| Literature DB >> 30793492 |
Nana Song1,2,3,4,5, Zhihui Lu1,2,3,4,5, Jian Zhang1,2,3,4,5, Yiqin Shi1,2,3,4,5, Yichun Ning1,2,3,4,5, Jing Chen1,2,3,4,5, Shi Jin1,2,3,4,5, Bo Shen1,2,3,4,5, Yi Fang1,2,3,4,5, Jianzhou Zou1,2,3,4,5, Jie Teng1,2,3,4,5, Xiang-Ping Chu6, Linlin Shen7, Xiaoqiang Ding1,2,3,4,5.
Abstract
Acidic microenvironment is commonly observed in ischaemic tissue. In the kidney, extracellular pH dropped from 7.4 to 6.5 within 10 minutes initiation of ischaemia. Acid-sensing ion channels (ASICs) can be activated by pH drops from 7.4 to 7.0 or lower and permeates to Ca2+ entrance. Thus, activation of ASIC1a can mediate the intracellular Ca2+ accumulation and play crucial roles in apoptosis of cells. However, the role of ASICs in renal ischaemic injury is unclear. The aim of the present study was to test the hypothesis that ischaemia increases renal epithelia cell apoptosis through ASIC1a-mediated calcium entry. The results show that ASIC1a distributed in the proximal tubule with higher level in the renal tubule ischaemic injury both in vivo and in vitro. In vivo, Injection of ASIC1a inhibitor PcTx-1 previous to ischaemia/reperfusion (I/R) operation attenuated renal ischaemic injury. In vitro, HK-2 cells were pre-treated with PcTx-1 before hypoxia, the intracellular concentration of Ca2+ , mitochondrial transmembrane potential (∆ψm) and apoptosis was measured. Blocking ASIC1a attenuated I/R induced Ca2+ overflow, loss of ∆ψm and apoptosis in HK-2 cells. The results revealed that ASIC1a localized in the proximal tubular and contributed to I/R induced kidney injury. Consequently, targeting the ASIC1a may prove to be a novel strategy for AKI patients.Entities:
Keywords: acid-sensing ion channels; apoptosis; calcium; ischaemia/reperfusion injury; kidney; mitochondrial transmembrane potential
Mesh:
Substances:
Year: 2019 PMID: 30793492 PMCID: PMC6484315 DOI: 10.1111/jcmm.14238
Source DB: PubMed Journal: J Cell Mol Med ISSN: 1582-1838 Impact factor: 5.310
Primer sets used for real‐time PCR
| Gene | Sense Primer(5’‐3’) | Antisense Primer(5’‐3’) |
|---|---|---|
| human ASIC1 | ATGGAAAGTGCTACACGTTCAA | GTTCATCCTGACTATGGATCTGC |
| mouse ASIC1 | AGGGCTTTTGGGTGACATCG | CAGCCGGTGCTTAATGACCT |
| human GAPDH | GGAGCGAGATCCCTCCAAAAT | GGCTGTTGTCATACTTCTCATGG |
| mouse GAPDH | AGGTCGGTGTGAACGGATTTG | GGGGTCGTTGATGGCAACA |
Figure 1Immunohistochemical analysis of ASIC1a expression in renal tissue. Immunostaining for ASIC1a, AQP1, THP and SYN in renal tissue. ASIC1a was colocalized with AQP and SYN, but not THP. ASIC1a, acid sensing ion channel 1a; AQP1, aquaporin 1, proximal tubular cells marker; THP, Tamm‐Horsfall protein, thick ascending limb and distal tubular cells marker; SYN, Synaptopodin, podocyte marker; DAPI, 4,6‐diamidino‐2‐phenylindole, nuclear
Figure 2Inhibiting ASIC1a by PcTx1 attenuate I/R induced kidney injury. Different doses of PcTx1 (0.2, 2, 4, 10 nmol L−1 kg−1 body weight) or vehicle were injected by tail vein, 30 min before I/R operation. Twenty‐four hours after reperfusion, the expression of ASIC1a in the kidney of sham and I/R operating mouse was measured by Western blotting and PCR; functional and histological changes were assessed by serum creatinine, Urea and PAS staining; apoptosis of renal tubular epithelia cells was assessed by TUNEL staining. A, I/R increase protein and RNA level of ASIC1a in the kidney, however, administration of PcTx1 had no effect on expression of ASIC1a. B‐C, injection of PcTx1 reduced serum creatinine and urea in a dose dependent manner; D, Typical visual field of PAS staining and pathological score calculated from PAS staining. PcTx1 (4 nmol L−1 kg−1 body weight) significantly attenuated I/R induced renal injury. *P < 0.05, **P < 0.01, ***P < 0.001, compared with sham; # P < 0.05, ### P < 0.001, compared with vehicle+I/R, n = 6
Figure 3Inhibiting ASIC1a by PcTx1 attenuate I/R induced apoptosis of renal tubule, in vivo. Typical image of TUNEL staining in renal coronal section from sham, vehicle+I/R and PcTx1+ I/R animal. ***P < 0.001, compared with sham; # P < 0.05, ### P < 0.001, compared with vehicle+I/R, n = 6
Figure 4Inhibiting ASIC1a by PcTx1 reduced H/R induced apoptosis of HK‐2 cells. A, H/R increase protein level of ASIC1a in the HK‐2 cells. *P < 0.05, n = 6. B, HK‐2 cells were pre‐treated with different doses of PcTx1 (5, 25, 100, and 500 ng/mL) or vehicle before H/R treatment. Apoptosis of HK‐2 cells was measured by Annexin‐V/PI staining and evaluated by flow cytometry. C, the group data from B. PcTx1 attenuated H/R induced apoptosis especially early apoptosis dose dependently. ***P < 0.001, compared with Normoxia; # P < 0.05, ## P < 0.01, compared with vehicle+H/R, n = 6. E, Cell variability was measured by MTT assay. Treatment of PcTx1 for 6 h had no effect on variability of HK‐2 cells
Figure 5Inhibiting ASIC1a by PcTx1 reduced H/R induced intracellular calcium overload and loss of mitochondrial membrane potential. HK‐2 cells were administrated with different doses of PcTx1 as Figure 3. A, Intracellular calcium concentration were measured by fluo4 and evaluated by flow cytometry. PcTx1 attenuated H/R induced intracellular calcium overload dose dependently. B, Intracellular calcium concentration was measured by fluo4 immunofluorescence staining. As expected, PcTx1 attenuated H/R induced intracellular calcium overload. C, mitochondrial membrane potential were monitored by JC‐1 dye and evaluated by flow cytometry. ***P < 0.001, compared with Normoxia; # P < 0.05, ## P < 0.01, compared with vehicle+H/R, n = 6
Figure 6Inhibiting ASIC1a by PcTx1 reduced expression of cleaved‐caspase3 in renal tubule. A: PcTx1 (4 nmol L−1 kg−1 body weight) or vehicle were injected by tail vein, 30 min before I/R operation. Twenty‐four hours after reperfusion, apoptosis of renal tubular epithelia cells was assessed by immunohistochemical reaction of cleaved‐caspase3. Typical image of cleaved‐caspase3 immunohistochemical staining in renal coronal section from sham, vehicle + I/R and PcTx1+ I/R animal; B, detailed information of immunohistochemical reaction of cleaved‐caspase3 under high‐power lens; **P < 0.01, compared with sham; ## P < 0.001, compared with vehicle + I/R, n = 6. C, HK‐2 cells were pre‐treated with PcTx1 (100 ng/mL) before H/R treatment, cleaved‐caspase3 was measured by Western blotting; **P < 0.01, compared with Normoxia; ## P < 0.01, compared with vehicle+H/R, n = 6
Figure 7Schema of I/R induced the local microenvironment acidification and the activation of ASIC1a on renal injury and the involved underlying mechanism. Ischaemia caused accumulation of extracellular protons (H+). ASIC1a are activated by extracellular H+ and induce influx of Ca2+, which induced loss of mitochondrial membrane potential. The damage of mitochondrial increased cleaved‐caspase3, which resulted in apoptosis of renal tubular epithelia cells. Administration of the specific inhibitor of ASIC1a, PcTx1 ameliorated ischaemic renal injury by inhibiting ASIC1a, which implied a potential therapeutic choice for AKI