Literature DB >> 30884209

Novel mutations found in the ATP7B gene in Chinese patients with Wilson's disease.

Zhiling Qian1, Xiongwei Cui1, Yunli Huang2, Yanmin Liu2, Ning Li3, Sujun Zheng4, Jun Jiang5, Shichang Cui1.   

Abstract

BACKGROUND: Wilson's disease (WD) is an autosomal recessive genetic disease caused by mutations in ATP7B and characterized by copper metabolism disorders.
METHODS: Direct sequencing of the ATP7B gene is the most sensitive and widely used confirmatory testing method. Fourteen probands with WD and 12 family members participated in this study. The ATP7B gene was analyzed by direct sequencing.
RESULTS: Twenty-nine different variants (27 substitutions, 1 duplication, 1 deletion) were found. Of the 23 reported variants, nine nondisease variants, 11 disease variants, one silent variant, and two variants with uncertain functions were identified. The six novel variants included c.1875T>A, c.2306T>C, c.3028A>G, c.3243G>A, c.3437_3438 delTG, and c.3903+5G>A.
CONCLUSION: These findings will assist in the diagnosis of WD. The novel variants have enriched the WD database.
© 2019 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

Entities:  

Keywords:  zzm321990ATP7Bzzm321990; Wilson's disease; mutation

Mesh:

Substances:

Year:  2019        PMID: 30884209      PMCID: PMC6503029          DOI: 10.1002/mgg3.649

Source DB:  PubMed          Journal:  Mol Genet Genomic Med        ISSN: 2324-9269            Impact factor:   2.183


BACKGROUND

Wilson's disease (WD, OMIM#277900) is an autosomal recessive genetic disease caused by mutations in ATP7B (HGNC: 870, VERSION NG_008806.1). ATP7B is located on 13q14.3 and contains 20 introns and 21 exons, for a total genomic length of 80 kb (Tanzi et al., 1993). ATP7B encodes copper‐transporting P‐type ATPase, which is a group of transmembrane copper transport proteins (Petrukhin et al., 1993). This protein is composed of 1,465 amino acids that contain a phosphatase domain (A‐domain), a phosphorylation domain (P‐domain), a nucleotide‐binding domain (N‐domain), and eight transmembrane ion channels (M‐domain) (Cater, Fontaine, & Mercer, 2007). Mutation of the ATP7B gene is closely linked to the impairment of copper excretion, leading to abnormal deposition of copper in the target organs (Dong & Wu, 2012). Variants in the ATP7B gene have been reported in almost all exons. More than 700 variants in ATP7B have been identified, of which single‐nucleotide missense and nonsense mutations is the most common, followed by insertions/deletions and splice site mutations. Most patients are compound heterozygotes, carrying different mutations on each copy of the chromosome. Due to the diverse clinical manifestations of WD, it can sometimes be difficult to diagnose. We conducted a molecular analysis of 14 probands and 12 family members and identified six novel variants in the ATP7B gene.

PATIENTS AND METHODS

Fourteen probands (three males and 11 females, age from 4 to 43 years old), who presented with hepatic symptoms and decreased ceruloplasmin (<200 mg/L, normal 200–400 mg/L), were diagnosed with WD from 2012 to 2015 in the YouAn Hospital of Capital Medical University. All probands had at least four points according to the WD scoring system (European Association for the Study of the Liver, 2012). Additionally, 11 parents and one sibling of the 14 probands were recruited for the study. They were of the Han ethnicity from North China. Written informed consent was obtained from the participants or their guardians before the genetic investigation was conducted. The Ethics Committee of the Beijing YouAn Hospital of Capital Medical University approved the present work. This study protocol conformed to the ethical guidelines of the Declaration of Helsinki. The ATP7B gene was analyzed by direct sequencing using genomic DNA extracted from leukocytes in peripheral blood (QIAGEN, Germany). The Primers used for PCR assay were showed in Table 1. The amplified products were detected by agarose gel electrophoresis and sequenced using an ABI3730 DNA Analyzer (Applied Biosystems, USA). The pathogenicity of the genetic variants was ascertained using the WD allelic variant database (http://www.wilsondisease.med.ualberta.ca/database.asp).
Table 1

Primers used for PCR assay of ATP7B gene exons and promoters

PrimerSequencesFragment size (BP)
ATP7B‐1FAGCCCTGGGAGCTGAGTCT781
ATP7B‐1RAAACATCAGTTGACGGCACA 
ATP7B‐2AFTCATTTTGTAGATGCTGCCT829
ATP7B‐2ARAAGGTCTCTTTGGGTTAGTG 
ATP7B‐2BFTCAGGGACCATGTAAATGAC836
ATP7B‐2BRCAAGGAAAGTTTGCAGGATT 
ATP7B‐3FGATGGCTGAGGGACAAGGTA583
ATP7B‐3RCACAATGCCAGTTATACAAGGA 
ATP7B‐4FTGTTCTAGAGGATTCTGGGAAGA394
ATP7B‐4RCCCAACAACAACAAACCAGA 
ATP7B‐5FAGGAGGGAAAGGCTCTTGG396
ATP7B‐5RTCCATGGGAAAAGTTGAAGAA 
ATP7B‐6FAGCTGTCTTCCCAGAAGTGC400
ATP7B‐6RGCAGCTAATCCAGGAGGAAG 
ATP7B‐7FTGTAATCCAGGTGACAAGCAG277
ATP7B‐7RCACAGCATGGAAGGGAGAG 
ATP7B‐8FCTACTTGCTGGCAGCCTTCACTG308
ATP7B‐8RGGAGCAGCTCTTTTCTGAACCTG 
ATP7B‐9FCCTGCAGAGCCTTTTATCGT344
ATP7B‐9RTCTCTGCCCACACTCACAAG 
ATP7B‐10FTCAGCAGCTGCACGATAAAT398
ATP7B‐10RTCCTAGACGTAGGAAAGAGACAA 
ATP7B‐11FGGGCTGAGCAAGTGACAGTTG272
ATP7B‐11RTGT CTG ATTT CCC AGAA CTCT 
ATP7B‐12FTCATAGGTTGTAATTTCCCATG245
ATP7B‐12RCAGG ATCAA TGT CAG TAGA TTAT 
ATP7B‐13FGAACCCAAGTTCGTCACGTT485
ATP7B‐13RGACTGGTGGCTACTCTGTTGC 
ATP7B‐14FAGTTCTGCCTCAGGAGTGTGAC338
ATP7B‐14RCAG CTA GGAG AGA A GG ACA TGG 
ATP7B‐15FCTTTCACTTCACCCCTCT254
ATP7B‐15RCAGCTGCAGAGACAAAAGC 
ATP7B‐16FGTTCACAGTGAAATTGGACC242
ATP7B‐16RACTGTATTT CTG AGAGAG CG 
ATP7B‐17FTTTTGTGTACATCCGTAAATGC399
ATP7B‐17RGGGCCAACTGGTGCTTACT 
ATP7B‐18FGTAACTTGAGGTTTCTGCTG368
ATP7B‐18RAGCAAATCATTCTGATGGAG 
ATP7B‐19FGACATGGGTGTGGCCATT374
ATP7B‐19RCCTCTAGCCAGCCAGTGAGT 
ATP7B‐20FCTGTGGGCAAGATCCATTG380
ATP7B‐20RTGCCACTGCAGCATTTGT 
ATP7B‐21FTCCTTTTCCTTGGAAACTCTTG500
ATP7B‐21RCTAGCTCAGCCCATCCTGCT 

F: forward, R: reversed, BP: base pairs.

Primers used for PCR assay of ATP7B gene exons and promoters F: forward, R: reversed, BP: base pairs.

RESULTS

By direct sequence analysis of the entire ATP7B gene coding and promoter regions, we identified 29 different variants. (27 substitutions, one duplication, one deletion). Of these 29 variants, six were novel variants and 23 reported variants previously (Table 2). The variants occurred most frequently in exons 8, 13, 16, and 18. No variants were found in exon 1, 4, 7, 9, and 19. Among the 23 reported mutations, we found nine nondiseased‐variants (NDV), 11 diseased‐variants (DV), one silent‐variant, and two uncertain function variants (DV or NDV) according the WD allelic variant database (http://www.wilsondisease.med.ualberta.ca/database.asp). The variants were classified into benign, likely benign, uncertain significance, likely pathogenic and pathogenic based on ACMG/AMP 2015 guideline (Richards et al., 2015) (http://wintervar.wglab.org/). The most frequent variants were c.2855A>G, c.3419C>T, and c.3903+6T>C, which were NDV. For 11 DVs, the most frequent was c.2333G>T, followed by c.2304dupC, c.2621C>T, c.588C>A, c.1708‐5T>G, c.2827G>A, c.2975C>T, c.3053C>T, c.3646G>A, c.A3809A>G, and c.4114C>T. 1 silent‐variant is c.2310C>G. 2 controversial variants (DV or NDV) are c.3316G>A and c.3443T>C.
Table 2

The 29 variants identified in the 14 probands with WD

 Variant name (nucleotide)Nucleotide sequenceVariant typeAmino acid changResult of changeArea of proteinReported statusClassificationNo. of allelesAllele frequency (%)
5′c.128C>A Substitution Unknown5UTRNDV 414.3
5′c.75A>C Substitution Unknown5UTRNDV 517.9
Exon2c.588C>AGAC‐GAASubstitutionp.Asp196GluMissenseCu2DVPathogenic13.6
Exon2c.1216T>GTCT‐GCTSubstitutionp.Ser406AlaMissenseCu4NDVPathogenic414.3
Exon3c.1366G>CGTG‐CTGSubstitutionp.Val456LeuMissensebet Cu4/Cu5NDVUncertain621.4
Exon5c.17085T>G Substitution SpliceCu6DV 13.6
Exon6c.1875T>AATT‐ATASubstitutionp.Ile625IleSynonymousCu6Novel 13.6
Exon8c.2304dupCCCCCATGDuplicationp.Met769Hisfs*26TerminationTM4DVPathogenic27.1
Exon8c2306T>CATG‐ACTSubstitutionp.Met769ThrMissenseTM4NovelUncertain13.6
Exon8c.2310C>GCTC‐CTGSubstitutionp.Leu770LeuSynonymousTM4SilLikely Benign725
Exon8c.2333G>TCGG‐CTGSubstitutionp.Arg778LeuMissenseTM4DVLikely Pathogenic621.4
Exon10c.2495A>GAAG‐AGGSubstitutionp.Lys832ArgMissenseTM4/TdNDVUncertain621.4
Exon11c.2621C>TGCG‐GTGSubstitutionp.Ala874ValMissensebet Td/TM5DVPathogenic27.1
Exon12c.2827G>AGGT‐AGTSubstitutionp.Gly943SerMissenseTM5DVPathogenic13.6
Exon12c.2855A>GAAA‐AGASubstitutionp.Lys952ArgMissensebet M5/TM6NDV 1242.9
Exon13c.2975C>TCCC‐CTCSubstitutionp.Pro992LeuMissensebet TM6/PhDVLikely Pathogenic13.6
Exon13c.3028A>GAAG‐GAG,Substitutionp.Lys1010GluMissensebet TM6/PhNovelPathogenic13.6
Exon13c.3053C>TGCG‐GTGSubstitutionp.Ala1018ValMissensebet TM6/PhDVPathogenic13.6
Exon14c3243G>AGAG‐GAASubstitutionp.Gln1081GlnSynonymousATP loopNovel 13.6
Exon15c.3316G>AGTC‐ATCSubstitutionp.Val1106IleMissenseATP loopDV or NDVPathogenic27.1
Exon16c.3419C>TGCC‐GTCSubstitutionp.Val1140AlaMissenseATP loopNDV 1242.9
Exon16c.3437_3438delTGTGCDeletionp.Val1146Ala fs*6FrameshiftATP loopNovelPathogenic13.6
Exon16c.3443T>CATT‐ACTSubstitutionp.Ile1148ThrMissenseATP loopDV or NDVPathogenic13.6
Exon17c.3646G>AGTG‐ATGSubstitutionp.Val1216MetMissenseATP bindDVPathogenic13.6
Exon18c.3809A>GAAT‐AGTSubstitutionp.Asn1270SerMissenseATP hingeDVPathogenic13.6
Exon18c.3889G>AGTC‐ATCSubstitutionp.Val1297IleMissensebet ATP hinge/TM7NDVPathogenic13.6
Exon18c.3903+5A>Ggaatgtg‐gagcgtgSubstitution Splicebet ATP hinge/TM7Novel 13.6
Exon18c.3903+6T>Cgaatgtg‐gagcgtgSubstitution Splicebet ATP hinge/TM7NDV 1139.3
Exon20c.4114C>TCAG‐TAGSubstitutionp.Gln1372TerNonsenseTM8DVPathogenic13.6

Reported status: variants according WD allelic variant database.

Classification: variants into “Benign”, “Likely benign”, “Uncertain significance”, “Likely pathogenic”, and “Pathogenic” based on ACMG/AMP 2015 guideline.

DV: disease variants, NDV: nondisease variants, UTR: untranslated regions, Cu: copper binding domain, TM: transmembrane domain, Ph: phosphorylation loop, bet: between; WD: Wilson's disease.

The 29 variants identified in the 14 probands with WD Reported status: variants according WD allelic variant database. Classification: variants into “Benign”, “Likely benign”, “Uncertain significance”, “Likely pathogenic”, and “Pathogenic” based on ACMG/AMP 2015 guideline. DV: disease variants, NDV: nondisease variants, UTR: untranslated regions, Cu: copper binding domain, TM: transmembrane domain, Ph: phosphorylation loop, bet: between; WD: Wilson's disease. The six novel variants included two synonymous mutations (c.1875T>A and c.3243G>A) and four possible disease variants (DVs) (c.2306T>C, c.3028A>G, c.3437_3438 delTG, and c.3903+5G>A) (Figure 1). The disease variants and novel variants from the 14 probands with WD showed in Table 3.
Figure 1

Chromatograms of six novel ATP7B variants. The lower nucleotide symbols in each frame represents the variant, while the upper one represents the normal sequence. The red arrow shows the variation point. (a) c.1875T>A, (b) c2306T>C, (c) c.3028A>G, (d) c3243G>A, (e) c.3437_3438delTG, (f) c3903+5G>A and reported c.3903+6T>C

Table 3

The disease variants and novel variants from the 14 probands with WD

CaseGenderAgeCER (mg/L)GenotypeFamily Variant 
1F2326Compound heterozygote c.2333G>Tc.2621C>T 
2F645Compound heterozygote c.1875T>Aa c.2333G>Tc.3443T>C
3F421Simple heterozygote c.3809A>G  
4F822Compound heterozygoteAc.3437_3438 delTGa c.4114C>T 
5M43125Compound heterozygoteBc.588C>Ac.2827G>Ac.3316G>A
6F519Compound heterozygoteCc.2333G>Tc.3646G>A 
7F3019Compound heterozygote c.3028A>Ga c.3053C>T 
8F2319Compound heterozygote c17085T>Gc3243G>Aa  
9F721Compound heterozygoteDc.2304dupCc.2975C>T 
10M779Simple heterozygoteEc.2306T>Ca   
11F758Simple heterozygoteFc.2304dupC  
12F1922Simple homozygote c.2333G>T  
13M1622Compound heterozygote c.2621C>T3,903+5G>Aa  
14F931Compound heterozygoteGc.2333G>Tc.3316G>A 

Unmarked: reported disease variants.

CER: ceruloplasmin; WD: Wilson's disease.

Novel.

Chromatograms of six novel ATP7B variants. The lower nucleotide symbols in each frame represents the variant, while the upper one represents the normal sequence. The red arrow shows the variation point. (a) c.1875T>A, (b) c2306T>C, (c) c.3028A>G, (d) c3243G>A, (e) c.3437_3438delTG, (f) c3903+5G>A and reported c.3903+6T>C The disease variants and novel variants from the 14 probands with WD Unmarked: reported disease variants. CER: ceruloplasmin; WD: Wilson's disease. Novel.

DISCUSSION

Mutation hotspots in ATP7B vary by geographic region, with a higher prevalence of specific variants reported in certain populations. The predominant variants in the Chinese population include c.2333G>T (p.Arg778Leu), c.2975C>T (p.Pro992Leu), c.3443T>C (p.Ile1148Thr), and c.2804C>T (p.Thr935Met) (Gu et al., 2003; Wang et al., 2011; Wei et al., 2014). In our study, the most frequently observed DVs were c.2333G>T, c.2304dupC, c.2621C>T, c.588C>A, c.1708‐5T>G, c.2827G>A, c.2975C>T, c.3053C>T, c.3646G>A, c.A3809A>G, and c.4114C>T. The one silent variant was c.2310C>G. The two uncertain variants (DVs or NDVs) were c.3316G>A and c.3443T>C. In our study, we found six novel variants, of which two were synonymous mutations (c.1875T>A and c.3243G>A) and four were possible DVs (c.2306T>C, c.3028A>G, c.3437_3438 delTG, and c.3903+5G>A). The c.2306T>C (ATG‐ACT, p.Met769Thr) mutation was newly found. At the same amino acid position, two mutations (c.2305A>G, ATG‐GTG, p.Met769Val and c.2306T>G, ATG‐AGG, p.Met769Arg) have been reported as DVs. The novel c.2306T>C heterozygous mutation was found in a child proband and his father. This mutation affects Cu transport by creating a conservative amino acid change in Tm4. The c.3028A>G(AAGGAG, p.Lys1010Glu)mutation is regarded as a new DV. At the same amino acid position, three DVs have been verified previously (Santhosh et al., 2008). It is found a compound heterozygote patient carrying c.3028A>G mutation and the known pathogenic variant c.3053C>T. We found a novel variant in exon 16, c.3437_3438 delTG (p.Val1146Ala fs*6). In a previous study, it was found that the c.3436G>A (p.Val1146Met) missense mutation at amino acid position 1146 is a DV (Antonietta et al., 2008). Generally, frameshift and missense mutations are associated with more severe phenotypes of WD. Furthermore, the compound heterozygote proband with the novel variant (c.3437_3438 delTG) and another DV (c.4114C>T, p.Gln1372Ter) was diagnosed with WD. This proband's father had a novel variant, and the proband's mother had another DV (c.4114C>T, p.Gln1372Ter); both were diagnosed as WD carriers because they were simple heterozygotes. Therefore, the novel variant (c.3437_3438 delTG) is likely to be a DV. A novel variant (c.3903+5G>A) was found in exon 18. Similarly, the c.3903+6T>C splice variant is a nondisease variant (NDV) (Gu et al., 2003) and the novel c.3903+5G>A splice variant was speculated to be a NDV. However, in our study, a patient carried the novel variant (c.3903+5G>A), a DV (c.2621C>T), and three NDVs (c.2855A>, c.3419C>T, and c.3903+6C>T). The pathological significance of the novel variant (c.3903+5G>A) requires more study in future. Summary, genetic testing is a valuable tool to detect WD. The results add data to the spectrum of known mutations in the ATP7B gene in Chinese Han population.

CONFLICT OF INTEREST

The authors declared that they have no conflict of interest.
  12 in total

1.  Genotype phenotype correlation in Wilson's disease within families--a report on four south Indian families.

Authors:  S Santhosh; R V Shaji; C E Eapen; V Jayanthi; S Malathi; P Finny; N Thomas; M Chandy; G Kurian; G M Chandy
Journal:  World J Gastroenterol       Date:  2008-08-07       Impact factor: 5.742

2.  Copper binding to the N-terminal metal-binding sites or the CPC motif is not essential for copper-induced trafficking of the human Wilson protein (ATP7B).

Authors:  Michael A Cater; Sharon La Fontaine; Julian F B Mercer
Journal:  Biochem J       Date:  2007-01-01       Impact factor: 3.857

3.  Mutation analysis of 73 southern Chinese Wilson's disease patients: identification of 10 novel mutations and its clinical correlation.

Authors:  Li-Hua Wang; Ye-Qing Huang; Xuan Shang; Quan-Xi Su; Fu Xiong; Qing-Yun Yu; Hui-Ping Lin; Zhi-Sheng Wei; Ming-Fan Hong; Xiang-Min Xu
Journal:  J Hum Genet       Date:  2011-07-28       Impact factor: 3.172

4.  Mapping, cloning and genetic characterization of the region containing the Wilson disease gene.

Authors:  K Petrukhin; S G Fischer; M Pirastu; R E Tanzi; I Chernov; M Devoto; L M Brzustowicz; E Cayanis; E Vitale; J J Russo
Journal:  Nat Genet       Date:  1993-12       Impact factor: 38.330

5.  The Wilson disease gene is a copper transporting ATPase with homology to the Menkes disease gene.

Authors:  R E Tanzi; K Petrukhin; I Chernov; J L Pellequer; W Wasco; B Ross; D M Romano; E Parano; L Pavone; L M Brzustowicz
Journal:  Nat Genet       Date:  1993-12       Impact factor: 38.330

6.  High incidence and allelic homogeneity of Wilson disease in 2 isolated populations: a prerequisite for efficient disease prevention programs.

Authors:  Antonietta Zappu; Olympia Magli; Maria Barbara Lepori; Valentina Dessì; Stefania Diana; Simona Incollu; Emmanuel Kanavakis; Polyxeni Nicolaidou; Nina Manolaki; Andreas Fretzayas; Stefano De Virgiliis; Antonio Cao; Georgios Loudianos
Journal:  J Pediatr Gastroenterol Nutr       Date:  2008-09       Impact factor: 2.839

7.  Mutation spectrum and polymorphisms in ATP7B identified on direct sequencing of all exons in Chinese Han and Hui ethnic patients with Wilson's disease.

Authors:  Y H Gu; H Kodama; S L Du; Q J Gu; H J Sun; H Ushijima
Journal:  Clin Genet       Date:  2003-12       Impact factor: 4.438

8.  Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology.

Authors:  Sue Richards; Nazneen Aziz; Sherri Bale; David Bick; Soma Das; Julie Gastier-Foster; Wayne W Grody; Madhuri Hegde; Elaine Lyon; Elaine Spector; Karl Voelkerding; Heidi L Rehm
Journal:  Genet Med       Date:  2015-03-05       Impact factor: 8.822

9.  Novel mutations found in the ATP7B gene in Chinese patients with Wilson's disease.

Authors:  Zhiling Qian; Xiongwei Cui; Yunli Huang; Yanmin Liu; Ning Li; Sujun Zheng; Jun Jiang; Shichang Cui
Journal:  Mol Genet Genomic Med       Date:  2019-03-18       Impact factor: 2.183

10.  Advance in the pathogenesis and treatment of Wilson disease.

Authors:  Qin-Yun Dong; Zhi-Ying Wu
Journal:  Transl Neurodegener       Date:  2012-11-27       Impact factor: 8.014

View more
  2 in total

1.  Novel mutations found in the ATP7B gene in Chinese patients with Wilson's disease.

Authors:  Zhiling Qian; Xiongwei Cui; Yunli Huang; Yanmin Liu; Ning Li; Sujun Zheng; Jun Jiang; Shichang Cui
Journal:  Mol Genet Genomic Med       Date:  2019-03-18       Impact factor: 2.183

2.  A Comprehensive Analysis and Splicing Characterization of Naturally Occurring Synonymous Variants in the ATP7B Gene.

Authors:  Xiaoying Zhou; Wei Zhou; Chunli Wang; Lan Wang; Yu Jin; Zhanjun Jia; Zhifeng Liu; Bixia Zheng
Journal:  Front Genet       Date:  2021-02-25       Impact factor: 4.599

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.