Literature DB >> 30809310

RACK1 Promotes Self-Renewal and Chemoresistance of Cancer Stem Cells in Human Hepatocellular Carcinoma through Stabilizing Nanog.

Junxia Cao1, Min Zhao1,2, Jian Liu1,2, Xueying Zhang1, Yujun Pei1, Jingyang Wang1, Xiao Yang3, Beifen Shen1,2, Jiyan Zhang1,2.   

Abstract

Targeting cancer stem cells (CSCs) has been proposed as a new strategy to eradicate malignancies, including hepatocellular carcinoma (HCC). However, the mechanisms by which CSCs sustain their self-renewal and chemoresistance remain elusive. Nanog is a master transcriptional regulator of stemness, especially in CSCs. Its expression is tightly regulated by the ubiquitin-proteasome system in embryonic stem cells (ESCs). Whether the suppression of Nanog ubiquitination contributes to its over-expression in CSCs has not been explored. In addition, the role of receptor for activated C kinase 1 (RACK1), an adaptor protein implicated in HCC growth, in liver CSC-like traits remains to be determined.
Methods: In vitro and in vivo assays were performed to investigate the role of RACK1 in liver CSC-like phenotype and murine ESC function. How RACK1 regulates Nanog expression was explored by immunoblotting and immunohistochemistry. The interaction of RACK1 with Nanog and the consequent effects on Nanog ubiquitination and stemness were then analyzed.
Results: RACK1 promotes self-renewal and chemoresistance of human liver CSCs and maintains murine ESC function. Consistently, RACK1 enhances the expression of Nanog in human HCC cells and murine ESCs. The protein levels of RACK1 in clinical HCC tissues positively correlate with those of Nanog. Further exploration indicates that RACK1 directly binds to Nanog, which prevents its recruitment of E3 ubiquitin ligase FBXW8 and ubiquitin-dependent degradation. The interaction with Nanog is essential for RACK1 to promote stemness. Conclusions: Our data provide novel insights into the regulation of Nanog protein levels, as well the key role of RACK1 to enhance self-renewal and chemoresistance of CSCs in human HCC.

Entities:  

Keywords:  CSCs; ESCs; Nanog; RACK1; ubiquitination

Mesh:

Substances:

Year:  2019        PMID: 30809310      PMCID: PMC6376462          DOI: 10.7150/thno.29271

Source DB:  PubMed          Journal:  Theranostics        ISSN: 1838-7640            Impact factor:   11.556


Introduction

Hepatocellular carcinoma (HCC) is the third leading cause of cancer death worldwide, particularly in the Asia-Pacific region and Africa 1. The high rate of recurrence and heterogeneity are the two major features of HCC 2. The concept that tumor arises from a subpopulation of stem-like cells, usually named as cancer stem cells (CSCs) or tumor-initiating cells, accounts for intratumoral heterogeneity 3-6. Several defined surface markers have been used for the enrichment of CSCs in HCC 7-10. CSCs have high capability of self-renewal and drug-resistance and, consequently, contribute to tumorigenesis and recurrence. Therefore, targeting CSCs has been proposed as a new strategy to eradicate malignancies, including HCC 3-6. Despite that, the mechanisms by which CSCs sustain their self-renewal and chemoresistance remain largely unknown. A small inhibitor of several tyrosine kinases, sorafenib, is the most commonly used monotherapy agent for the treatment of HCC 11. However, intrinsic or acquired resistance to sorafenib frequently occurs 11. Sorafenib resistance is positively correlated with stemness-related genes, especially Nanog 12-16. Nanog knockdown renders HCC cells sensitive to sorafenib 16. Various microRNAs, transcription factors, and kinases have been revealed to modulate the phenotype of CSCs through mediating the over-expression or silencing of Nanog 3-6. Therefore, Nanog has been proposed as a central regulator of CSCs 3-6. While the transcription and epigenetic regulation of Nanog gene have been extensively explored, comparatively little is known about the post-transcriptional regulation of Nanog. In embryonic stem cells (ESCs), Nanog is tightly regulated by the ubiquitin-proteasome system (UPS) through a PEST motif that lies in the N-terminal region 17,18. F-box protein FBXW8 and deubiquitinase USP21 have been suggested to be the ubiquitin E3 ligase and the deubiquitinating enzyme that govern Nanog stability in ESCs, respectively 19-22. Furthermore, the phosphorylation of Nanog at Ser/Thr-Pro motifs facilitates its physical interaction with the prolyl isomerase Pin1 in ESCs and, hence, stabilizes Nanog by preventing its degradation through the UPS 18,23. However, it remains unknown whether the suppression of Nanog ubiquitination contributes to its over-expression in CSCs. Receptor for activated C kinase 1 (RACK1) was originally identified on the basis of its ability to anchor activated form of protein kinase C (PKC). As a member of the Trp-Asp (WD) repeat protein family, it has been recognized as an adaptor protein involved in multiple intracellular signaling pathways. Elevated levels of RACK1 mRNA 24,25 or protein 26,27 have been observed by different groups in clinical HCC samples. RACK1 expression is well correlated with the clinical stage as well as the poor prognosis 26,27. Over-expressed RACK1 augments the activity of c-Jun N-terminal protein kinase (JNK) and thus promotes HCC growth through directly binding to JNK specific upstream kinase MKK7 and enhancing its activity 26. Moreover, ribosomal RACK1 couples with PKCβII to promote the phosphorylation of eukaryotic initiation factor 4E (eIF4E), which leads to preferential translation of the potent factors involved in growth and survival 27. However, the role of RACK1 in liver CSC-like traits remains to be determined. In this work, we show that RACK1 directly binds to Nanog and thus reduces its ubiquitination, which contributes to the self-renewal and chemoresistance of CSCs in human HCC.

Methods

Plasmids, small-interfering RNAs (siRNAs), and short hairpin RNAs (shRNAs)

7Gli:GFP was a gift from Michael Lewis (Addgene plasmid #110494) 28. Nanog reporter was kindly provided by Dr. Ping Wang 29. pcDNA3.1 (+) vector, pEGFP-N1 vector, and pGEX-KG vector were used to construct the other mammalian or prokaryotic expression vectors. PCR-amplified products were cloned into these vectors and confirmed by DNA sequencing. Human RACK1 siRNA (ACCAGGGATGAGACCAACT), human MKK7 siRNA (CGCTCCGGGAACAAGGAGG), human FBXW8 siRNA (GCCTTTCTTTGATATCCAA), and the non-targeting control (NC) siRNA were purchased from Shanghai GenePharma (Shanghai, China). Lentivirus-based human RACK1 shRNA (GGATGAGACCAACTATGGAAT), murine RACK1 shRNAs (1#: GTCCCGAGACAAGACCATAAA, 2#: CCCACTTCGTTAGTGATGTTG), and NC shRNA were ordered from Shanghai GeneChem (Shanghai, China). Another set of lentivirus-based human RACK1 shRNA (RACK1-b) and control lentivirus were ordered from Santa Cruz Biotechnology (Santa Cruz, CA, USA, Cat. No. sc-36354-v). Lentivirus-based Nanog expression vector driven by EF1α promoter and control lentivirus were purchased from Cellomic Technology (Halethorpe, MD, USA, Cat. No. PLV-10075-50).

Cell culture, transfection, and transduction

Human HCC cell lines used in this study have been described previously 26 and were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS; HyClone, Logan, UT, USA, Cat. No. SH30070.03), 100 U/ml penicillin, and 100 μg/mL streptomycin. Murine ESCs were grown on feeder layers of γ-irradiated murine embryonic fibroblasts in DMEM supplemented with 15% FBS, 2 mM Glutamine (Hyclone, Cat. No. SH30034.01), 0.1 mM nonessential amino acids (Hyclone, Cat. No. SH3238.01), 0.1 mM β-mercaptoethanol, 100 U/ml penicillin, and 100 μg/ml streptomycin and passaged every 3 days 30. Transfection was performed with Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA, Cat. No. 52887). Transduction was performed with lentivirus (multiplicity of infection=10). Stable clones were selected in 600 μg/mL neomycin (Invitrogen, Cat. No. 10131027) or 1 μg/mL puromycin (Sigma-Aldrich, St. Louis, MO, USA, Cat. No. P8833) for approximately 2 months.

Flow cytometry analysis

After HCC cells were digested with trypsin, single-cell suspensions were stained with PE-conjugated CD13 antibody (BD Biosciences, Bedford, MA, USA, Cat. No. 555394) or APC-conjugated CD133 antibody (Miltenyi Biotech, Bergisch Gladbach, Germany, Cat. No. 130-113-668) in PBS containing 0.1% sodium azide and 2% FBS for 30 min on ice in the dark. Samples were washed once in staining buffer. Then, the cells were fixed with 1% (w/v) paraformaldehyde in PBS and preserved at 4 ºC. An isotype antibody was included as negative control. For apoptosis analysis, cells were stained with anti-CD13-PE and Annexin V-FITC (BioLegend, San Diego, CA, USA, Cat. No. 640906) or Annexin V-APC (BioLegend, Cat. No. 640920) resuspended in 300 μL binding buffer containing calcium ion for 30 min on ice in the dark. Samples were washed once in binding buffer. Apoptosis was immediately assessed by flow-cytometric analysis of Annexin-V staining in CD13+ cells. Flow cytometry was performed on a FACSCalibur machine (BD Biosciences).

Sphere formation assays

HCC cells stained with PE-conjugated CD13 antibody were sorted using a FACSVantage (BD Biosciences) and plated into ultra-low attached 96-well plates. Each well was seeded with 100 cells. Cells were cultured in DMEM/F12 media (Invitrogen, Cat. No. 88215) supplemented with B27 (Invitrogen, Cat. No. 12587010), 20 ng/mL epidermal growth factor (PeproTech, Rocky Hill, USA, Cat. No. 37000015), 20 ng/mL of basic fibroblast growth factor (PeproTech, Cat. No. 100-18B), 10 ng/mL hepatocyte growth factor (PeproTech, Cat. No. 100-39). Next, 1% methyl cellulose (Sigma, Cat. No. M7027) was added to prevent cell aggregation, and individual sphere derived from a single cell was confirmed. After 4-5 days, equal fresh media was added. Cells were incubated for 10-14 days and spheres with a diameter of more than 75 μm were counted. Sphere formation ability was calculated as the number of spheres divided by the initial seeding cell number × 100%. For serial passaging, spheres were harvested and dissociated into single cells with trypsin.

Alkaline phosphatase (AP) activity analysis

Single-cell suspensions (1×105/sample) of murine ESCs were subjected to alkaline phosphatase activity analysis with an alkaline phosphatase assay kit (Abcam, Eugene, OR, USA, Cat. No. ab83369) according to the manufacturer's protocol. Measurement was taken at OD405 on a microplate reader.

Immunohistochemistry

Formaldehyde-fixed and paraffin-embedded clinical HCC samples were examined for Nanog (Abcam, Cat. No. ab109250) and RACK1 (BD Bioscience, Cat. No. 610178) staining on tissue microarray slides obtained from US Biomax (see detailed clinicopathological features in Table ). Patients' consent and approval by the local ethics committee were obtained for the use of the clinical materials in research. Immunohistochemistry was performed using standard protocols with citrate buffer (pH 6.0) pretreatment. Briefly, the sections were incubated with primary antibodies at 4 °C overnight and then with horseradish peroxidase-conjugated secondary antibodies at 37 °C for 30 min. The sections were finally incubated with diaminobenzidine and counterstained with hematoxylin for detection. Staining was assessed by pathologists blinded to the origination of the samples and subject outcome. Each specimen was assigned a score according to the intensity of the staining (no staining = 0; weak staining = 1, moderate staining = 2, strong staining = 3) and the extent of stained cells (0% = 0, 1-24% = 1, 25-49% = 2, 50-74% = 3, 75-100% = 4). The final immunoreactive score was determined by multiplying the intensity score with the extent of score of stained cells, ranging from 0 (the minimum score) to 12 (the maximum score). Fluorescent multiplex immunohistochemistry (mIHC) with tyramide signal amplification was performed with an Opal 7-Color Manual IHC kit ordered from PerkinElmer (Akron, OH, USA, Cat. No. NEL811001KT) according to the manufacturer's protocol. The aforementioned primary antibodies and secondary antibodies were used. Antibodies against CD13 (Cat. No. 66211-1-Ig) and AFP (Cat. No. 14550-1-Ap) were ordered from Proteintech (Chicago, IL, USA).

In vivo tumorigenicity experiments

Male nonobese diabetic/severe combined immunodeficient (NOD/SCID) mice were purchased from Institutes of Experimental Animals, Academy of Chinese Medical Sciences (Beijing, China) and maintained under specific-pathogen-free conditions. All experiments were performed in accordance with institutional guidelines for animal care. 5,000 or 500 CD13+ HuH7 cells were suspended in 100 μL of DMEM and Matrigel (1:1) (BD Biosciences, Cat. No. 356234) and injected subcutaneously into six-to-eight-week-old NOD/SCID mice. Mice were sacrificed for evaluation of tumor incidence and tumor weight 5 or 7 weeks later.

Glutathione S-transferase (GST) pull-down assays

GST or GST-RACK1 were expressed and purified as previously described 26. Lysates of HuH7 cells were incubated with GST or GST-RACK1 bound to glutathione-Sepharose beads (Amersham Pharmacia, Pittsburgh, PA, USA, Cat. No. 17-0756-01), and the adsorbed proteins were analyzed by immunoblotting analysis.

Coimmunoprecipitation (Co-IP) and immunoblotting (IB)

Cells were homogenized in RIPA buffer (50 mM Tris-HCl, pH 7.5, 1% NP40, 0.35% DOC, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, supplemented with protease and phosphatase inhibitor cocktail) or IP lysis buffer (10 mM Tris-HCl, pH 7.5, 2 mM EDTA, 1% NP40, 150 mM NaCl, supplemented with protease and phosphates inhibitor cocktail). Nuclear cytoplasmic fractionation, coimmunoprecipitation, and immunoblotting analysis were performed as previously described 31-33. Antibodies against Nanog (Cat. No. 4903 and 8822, for IB), Phospho-JNK (Thr183/Tyr185, Cat. No. 4671), Phospho-Akt (Ser473, Cat. No. 4060), Akt (Cat. No. 4691), and MKK7 (Cat. No. 4172) were purchased from Cell Signaling Technology (Danvers, MA, USA). Antibodies against RACK1 (Cat. No. sc-10775, for IP), Nanog (Cat. No. sc-293121, for IP), β-catenin (Cat. No. sc-7963), c-Myc (Cat. No. sc-40), USP21 (Cat. No. sc-79305), and actin (Cat. No. sc-7210) were from Santa Cruz Biotechnology. Antibody against RACK1 (Cat. No. 610178, for IB) was from BD Bioscience. CGP53353 (Cat. No. C7866), cycloheximide (Cat. No. C7698), MG132 (Cat. No. M8699), and antibody against FLAG (M2, Cat. No. F1804) were from Sigma-Aldrich. Antibodies against Myc-tag (Cat. No. M192-3) and GFP (Cat. No. 598) were from MBL International (Woburn, MA, USA). Antibodies against Oct4 (Cat. No. ab19857) and Sox2 (Cat. No. ab97959) were purchased from Abcam. Antibody against Pin 1 (Cat. No. AM2212b-ev) was from Abgent (San Diego, CA, USA). Antibody against FBXW8 (Cat. No. abs127583) was from Absin (Shanghai, China).

In vivo ubiquitination assays

Cells were solubilized in a modified lysis buffer (50 mM Tris-Cl, pH 7.4, 150 mM NaCl, 10% glycerol, 1 mM EDTA, 1 mM EGTA, 1% SDS, 1 mM Na3VO4, 1 mM DTT, and 10 mM NaF) supplemented with protease inhibitor cocktail (Roche Diagnostics). After incubation at 60 ºC for 10 min, the cell lysates were 10 times diluted with the same modified lysis buffer without SDS. Next, immunoprecipitation was performed with an antibody against FLAG, GFP, or Nanog, followed by immunoblotting.

Indirect immunofluorescence analysis

HuH7 cells, grown on cover slides, were washed twice in PBS, fixed with 4% (w/v) paraformaldehyde in PBS for 10 min at room temperature, and then permeabilized with 0.5% Triton X-100 in PBS for 15 min. The nonspecific sites were blocked by incubation with 1% bovine serum albumin in PBS for 30 min at room temperature. Cells were then rinsed in PBS containing 0.05% Tween 20 for 5 min and incubated with an anti-Nanog antibody (Cell Signaling Technology, Cat. No. 4903) and an anti-RACK1 antibody (BD Bioscience, Cat. No. 610178) diluted in blocking buffer for 1 h at room temperature or overnight at 4 °C. After being washed for three times in PBS containing 0.05% Tween 20, the cells were incubated with TRITC-conjugated goat anti-rabbit IgG and FITC-conjugated goat anti-mouse IgG for 45 min at room temperature. The cells were washed again as stated above, incubated with 1 μg/mL 4′,6-diamidine-2-phenylindole, and then observed under a laser scanning confocal microscopy (RADIANCE 2100; Bio-Rad).

Quantitative real-time reverse-transcriptase polymerase chain reaction (qRT-PCR)

RNA was extracted by using TRIzol reagent. cDNA was derived from 1 μg total RNA by reverse transcription using Moloney murine leukemia virus reverse transcriptase and oligo(dT) primer in ReverTra Ace® qPCR RT kit (TOYOBO Life Sciences, Osaka, Japan, Cat. No. FSK-101). Quantitative PCR was performed with SYBR Green Realtime PCR Master Mix (TOYOBO Life Sciences, Cat. No. QPK-201) in a CFX96 Real-Time System (BIO-RAD). For all assays, PCR reaction conditions were 94 °C for 30 s, followed by 40 cycles of amplification (94 ˚C for 5 s, 60 ˚C for 30 s and 72 ˚C for 30 s). GAPDH mRNA was used to normalize RNA inputs. Primers for human multidrug resistance protein 1 (MDR1) were: 5'-CCCATCATTGCAATAGCAGG-3' (forward) and 5'-GTTCAAACTTCTGCTCCTGA-3' (reverse), for human multidrug resistance-associated protein 1 (MRP1) were: 5'-GAAGGACTTCGTGTCAGCC-3' (forward) and 5'-GTCCATGATGGTGTTGAGCC-3' (reverse), for human lung resistance protein (LRP) were: 5'-GGATGTCAAGACCGGAAAGGT-3' (forward) and 5'-TCTTTCTCCCACGGACTTCGT-3' (reverse), for human Nanog were: 5'-TGAACCTCAGCTACAAACAG-3' (forward) and 5'- TGGTGGTAGGAAGAGTAAAG-3' (reverse), and for human GAPDH were: 5'-ACCCACTCCTCCACCTTTGA-3' (forward) and 5'-TCCACCACCCTGTTGCTGTA-3' (reverse).

Migration

10,000 CD13+ or CD13- HCC cells were resuspended in 100 μL serum-free media and seeded onto the inside of a transwell chamber (8.0 μm pore size, Costar Inc., Corning, NY, USA, Cat. No. 3422). A 900-μL DMEM medium with 20% FBS and 10 μg/mL mitomycin C (Sigma-Aldrich, Cat. No. M0503) was added to bottom chamber of each well. After 24 h, the non-migrating cells were removed with cotton buds and the lower cells were fixed with methanol and stained with Giemsa dye.

Reporter assays

For Nanog reporter, HuH7 cells were transfected with the firefly luciferase reporter and the renilla luciferase vector. After 36 h, cells were harvested in lysis buffer (25 mM Tris-Cl (pH7.8), 25 mM DTT, 2 mM 1,2-diaminocyclo-hoxane N,N,N,N'-tetracetic acid, 10% glycerol, 1% Triton X-100), and luciferase assays were performed using the dual-luciferase reporter assay system (Promega, Madison, WI, USA, Cat. No. E1910). For Hedgehog signaling activity, HCC cells were transfected with the 7Gli-GFP reporter. 36 h later, the percentages of GFP+ cells were measured by flow cytometry.

Statistical analysis

Differences between variables were assessed by Spearman, Wilcoxon rank-sum test, Kruskal-Wallis Test, or 2-tailed Student's t-test. Statistical calculations were performed using SPSS 13.0 (SPSS Inc., Chicago, IL, USA). P values of less than 0.05 were considered statistically significant.

Results

RACK1 promotes self-renewal and chemoresistance of human liver CSCs and maintains murine ESC function

Recent evidence indicates hepatic CSCs at the single-cell level are phenotypically, functionally, and transcriptomically heterogeneous 34. Therefore, the identification and definition of liver cancer stem cells requires both immunophenotypic and functional properties. CD13 has been used by independent groups as a human liver CSC surface marker 7,35-39. We observed that CD13+ subpopulation in either HuH7 or SMMC-7721 human HCC cell line showed much higher capacity of sphere formation (Figure ), sorafenib resistance (Figure ), and migration (Figure ) than CD13- counterpart. When CD13+ HCC cells were cultivated in 10% serum-supplemented medium, the proportion of CD13+ cells significantly reduced after 10 days (Figure ). These data suggest that CD13+ cells could differentiate to CD13- cells in conventional culture conditions. Since it has been reported that CSCs show preferential overexpression of ESC-specific pluripotency transcription factors Nanog, Oct4, and Sox2 5,12,40, it is possible these proteins are enriched in CD13+ subpopulations. Immunoblotting analysis confirmed this hypothesis (Figure ), supporting the notion that CD13 is a marker for CSCs in HCC. In addition, CD133 is another well-characterized surface marker for “CSCs” derived from both HCC lines and patients' samples of HCC 10,41,42. Flow cytometry revealed that CD133 exhibited certain enrichment in CD13+ subpopulations (Figure ). Therefore, we identify CD13+ cells as hepatic CSCs in this study. As expected, RACK1 protein showed enrichment in CD13+ HCC cells as compared with their CD13- counterparts (Figure ). In this scenario, we set out to analyze the effects of RACK1 loss-of-function or gain-of-function on the self-renewal and chemoresistance of human liver CSCs. Efficient knockdown of RACK1 with lentivirus carrying RACK1 shRNA in these two cell lines (Figure and Figure ) led to shrinkage of the CD13+ (Figure and Figure ) and CD13+CD133+ (Figure ) cell pools. Remnant CD13+ cells in RACK1 shRNA group exhibited reduced RACK1 expression, albeit still slightly higher than CD13- cells in NC shRNA group (Figure ), which was associated with impaired sphere formation (Figure and Figure ), diminished tumorigenicity (Figure ), increased sensitivity to the therapeutic agents, etoposide and sorafenib (Figure and Figure ), and decreased expression of drug-resistant relative genes MDR1, MRP1, and LRP (Figure ). Next, HuH7 single clone, stably expressing FLAG-RACK1, and the mock control were generated (Figure ). Flow cytometry revealed that RACK1 over-expression led to expansion of the CD13+ and CD13+CD133+ cell pools (Figure ). As expected, CD13+ cells in FLAG-RACK1 group expressed exogenous RACK1 protein (Figure ). As for self-renewal capacity, RACK1 over-expression resulted in increased numbers of primary and serially passaged spheroids in CD13+ HuH7 cells (Figure ), which was associated with augmented tumorigenicity (Figure and Figure ). RACK1 over-expression also led to increased resistance to the therapeutic agents, etoposide and sorafenib in CD13+ HuH7 cells (Figure ), which might be due to increased expression of drug-resistant relative genes MDR1 and LRP (Figure ). Our aforementioned data suggest that RACK1 be implicated in the regulation of stemness. Thus, it is reasonable to hypothesis that RACK1 might affect ESC function. Indeed, RACK1 knockdown in murine ESCs (Figure ) led to impaired ability to form colonies (Figure ) with marginal effect on ESC survival (Figure ), which was associated with reduced alkaline phosphatase activity (Figure ).

Enhancement of Nanog expression by RACK1 in human HCC cells and murine ESCs

The pro-tumorigenic effects of RACK1 in human HCC have been attributed to its ability to augment the activity of MKK7 or PKCβII 26,27. Indeed, immunoblotting analysis revealed slight enrichment of phosphorylated JNK (indicating MKK7 activity) and significant enrichment of c-Myc (indicating PKCβII activity) in CD13+ HCC cells (Figure ). We explored whether these two pathways contribute to RACK1-mediated stemness of HCC cells. While silencing of endogenous RACK1 expression by RACK1 siRNA in HuH7 cells led to shrinkage of the CD13+ cell pool and impaired sphere formation by the remnant CD13+ cells, MKK7 knockdown did not affect the proportion of CD13+ cells and only slightly hindered sorted CD13+ cells to form spheres under the same conditions (Figure ). Selective PKCβII inhibitor CGP53353 exhibited the same effects (Figure ). Furthermore, CGP53353 failed to inhibit the expression of drug-resistant relative genes MDR1, MRP1, and LRP (Figure ), though RACK1/ PKCβII axis has been implicated in chemoresistance 27. Instead, CGP53353 enhanced MDR1 expression (Figure ). In addition, RACK1 has been demonstrated to promote β-catenin degradation in gastric cancer and activates sonic hedgehog signaling pathway in non-small-cell lung cancer 43,44. Therefore, it is of interest to explore whether these CSC-related signaling pathways are regulated by RACK1. However, the protein level of β-catenin in HuH7 cells remained unchanged upon RACK1 knockdown or overexpression (Figure ). On the other hand, RACK1 knockdown partially suppressed and RACK1 overexpression partially enhanced the transcriptional activity of hedgehog downstream effector Gli1 in HuH7 cells (Figure ). Despite that, the effects were relatively weak and cannot fully explain RACK1-mediated stemness of HCC cells. In this scenario, we turned to examine whether the expression of pluripotency transcription factors Nanog, Oct4, and Sox2 is regulated by RACK1 since these proteins are coupled with RACK1 in CD13+ HCC cells (Figure ). Immunoblotting analysis revealed silencing of endogenous RACK1 expression in HuH7 cells with two RACK1 shRNAs targeting different sequences led to decreased protein levels of Nanog, but not Oct4 and Sox2 (Figure ). On the other hand, stable ectopic expression of FLAG-RACK1 in HuH7 cells resulted in opposite effects (Figure ). As for the possible correlation with CSC surface marker(s), remnant CD13+ cells in RACK1 shRNA group exhibited reduced Nanog expression, even though still higher than CD13- cells in NC shRNA group (Figure ), whereas stable ectopic expression of FLAG-RACK1 further enhanced Nanog expression in CD13+ cells (Figure ). These data help explain why the same number of CD13+ sorted cells from different groups display different ability of self-renewal and drug resistance. The reduced levels of Nanog protein upon RACK1 knockdown were also observed in SMMC-7721, BEL-7404, Hep3B, and HCCLM3 human HCC cells (Figure ). In addition, RACK1 knockdown resulted in reduced protein level of RACK1 in murine ESCs (Figure ). We also examined the levels of Nanog protein upon silencing of endogenous MKK7 expression or treatment with selective PKCβII inhibitor CGP53353 27. As expected, silencing of endogenous RACK1 expression by RACK1 siRNA led to reduced Nanog expression, whereas MKK7 knockdown showed no effect under the same conditions (Figure ). Furthermore, administration of selective PKCβII inhibitor CGP53353 failed to inhibit Nanog expression (Figure ). By contrast, it enhanced the levels of Nanog protein in a dose-dependent manner, even though c-Myc expression was abolished under the same conditions (Figure ). In addition, RACK1 knockdown led to reduced Akt phosphorylation at Ser473 (Figure ), which indicates Akt activity, as reported previously 45,46. As Akt activity contributes to Nanog expression under certain circumstances 47, it is of interest to test whether RACK1 augments Nanog expression via enhancing Akt activity. For this purpose, we used a mammalian expression vector encoding constitutively activated Akt, Myr-Akt 48. However, Myr-Akt expression failed to rescue the reduction of Nanog expression upon RACK1 knockdown (Figure ). Therefore, novel mechanism(s) might be implicated in the enhancement of Nanog expression by RACK1.

The correlation between RACK1 and Nanog expression in clinical HCC tissues

The protein levels of RACK1 and Nanog in clinical HCC tissues were analyzed by immunohistochemical staining on tissue microarray slides. RACK1 protein was mainly localized in the cytoplasm, whereas Nanog protein exhibited nuclear accumulation with a considerable portion distributed in the cytoplasm (Figure ). Consistent with previous observations 26,27, clinical HCC tissues exhibited elevated RACK1 expression than peritumoral liver tissues (Figure and Table ). The levels of RACK1 protein in the 136 HCC tissues were associated with the tumor size and the clinical stage (Table ). As expected, clinical HCC tissues also exhibited elevated Nanog expression than peritumoral liver tissues (Figure and Table ). The levels of Nanog in the 136 HCC tissues were associated with the pathological grade (Table ). More importantly, the protein levels of RACK1 in clinical HCC tissues positively correlated with those of Nanog (Figure ). Furthermore, fluorescent multiplex immunohistochemistry (mIHC) with tyramide signal amplification revealed good correlation of RACK1 and Nanog with CD13 in clinical HCC tissues (Figure ). Because CD13 was reported to be expressed widely in many normal tissues, including fibroblast, blood cells and epithelium, etc. 49, we employed AFP as a HCC specific marker. As expected, mIHC indicated that RACK1, Nanog, and CD13 were indeed highly expressed in human HCC (Figure ).

RACK1 augments Nanog stability through the ubiquitin-proteasome system

Because the levels of Nanog mRNA were not consistent with those of Nanog protein upon changes in the RACK1 levels (Figure ), adaptor protein RACK1 might enhance the stability of Nanog. The impact of RACK1 knockdown or over-expression on the stability of Nanog was directly measured by treating human HCC cells with cycloheximide (CHX), which blocks de novo protein synthesis 50. As expected, silencing of endogenous RACK1 expression shortened the half-life of Nanog protein (Figure ) whereas stable ectopic expression of FLAG-RACK1 extended the half-life in HuH7 cells (Figure ). By contrast, RACK1 showed no effect on the half-life of Oct4 and Sox2 (Figure ). Moreover, RACK1 knockdown reduced the levels of exogenous Nanog protein in human HCC cells (Figure ), further suggesting that RACK1 enhances the stability of Nanog. Because the stability of Nanog has been demonstrated to be regulated by the ubiquitin-proteasome system 17-23, we tested whether RACK1 inhibits the degradation of Nanog in a proteasome-dependent manner. The proteasome inhibitor MG132 prevented the reduction of exogenous Nanog protein under the condition of RACK1 knockdown (Figure ). Moreover, the shortened half-life of Nanog protein upon RACK1 knockdown also occurred in murine ESCs, but the effects of RACK1 knockdown diminished in the presence of MG132 (Figure ). These data suggest that RACK1 might inhibit the ubiquitin-proteasome- dependent degradation of Nanog. Indeed, the ubiquitination of Nanog was significantly increased upon RACK1 knockdown (Figure ), whereas ectopic expression of RACK1 resulted in decreased Nanog ubiquitination in in vitro cultured HuH7 cells (Figure ). Moreover, the ubiquitination of endogenous Nanog in HuH7 tumors was enhanced upon RACK1 knockdown (Figure ). Collectively, these data indicate that RACK1 stabilizes Nanog through down-regulation of Nanog ubiquitination.

RACK1 interacts with Nanog in vitro and in vivo

Since RACK1 is an adaptor protein, it is possible that RACK1 reduces Nanog ubiquitination through protein-protein interaction. Previous studies have revealed that various members of the WD repeat protein family might be involved in a Nanog interactome 51,52. To test whether RACK1 engages a direct interaction with Nanog, we carried out in vitro Glutathione S-transferase pull-down assays. Compared with GST alone, GST-RACK1 specifically precipitated endogenous Nanog, but not Oct4 and Sox2, in lysates of HuH7 cells (Figure ). We also checked the possible co-localization of Nanog and RACK1. Consistent with data from clinical HCC tissues (Figure ), indirect immunofluorescence analysis revealed that RACK1 was predominantly cytoplasmic, whereas Nanog was predominantly nuclear with a considerable portion distributed in the cytoplasm in HuH7 cells (Figure ). Nanog and RACK1 showed co-localization in the cytoplasm (Figure ). This notion was confirmed by nuclear cytoplasmic fractionation and subsequent immunoblotting (Figure ). The interaction of RACK1 with Nanog was confirmed by coimmunoprecipitation analysis: GFP-RACK1 co-precipitated with co-expressed FLAG-Nanog and Myc-Nanog co-precipitated with co-expressed FLAG-RACK1 in 293T cells (Figure ). Interestingly, ectopic RACK1 expression failed to enhance exogenous Nanog expression in 293T cells (Figure ). In line with this, RACK1 knockdown in 293T cells failed to suppress exogenous Nanog expression (Figure ). These data suggest that the effects of RACK1 on Nanog expression is cell-type specific. The interaction of RACK1 with Nanog under physiological conditions was then examined. Endogenous Nanog in in vitro cultured HuH7 cells co-precipitated with endogenous RACK1 (Figure ). Furthermore, endogenous RACK1 in in vitro cultured HuH7 cells co-precipitated with endogenous Nanog (Figure ). The physiological interaction between RACK1 and Nanog was also observed in HuH7 tumors (Figure ) and in murine ESCs (Figure ). Collectively, our data indicate that RACK1 is a direct binding partner for Nanog.

RACK1 reduces Nanog ubiquitination through directly binding to it

Nanog is composed of an N-terminal domain (ND), a homeodomain (HD), and a C-terminal domain (CD), whereas RACK1 contains seven WD repeats. The CD of Nanog contains a prominent tryptophan-rich (WR) subdomain that divides the CD into three parts (CD1, WR, and CD2). RACK1/Nanog interacting regions were analyzed in 293T cells through generating several deletion mutants followed by coimmunoprecipitation analysis. For some unknown reason(s), we failed to detect the expression of FLAG-tagged ND-truncated Nanog mutant (FLAG-ΔND). However, all the other FLAG-tagged Nanog deletion mutants (FLAG-ΔHD, FLAG-ΔCD1, FLAG-ΔWR, and FLAG-ΔCD2) co-precipitated with co-expressed GFP-RACK1 (Figure ). Then, we constructed mammalian expression vectors encoding GFP-Nanog and GFP-ΔND, respectively. Unlike FLAG-ΔND, GFP-ΔND could be detected. Endogenous RACK1 co-precipitated with exogenous GFP-Nanog, but not with exogenous GFP-ΔND (Figure ). Nanog mutant lacking the RACK1-binding domain (i.e., the N-terminal domain) undergoes augmented ubiquitination (Figure ). On the other hand, Myc-Nanog co-precipitated with co-expressed wild type RACK1 and its WD1-4-truncated mutant, but not with co-expressed RACK1 mutant lacking WD5-7 (Figure ). Moreover, the RACK1 mutant deficient of WD5 (FLAG-WDΔ5), but not FLAG-WDΔ6 or FLAG-WDΔ7, showed significantly reduced association with co-expressed Myc-Nanog (Figure ). Therefore, RACK1 anchors the N-terminal domain of Nanog via its WD5. Deletion of the Nanog-binding domain abrogated the inhibition of Nanog ubiquitination by RACK1 (Figure ). Consequently, RACK1 mutant lacking WD5 lost the ability of wild type RACK1 to enhance Nanog expression in HuH7 cells (Figure ). By contrast, RACK1 mutant lacking WD5 slightly suppressed the protein level of Nanog in HuH7 cells (Figure ). Because RACK1 usually forms a homodimer via its WD4 53, it is possible that RACK1 mutant lacking WD5 hinders the function of its dimerization partner. Collectively, our data suggest that RACK1 reduces Nanog ubiquitination and thus stabilizes it through direct interaction.

RACK1 prevents the recruitment of FBXW8 by Nanog through directly binding to Nanog

Our aforementioned data show that RACK1 prevents the ubiquitin-dependent degradation of Nanog and their direct interaction is required for this effect. How RACK1 represses the ubiquitination of Nanog is interesting. RACK1 has been reported to either promote or prevent the ubiquitin-proteasome degradation of its interacted proteins, depending on how the interaction might affect the recruitment of the corresponding E3 ubiquitin ligase(s) or deubiquitinase(s) 54-59. The prolyl isomerase Pin1 and deubiquitinase USP21 have been suggested to stabilize Nanog in ESCs by preventing its degradation through the UPS 18,21-23. Immunoblotting analysis revealed that ectopic expression of USP21, but not Pin1, significantly enhanced the protein level of Nanog in HuH7 cells (Figure ). However, coimmunoprecipitation analysis demonstrated that the interaction between Nanog and USP21 was not suppressed upon RACK1 knockdown (Figure ). In this scenario, we turned to the reported Nanog E3 ubiquitin ligase FBXW8 in ESCs 20. As expected, ectopic expression of FBXW8 led to reduced protein level of Nanog in HuH7 cells (Figure ). Importantly, the interaction between Nanog and FBXW8 in HuH7 cells was augmented upon RACK1 knockdown, even though no interaction between RACK1 and FBXW8 was detected under the same conditions (Figure ). We then checked whether RACK1 promotes Nanog expression via FBXW8. RACK1 knockdown resulted in diminished protein level of Nanog in HuH7 cells; this effect disappeared upon FBXW8 knockdown (Figure ). Furthermore, ectopic expression of wild type RACK1, but not its mutant defective of anchoring Nanog, abrogated the interaction between Nanog and FBXW8 in HuH7 cells (Figure ). Together, these data suggest that RACK1 prevents the recruitment of FBXW8 by Nanog through directly binding to Nanog, thereby promoting Nanog expression.

RACK1 promotes self-renewal and chemoresistance of human liver CSCs through directly binding to Nanog

It is of importance to analyze the role of Nanog in the enhancement of stemness by RACK1. For this purpose, we restored Nanog expression by lentiviral vector in HuH7 cells expressing RACK1 shRNA. The partially restored Nanog protein level in total cells (Figure ) led to partial reversal of the reduced percentage of CD13+ HuH7 cells (Figure ). Sorted CD13+ cells showed fully reversed expression of Nanog, even higher than that in NC shRNA group (Figure ), which was associated with fully reversed capability of these CSCs to form spheroids (Figure ), although the sizes of these spheroids were relatively smaller (data not shown). As for tumorigenicity, the diminished efficiency of tumor formation and the decreased tumor sizes upon RACK1 knockdown was partially reversed (Figure and Figure ). The increased sensitivity to therapeutic agents and the reduced expression of drug-resistant relative genes upon RACK1 knockdown was significantly reversed (Figure ). As we failed to generate HuH7 cells stably expressing the RACK1 mutant defective of anchoring Nanog (WDΔ5), we used the strategy of transient transfection with GFP-tagged mammalian expression vectors since the expression levels of wild type RACK1 and its mutant in total HuH7 cells were similar (Figure ). Unexpectedly, sorted GFP+CD13+ cells showed much lower level of GFP-WDΔ5 expression, as compared to the wild type protein (Figure ). While CD13+ subpopulation expressing GFP-RACK1 exhibited enhanced Nanog expression, enhanced sphere formation, enhanced chemoresistance to etoposide and sorafenib, and enhanced expression of drug-resistant relative genes MDR1 and LRP, no such phenomena occurred in CD13+ subpopulation expressing GFP-WDΔ5 (Figure ). In line with the data shown in Figure , CD13+ subpopulation expressing this mutant even showed the tendency of reduced Nanog expression (Figure ) and sphere formation (Figure ). Taken together, these results suggest that RACK1 promotes self-renewal and chemoresistance of human liver CSCs through, at least partially, directly binding to Nanog and thereby maintaining its expression.

Discussion

A possible role of RACK1 in normal stem cells has been suggested in planarians 60. In line with this, it has been reported that conventional knockout of RACK1 in the mouse is not feasible, due to the reduced ability of ES to go germline 61. Here, we show that RACK1 directly binds to Nanog, which prevents its recruitment of E3 ubiquitin ligase FBXW8 and ubiquitin-dependent degradation, thereby promoting self-renewal and chemoresistance of human liver CSCs and maintaining murine ESC function. Besides HCC, elevated levels of RACK1 protein were observed in various types of cancers 54; the regulation of Nanog expression by RACK1 might be a common molecular mechanism for various cancers to maintain stemness. Thus, RACK1 might be an attractive target for directed anti-CSCs therapeutics. In line with previous studies, our work indicates that CD13 is a surface marker for human liver CSCs. Recently, it has been reported by independent groups that targeting CD13 inhibits human liver cancer growth by killing CSCs 62,63. Our findings provide novel insight into this strategy. Interestingly, different exogenous proteins show different expression efficiency in CD13+ cells, depending on the function of the individual protein, which might facilitate maintaining the characteristics of CSCs. Similarly, RACK1 shRNA is relatively less efficient in this subpopulation. Indeed, RACK1 is enriched in CD13+ cells and is essential for the self-renewal and chemoresistance of human liver CSCs through stabilization of Nanog. How Nanog promotes CD13 expression remains unknown. Future studies are required to address this issue. Our work has revealed a novel mechanism underlying Nanog over-expression in CSCs. RACK1 directly binds to Nanog, which might induce conformational changes and consequently prevent its recruitment of E3 ubiquitin ligase FBXW8. Furthermore, our preliminary data suggest that RACK1 also affects the nuclear translocation of Nanog. Nanog was predominantly nuclear in murine ESCs (Figure ). Lentivirus carrying RACK1 shRNA not only caused diminished endogenous Nanog but also led to predominantly cytoplasmic localization of remnant Nanog (Figure ). Furthermore, exogenous wild type Nanog was almost exclusively nuclear, whereas Nanog mutant lacking the RACK1-binding domain (i.e., the N-terminal domain) exhibited significant cytoplasmic accumulation (Figure ). These data suggest that RACK1 promotes the nuclear translocation of Nanog through directly binding to it. As for transactivation of Nanog, RACK1 knockdown significantly suppressed, whereas RACK1 overexpression significantly enhanced, the transactivation of Nanog in HuH7 cells (Figure ). RACK1 mutant defective of anchoring Nanog lost the ability of wild type RACK1 to enhance the transcriptional activity of Nanog (Figure ). By contrast, it showed the tendency to suppress Nanog activity (Figure ), in line with its effect on Nanog expression (Figure and Figure ). These data suggest that RACK1 promotes the transcriptional activity of Nanog through directly binding to it. The levels of RACK1 protein are associated with the tumor size and the clinical stage, while those of Nanog are not. Moreover, the diminished self-renewal capability of CSCs upon RACK1 knockdown could not be fully reversed by ectopic Nanog expression (Figure ). Therefore, Nanog might collaborate with other RACK1-related signaling pathways to promote HCC tumorigenesis and recurrence. Our data suggest that MKK7, PKCβII, Hedgehog, and Akt might contribute to RACK1-mediated self-renewal. Nanog seems to play a predominant role in RACK1-mediated chemoresistance to etoposide and sorafenib and the expression of drug-resistant relative genes MDR1 and LRP because ectopic Nanog expression can fully reverse the corresponding defects upon RACK1 knockdown, at least in vitro. Selective PKCβII inhibitor CGP53353 failed to inhibit the expression of drug-resistant relative genes MDR1, MRP1, and LRP (Figure ), though RACK1/ PKCβII axis has been implicated in doxorubicin resistance of HCC 27. PKCβII inhibitor attenuated, but not completely abolished, RACK1-mediated doxorubicin resistance of HCC 27, suggesting other mechanism(s) collaborate with PKCβII in RACK1-mediated chemotherapy resistance of HCC. Nanog should be such a factor. Another possibility is that different chemotherapy drugs use different mechanism(s) to trigger apoptosis. RACK1/PKCβII axis plays a key role in doxorubicin resistance, whereas RACK1/Nanog axis contributes more to chemoresistance to etoposide and sorafenib. These issues await future studies. Supplementary figures and tables. Click here for additional data file.
  62 in total

1.  Phosphorylation stabilizes Nanog by promoting its interaction with Pin1.

Authors:  Matteo Moretto-Zita; Hua Jin; Zhouxin Shen; Tongbiao Zhao; Steven P Briggs; Yang Xu
Journal:  Proc Natl Acad Sci U S A       Date:  2010-07-09       Impact factor: 11.205

2.  PEST motif sequence regulating human NANOG for proteasomal degradation.

Authors:  Suresh Ramakrishna; Bharathi Suresh; Key-Hwan Lim; Byung-Hyun Cha; Soo-Hong Lee; Kwang-Soo Kim; Kwang-Hyun Baek
Journal:  Stem Cells Dev       Date:  2011-03-12       Impact factor: 3.272

3.  RACK1 promotes non-small-cell lung cancer tumorigenicity through activating sonic hedgehog signaling pathway.

Authors:  Shuo Shi; Yue-Zhen Deng; Jiang-Sha Zhao; Xiao-Dan Ji; Jun Shi; Yu-Xiong Feng; Guo Li; Jing-Jing Li; Di Zhu; H Phillip Koeffler; Yun Zhao; Dong Xie
Journal:  J Biol Chem       Date:  2012-01-19       Impact factor: 5.157

4.  lnc-β-Catm elicits EZH2-dependent β-catenin stabilization and sustains liver CSC self-renewal.

Authors:  Pingping Zhu; Yanying Wang; Guanling Huang; Buqing Ye; Benyu Liu; Jiayi Wu; Ying Du; Lei He; Zusen Fan
Journal:  Nat Struct Mol Biol       Date:  2016-05-30       Impact factor: 15.369

5.  A CD13-targeting peptide integrated protein inhibits human liver cancer growth by killing cancer stem cells and suppressing angiogenesis.

Authors:  Yan-Bo Zheng; Jian-Hua Gong; Xiu-Jun Liu; Yi Li; Yong-Su Zhen
Journal:  Mol Carcinog       Date:  2017-01-04       Impact factor: 4.784

6.  Heterogeneity in cancer: cancer stem cells versus clonal evolution.

Authors:  Mark Shackleton; Elsa Quintana; Eric R Fearon; Sean J Morrison
Journal:  Cell       Date:  2009-09-04       Impact factor: 41.582

7.  Poly(ethylene glycol)-poly(lysine) block copolymer-ubenimex conjugate targets aminopeptidase N and exerts an antitumor effect in hepatocellular carcinoma stem cells.

Authors:  Reishi Toshiyama; Masamitsu Konno; Hidetoshi Eguchi; Hiroyasu Takemoto; Takehiro Noda; Ayumu Asai; Jun Koseki; Naotsugu Haraguchi; Yuji Ueda; Katsunori Matsushita; Kei Asukai; Tomofumi Ohashi; Yoshifumi Iwagami; Daisaku Yamada; Daisuke Sakai; Tadafumi Asaoka; Toshihiro Kudo; Koichi Kawamoto; Kunihito Gotoh; Shogo Kobayashi; Taroh Satoh; Yuichiro Doki; Nobuhiro Nishiyama; Masaki Mori; Hideshi Ishii
Journal:  Oncogene       Date:  2018-08-08       Impact factor: 9.867

Review 8.  Emerging role of nanog in tumorigenesis and cancer stem cells.

Authors:  Luis E Iv Santaliz-Ruiz; Xiujie Xie; Matthew Old; Theodoros N Teknos; Quintin Pan
Journal:  Int J Cancer       Date:  2014-01-13       Impact factor: 7.396

9.  Receptor for activated C kinase 1 (RACK1) promotes the progression of OSCC via the AKT/mTOR pathway.

Authors:  Xuefeng Zhang; Na Liu; Danhua Ma; Ling Liu; Lu Jiang; Yu Zhou; Xin Zeng; Jing Li; Qianming Chen
Journal:  Int J Oncol       Date:  2016-06-03       Impact factor: 5.650

10.  RACK1 depletion in a mouse model causes lethality, pigmentation deficits and reduction in protein synthesis efficiency.

Authors:  Viviana Volta; Anne Beugnet; Simone Gallo; Laura Magri; Daniela Brina; Elisa Pesce; Piera Calamita; Francesca Sanvito; Stefano Biffo
Journal:  Cell Mol Life Sci       Date:  2012-12-02       Impact factor: 9.261

View more
  17 in total

Review 1.  Kelch-like proteins in the gastrointestinal tumors.

Authors:  An-Bo Fu; Sen-Feng Xiang; Qiao-Jun He; Mei-Dan Ying
Journal:  Acta Pharmacol Sin       Date:  2022-10-20       Impact factor: 7.169

2.  CD73 sustained cancer-stem-cell traits by promoting SOX9 expression and stability in hepatocellular carcinoma.

Authors:  Xiao-Lu Ma; Bo Hu; Wei-Guo Tang; Su-Hong Xie; Ning Ren; Lin Guo; Ren-Quan Lu
Journal:  J Hematol Oncol       Date:  2020-02-05       Impact factor: 17.388

3.  Hypoxia-induced myeloid derived growth factor promotes hepatocellular carcinoma progression through remodeling tumor microenvironment.

Authors:  Xu Wang; Jie Mao; Tao Zhou; Xingyi Chen; Haoyang Tu; Jinyan Ma; Yixuan Li; Yushi Ding; Yong Yang; Hongxi Wu; Xinying Tang
Journal:  Theranostics       Date:  2021-01-01       Impact factor: 11.556

4.  Cold Atmospheric Pressure Plasma-Activated Medium Induces Selective Cell Death in Human Hepatocellular Carcinoma Cells Independently of Singlet Oxygen, Hydrogen Peroxide, Nitric Oxide and Nitrite/Nitrate.

Authors:  Yan Li; Tianyu Tang; Haejune Lee; Kiwon Song
Journal:  Int J Mol Sci       Date:  2021-05-24       Impact factor: 5.923

5.  Association of Preoperative NANOG-Positive Circulating Tumor Cell Levels With Recurrence of Hepatocellular Carcinoma.

Authors:  Yongrong Lei; Xishu Wang; Heng Sun; Yuna Fu; Yichen Tian; Ludi Yang; Jianhua Wang; Feng Xia
Journal:  Front Oncol       Date:  2021-05-27       Impact factor: 6.244

6.  DNA methylation maintains the CLDN1-EPHB6-SLUG axis to enhance chemotherapeutic efficacy and inhibit lung cancer progression.

Authors:  Jia-En Wu; Yi-Ying Wu; Chia-Hao Tung; Yao-Tsung Tsai; Hsuan-Yu Chen; Yuh-Ling Chen; Tse-Ming Hong
Journal:  Theranostics       Date:  2020-07-11       Impact factor: 11.556

Review 7.  Homeobox Genes and Hepatocellular Carcinoma.

Authors:  Kwei-Yan Liu; Li-Ting Wang; Shih-Hsien Hsu; Shen-Nien Wang
Journal:  Cancers (Basel)       Date:  2019-05-03       Impact factor: 6.639

8.  miR-552 Regulates Liver Tumor-Initiating Cell Expansion and Sorafenib Resistance.

Authors:  Tao Han; Yue Zhang; Xiaodan Yang; Lei Han; Hengyu Li; Tingsong Chen; Zhendong Zheng
Journal:  Mol Ther Nucleic Acids       Date:  2020-01-15       Impact factor: 8.886

Review 9.  An evolving paradigm of cancer stem cell hierarchies: therapeutic implications.

Authors:  Alexander J Cole; Adetunji P Fayomi; Vivian I Anyaeche; Shoumei Bai; Ronald J Buckanovich
Journal:  Theranostics       Date:  2020-02-10       Impact factor: 11.556

10.  Overexpression of RACK1 Predicts Poor Prognosis in Melanoma.

Authors:  Congcong Shen; Hui Hua; Lixiong Gu; Shuanglin Cao; Hengji Cai; Xiaodong Yao; Xiaodong Chen
Journal:  J Cancer       Date:  2020-01-01       Impact factor: 4.207

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.