS–PAGE and transferred onto the PVDF membrane which was then blocked by 5% BSA for 1 h at room temperature with constant agitation. Thereafter, PVDF membranes were incubated with primary antibodies (β-actin: Proteitech, 60008-1-Ig; p16: Novus, NBP2-37740; p53: Proteintch, 10442-1-AP; collagen I: Abcam, ab34710; aggrecan: Santa Cruz, sc-16492; Beclin-1: Abcam, ab207612; LC3: Cell Signaling Technology, #12741. All diluted at 1:2000) overnight at 4°C. After washing the membrane for three times with PBS-T, the horseradish peroxidase (HRP)-conjugated secondary antibodies were added and incubated at room temperature for 2 h. Following another three washes with PBS-T, protein bands were visualized using the LiCoR Odyssey imager (LI-COR Biosciences, Lincoln, NE, U.S.A.), and semiquantification was performed using the LiCoR Odyssey imager software.
Statistical analysis
All numeric data were shown as mean ± standard deviation values and the mean values were analyzed using the SPSS17.0 software. The one-way ANOVA was used for comparisons between groups. A P-value of less than 0.05 was considered as a significant difference.
Results
Results showed that AF cell proliferation in the 20% tension group was significantly decreased compared with the 5% tension group and the control group on days 1 and 3. However, AF cell proliferation between the control group and the 5% tension group did not show any significant difference (Figure 1).
Figure 1
Cell proliferation analysis
Cell proliferation potency of AF cells under mechanical tension was analyzed by a CCK-8 kit. The Data are presented as mean ± SD (n=3). *: Indicates a statistical difference (P<0.05) between two groups.
Cell proliferation analysis
Cell proliferation potency of AF cells under mechanical tension was analyzed by a CCK-8 kit. The Data are presented as mean ± SD (n=3). *: Indicates a statistical difference (P<0.05) between two groups.
Telomerase activity
Results showed that telomerase activity in the 5% tension group was similar to that in the control group; whereas, telomerase activity in the 20% tension group was significantly lower than that in the control group. Furthermore, telomerase activity in the 20% tension group was significantly decreased compared with that in the 5% tension group (Figure 2).
Figure 2
Telomerase activity analysis
Telomerase activity of AF cells under mechanical tension was evaluated by a telomerase ELISA Kit. The data are presented as mean ± SD (n=3). *: Indicates a statistical difference (P<0.05) between two groups.
Telomerase activity analysis
Telomerase activity of AF cells under mechanical tension was evaluated by a telomerase ELISA Kit. The data are presented as mean ± SD (n=3). *: Indicates a statistical difference (P<0.05) between two groups.
Cell cycle fraction
Our results showed that 5% tension group had a similar fraction of the G0/G1 phase and a little lower fraction of the S phase compared with those in the control group. Additionally 20% tension group had a significantly higher fraction of the G0/G1 phase and a significantly lower fraction of the S phase compared with those in the control group. Moreover, fraction of G1/G0 phase and fraction of S phase in the 20% tension group were significantly increased and decreased compared with those in the 5% tension group, respectively (Figure 3).
Figure 3
Cell cycle analysis
Fraction of each cell cycle (G1/G0, G2/M, and S) of AF cells under mechanical tension was evaluated. The data are presented as mean ± SD (n=3). *: Indicates a statistical difference (P<0.05) between two groups.
Cell cycle analysis
Fraction of each cell cycle (G1/G0, G2/M, and S) of AF cells under mechanical tension was evaluated. The data are presented as mean ± SD (n=3). *: Indicates a statistical difference (P<0.05) between two groups.
Expression of senescence markers
Gene and protein expression of senescence markers (p16 and p53) were analyzed. Results showed that both gene and protein expression of them in the 5% tension group was similar to that in the control group; whereas, their expression in the 20% tension group was significantly higher than that in the control group. Furthermore, their expression in the 20% tension group was significantly increased compared with that in the 5% tension group (Figure 4).
Figure 4
Expression of senescence markers
Both gene and protein expression of senescence markers (p16 and p53) of AF cells under mechanical tension was evaluated. (A) Real-time PCR analysis. (B) Western blot analysis. The data are presented as mean ± SD (n=3). *: Indicates a statistical difference (P<0.05) between two groups.
Expression of senescence markers
Both gene and protein expression of senescence markers (p16 and p53) of AF cells under mechanical tension was evaluated. (A) Real-time PCR analysis. (B) Western blot analysis. The data are presented as mean ± SD (n=3). *: Indicates a statistical difference (P<0.05) between two groups.
Expression of matrix macromolecules
Because AF matrix mainly contains aggrecan and collagen I, their gene and protein expression were analyzed. Results showed that 5% tension partly increased their gene and protein expression with no statistical significance compared with the control group; whereas, 20% tension group significantly decreased their expression compared with the control group. In addition, both gene and protein expression of them in the 20% tension group were significantly down-regulated compared with the 5% tension group (Figure 5).
Figure 5
Expression of matrix macromolecules
Both gene and protein expression of matrix macromolecules (aggrecan and collagen I) of AF cells under mechanical tension was evaluated. (A) Real-time PCR analysis. (B) Western blot analysis. The data are presented as mean ± SD (n=3). *: Indicates a statistical difference (P<0.05) between two groups.
Expression of matrix macromolecules
Both gene and protein expression of matrix macromolecules (aggrecan and collagen I) of AF cells under mechanical tension was evaluated. (A) Real-time PCR analysis. (B) Western blot analysis. The data are presented as mean ± SD (n=3). *: Indicates a statistical difference (P<0.05) between two groups.
Expression of autophagy-related molecules
Expressions of Beclin-1 and LC3, and the ratio of LC3-II to LC3-I were several important parameters to evaluate cell autophagy. Results showed that 5% tension group showed a similar gene/protein expression of them; whereas, 20% tension group showed a decreased expression of them compared with the control group. Moreover, their gene/protein expression in the 20% tension group was significantly decreased compared with the 5% tension group. In addition, the ration of LC3-II protein expression to LC3-I protein expression in the 5% tension group was similar to that of control group; whereas, it was significantly decreased in the 20% tension group compared with both control group and 5% tension group (Figure 6).
Figure 6
Expression of autophagy-related molecules
Both gene and protein expressions of autophagy-related molecules (Beclin-1 and LC3) of AF cells under mechanical tension were evaluated. (A) Real-time PCR analysis. (B) Western blot analysis. The data are presented as mean ± SD (n=3). *: Indicates a statistical difference (P<0.05) between two groups.
Expression of autophagy-related molecules
Both gene and protein expressions of autophagy-related molecules (Beclin-1 and LC3) of AF cells under mechanical tension were evaluated. (A) Real-time PCR analysis. (B) Western blot analysis. The data are presented as mean ± SD (n=3). *: Indicates a statistical difference (P<0.05) between two groups.
Discussion
IDD largely contributes to low back pain [3]. As a mechanical element of the spine, it is subjected to various mechanical stimuli during daily activities [7,19,20]. It has been established that mechanical overload is an important pathological factor to initiate and aggravate disc degeneration [13-15]. During disc degeneration, AF tissue structural destruction – such as tears and fissures – is very common in the degenerated disc AF tissue [8,9]. Because AF matrix anabolism was related to tissue integrity, several studies have indicated that mechanical overload is a contributor to AF tissue structural destruction [19,20]. Hence, further investigation on AF biology under mechanical stimuli is important to understand mechanical load-induced disc degeneration.Disc cell senescence is a classical feature within the degenerative disc tissue, and it is reported that disc cell senescence is positively related with degree of disc degeneration in adults [11,21-23]. Hence, investigation on the role of cell senescence in the progression of disc degeneration is implicated to elucidate the pathogenesis of disc degeneration. Disc cells are responsible for disc matrix homeostasis to maintain disc structural integrity and disc function [24]. Once disc cell senescence is initiated, it will result in a decrease in number of viable and functional disc cells because their replication exhaustion can not resist disc cell loss caused by apoptosis or cell death. Besides, senescent disc cells often secrete matrix proteases and chemokines, which lead to a decrease in matrix synthesis and an increase in matrix degradation [25-27]. To date, much less studies have performed to investigate AF cell senescence under mechanical stimuli.Under physiological conditions, AF cells mainly experience transverse mechanical tension [28]. As we know, this is the first time to investigate AF cell senescence under mechanical tension. It showed that a 20% tension induced a decreased cell proliferation potency and telomerase activity, an increased G1/G0 phase fraction, and a decreased S phase fraction, as well as an up-regulated gene/protein expression of senescence markers (p16 and p53) compared with the 5% tension group, directly indicating that 20% tension significantly promotes AF cell senescence compared with 5% tension. In addition, 20% tension obviously decreased gene/protein expression aggrecan and collagen I compared with 5% tension. In light of the decreased matrix anabolism of senescent cells, these results again indirectly suggest that 20% tension promotes AF cell senescence compared with the 5% tension. Though there were no studies about AF cell senescence under mechanical tension previously, lots of previous studies have demonstrated that high magnitude of mechanical stimuli promotes disc NP cell senescence [13-15,29]. Anyway, the present study and other previous studies demonstrate that high magnitude of mechanical stimulation does harm the healthy disc biology and is a risk factor for disc degeneration.Cell autophagy is a process that can protect cell biology during pathological stress by eliminating the intracellular organelles and molecules through the lysosomal pathway [30]. It participates in the process of many diseases, such as diabetes, neurodegeneration and aging [31-33]. For the mechanism behind AF cell senescence under mechanical tension, we detected cell autophagy under different magnitudes of mechanical tension. We found that gene/protein expression of Beclin-1 and LC3 in the 20% tension group significantly increased, as well as the ratio of LC3-II to LC3-I, compared with the 5% tension group, and that there is no significant difference behind these parameters between 5% tension group and the control group, indicating that cell autophagy is significantly suppressed under high mechanical tension. Taking the promoted AF cell senescence in the 20% tension group into account, we deduced that 20% mechanical tension may promote AF cell senescence through suppressing cell autophagy. This is in line with previous studies demonstrating that certain pathological factors promote disc NP cell senescence through inhibiting cell autophagy [17,18,34,35].However, the present study has several limitations. First, some signaling pathways (i.e., p38 MAPK, PI3K/Akt, and Wnt/β-Catenin) play an important role in mediating disc cell biology under mechanical stimulation [13,36,37]. However, the present study is just a preliminary work of our research team. We will further investigate the potential signaling pathways behind this process in the future study. Second, though several previous studies have showed that certain pathological factors promote disc NP cell senescence through inhibiting cell autophagy [17,18,34,35], the present study did not further use the autophagy inhibitor in the 5% tension group to indirectly verify the role of autophagy in mediating AF cell senescence under mechanical tension.
Conclusion
In a word, the present study studied AF cell senescence and the potential mechanism under mechanical tension. Our results demonstrated that extensive mechanical tension promoted AF cell senescence compared with the low mechanical tension, and cell autophagy may be involved in this process. The present study sheds a light on AF cell senescence under mechanical tension, and will help us to understand mechanical load-related disc degeneration better.
Authors: Nam V Vo; Robert A Hartman; Takashi Yurube; Lloydine J Jacobs; Gwendolyn A Sowa; James D Kang Journal: Spine J Date: 2013-01-29 Impact factor: 4.166