Female-biased embryonic death from inflammation induced by genomic instability.

Genomic instability can trigger cellular responses that include checkpoint activation, senescence and inflammation1,2. Although genomic instability has been extensively studied in cell culture and cancer paradigms, little is known about its effect during embryonic development, a period of rapid cellular proliferation. Here we report that mutations in the heterohexameric minichromosome maintenance complex-the DNA replicative helicase comprising MCM2 to MCM73,4-that cause genomic instability render female mouse embryos markedly more susceptible than males to embryonic lethality. This bias was not attributable to X chromosome-inactivation defects, differential replication licensing or X versus Y chromosome size, but rather to 'maleness'-XX embryos could be rescued by transgene-mediated sex reversal or testosterone administration. The ability of exogenous or endogenous testosterone to protect embryos was related to its anti-inflammatory properties5. Ibuprofen, a non-steroidal anti-inflammatory drug, rescued female embryos that contained mutations in not only the Mcm genes but also the Fancm gene; similar to MCM mutants, Fancm mutant embryos have increased levels of genomic instability (measured as the number of cells with micronuclei) from compromised replication fork repair6. In addition, deficiency in the anti-inflammatory IL10 receptor was synthetically lethal with the Mcm4Chaos3 helicase mutant. Our experiments indicate that, during development, DNA damage associated with DNA replication induces inflammation that is preferentially lethal to female embryos, because male embryos are protected by high levels of intrinsic testosterone.

Mutations that compromise DNA replication or replication-associated repair can cause replication stress (RS) and GIN [7,8]. Resulting chronic DNA damage can lead to inflammation by activating the cGAS/STING pathway, potentially resulting in a “senescence-associated secretory phenotype” (SASP) [1,9,10]. Little is known about consequences of fetal or maternal GIN-induced inflammation during gestation.

DNA replication requires the heterohexameric minichromosome maintenance complex (MCM2–7), constituting the catalytic core of the replicative helicase. Reduction of MCMs causes RS by decreasing dormant (“backup”) origins that are important for completing DNA replication when replication forks stall or collapse [11-13]. Mice bearing the Chaos3 allele of Mcm4 (abbreviated Mcm4) have elevated micronuclei and are highly cancer prone [4]. This allele causes GIN by destabilizing the MCM2–7 helicase and triggering post-transcriptional pan-reduction (~40%) of Mcm2–7 mRNAs and protein [3]. Although Mcm4 homozygotes in strain C3H are fully viable, compound heterozygosity for certain other Mcm genes causes severe phenotypic consequences including pre- and postnatal lethality [3]. Upon closer examination of those and additional breeding data, we noticed that females of the MCM-depleted, semi-lethal genotypes Mcm4, Mcm4 Mcm2 , Mcm4 Mcm6, and Mcm4 Mcm7 (Gt = gene trap allele) were drastically under-represented compared to males of the same mutant genotype (Fig. 1a; Tables S1, S2, S3, S4). There was no gender skewing associated with non-lethal genotypes (Mcm4 Mcm3 and Mcm4 Mcm5), i.e., those genotypes present in offspring at Mendelian ratios (Fig. 1a; Table S5) [3].

Fig. 1.

Female-biased embryonic lethality in MCM-depleted mice.

(a) Female MCM-depleted mice are underrepresented at birth. Mice were bred to produce Mcm4 (“C3/C3”) or Mcm4 offspring (“C3/M4), some of which were heterozygous for null alleles in other MCMs (“M#”; for example, M2/+ = Mcm2). Graphed are percent viability at birth of males and females for each of the indicated genotypes versus C3/C3 littermates. For Fancm, the viability is versus WT littermates. The numbers on or over the bars = # males or females of the indicated genotype, and the N values below equal the total number of newborns with that genotype. Some of the data for all genotypes except that involving M5 were reported in [3], but broken out by sex here and with added data that are enumerated in Extended Data Table 1 and Tables S1-S5. P-values are from a Chi-Squared test that females are underrepresented vs males from that genotype. “<>“ represents a significant two-sided Fisher Exact Test (C3/M4; P=0.011, C3/M6; P=0.018) between indicated groups in terms of the ability of Mcm3 heterozygosity to decrease sex bias. (b) Timing of female death during embryogenesis. E = embryonic day. Numbers above bars are viable XY:XX embryos genotyped (they sum to the “N” values). P-values determined from Chi-Squared probability.

To determine when Mcm4 Mcm2 females were dying during development, we conducted timed matings of Mcm4 females to Mcm4 Mcm2 males. Loss of Mcm4 Mcm2 embryos was first evident at E14.5, and was already skewed against females; the male:female ratios of Mcm4 Mcm2 embryos at E9.5, E12.5, E14.5 and birth were 1.0, 1.37, 2.0, and 3.11, respectively (Fig. 1b).

MEFs (mouse embryonic fibroblasts) bearing MCM mutations exhibit reduced dormant replication origins [14,15]. To test if dormant origin reduction contributes to the female-biased lethality, Mcm3 heterozygosity was introduced into the semilethal genotypes. Mcm3 heterozygosity ameliorates several deleterious phenotypes of MCM-deficient mutant mice and cells by increasing chromatin-bound MCMs (MCM3 participates in nuclear export of MCMs) [3]. This dramatically rescued viability of Mcm4 and Mcm4 Mcm6 female embryos preferentially, increasing female viability from 0% to 27% in the former, and from 3% to 42% in the latter (Fig. 1a, Tables S1,S2). Mcm3 heterozygosity also increased viability of Mcm4 Mcm2 newborns from 30% to 72%, but both sexes were rescued approximately proportionately (Fig. 1a; Table S3); preferential female rescue may be related to overall degree of lethality in compound mutants (93%, 82% and 70% lethality for Mcm4 , Mcm4 Mcm6 and Mcm4 Mcm2, respectively) [3].

We next hypothesized that the female-biased embryonic lethality was related to one of the following: 1) defects in X-inactivation caused by impaired or delayed DNA replication, 2) the larger size of the X (~171 Mb) vs the Y chromosome (~90 Mb), which might stress the compromised replication machinery, or 3) secondary sexual characteristics. Flow cytometric analysis of cells from E10.5 female embryos bearing an ubiquitously-expressed X-linked GFP transgene revealed no difference between non-lethal genotypes (Mcm4 Mcm2; Mcm4 Mcm2; Mcm4 Mcm2) and the sex-biased lethal genotype (Mcm4 Mcm2; Extended Data Fig. 1), indicating that X-inactivation occurs normally. To distinguish between hypotheses 2 and 3, a single experiment was performed. We induced sex reversal of XX Mcm4 Mcm2 embryos with an autosomal Sry transgene. Strikingly, this increased the proportion of XX Mcm4 Mcm2 mice from 20% to 48% (Fig 2a; Table S6). These results indicate that maleness, and not the presence of two X chromosomes per se, protects embryos from MCM deficiency. These data are consistent with the finding that preferential female embryo death occurs after sex determination (E9.5–12.5).

Extended Data Fig. 1.

X-inactivation is not perturbed in MCM mutant embryos.

Mouse female embryos bearing one X-linked GFP transgene were dispersed into single cells and examined by flow cytometry for GFP fluorescence. Control animals were female littermates with a genotype of Mcm4 Mcm2 or Mcm4 Mcm2. The center line represents the mean, and error bars represent the standard deviation in GFP-positive cells among the individual embryos (N) used. There is no significance difference between the values by an unpaired 2-tailed T-test(P=0.926). C3 = Mcm4; M2 = Mcm2.

Fig. 2.

Evidence that the anti-inflammatory activity of testosterone protects male embryos from genomic instability-induced lethality.

(a) Viability of genetically female (XX) Mcm4 Mcm2 or Fancm embryos is rescued by Sry transgene-induced sex reversal (Sry Tg), and treatment of pregnant dams with either testosterone (“Testos”) or ibuprofen (“NSAID”). Values above each bar are total mice, and those inside bars are XX. Nontransgenics and transgenics in the Sry Tg experiment were from the same cross. The untreated mice in the testosterone and NSAID experiments are from Table S3 and also plotted in Fig. 1a. This aggregate value contains 8 male and 1 female Mcm4 Mcm2 offspring that were produced contemporaneous to the NSAID cohort. P values are from two-tailed F.E.T. or an unpaired, 2-tailed T-test. The Sry Tg and testosterone crosses involved an Mcm3 allele that was included to boost viability (but not sex skewing, see Fig. 1a) of the lethal genotypes. (b) Testosterone treatment does not affect Mcm mRNA, but does lower the inflammation markers Il6 and Ptgs2. Mcm4 Mcm2 MEFs (n=6: 3 male, 3 female) were treated with 10nM T for 1 hr, and mRNA collected 6 hrs later for qRT-PCR. Bars represent mean and error bars indicate standard deviation. Individual data points are indicated. (c) Same as (b), but protein was collected 24 hrs after T treatment, and Western analysis performed with indicated antibodies by stripping and re-probing the same blot. The experiment was repeated a minimum of 3 times with different MEF lines of the same genotype with similar results. For gel source data, see Supplemental Figure 1.

Since sex reversal rescued XX lethality, we hypothesized that testosterone (T) might be responsible. It is produced at high levels by Leydig cells in embryonic testes from ~E12.5 onward [16]. We injected pregnant females daily with T beginning at E7.5, and found that the viability of XX Mcm4 Mcm2 E19.5 fetuses increased dramatically from 22% to 54% (Fig. 2a; Table S7). We speculated that T might protect MCM-deficient embryos by increasing replication capacity, given a report that the androgen receptor stimulates proliferation of prostate cancer cells by acting as a replication factor [17,18]. However, we observed no increase of Mcm mRNA or chromatin-bound MCMs in T-treated MEFs (Fig. 2b, c), and no sex-specific differences in MCM2 or MCM4 protein levels in E13.5 fetuses or placentae of various genotypes (Extended Data Fig. 2).

Extended Data Fig 2.

Placental, but not embryonic MCM levels are decreased in MCM mutants independent of maternal genotype, and NSAID does not rescue MCM levels.

a) Representative westerns blots of protein lysates from E13.5 embryos and placentas of the indicated genotypes (top of each lane) were immunolabeled with antibodies against MCM2, MCM4, and beta actin. The samples came from dams of two genotypes indicated at the top of the panel. C3 = Mcm4; M2 = Mcm2. Note that MCM4 levels are particularly affected. The experiment was repeated twice for each maternal genotype. For gel source data, see Supplementary Figure 1. b) Placental MCM2 and MCM4 protein levels from the indicated maternal genotypes were quantified from western blots (including some other than those in “a”) that were imaged (see Methods) and normalized to actin and WT protein levels. Each plotted point represents a single placenta. P-values represent unpaired two-tailed T-test. Placentae corresponding to male or female Mcm4 Mcm2 genotype are indicated. Centre values represent the mean and error bars indicate standard deviation. c) Embryonic MCM2 and MCM4 protein levels were determined as in (b). Each plotted point represents a single embryo. Embryos corresponding to male or female Mcm4 Mcm2 genotype are indicated. The results were not significant (n.s.) by a one-way ANOVA.

Next, we hypothesized that T was ameliorating certain consequences of GIN in the Mcm mutants. In particular, elevated micronuclei, the signature phenotype of Mcm4 mice [4], can trigger inflammation via the cGAS-STING pathway [19]. T, a steroid hormone, suppresses the expression of pro-inflammatory cytokines while increasing the anti-inflammatory molecule IL10 [5,20,21]. Indeed, T treatment of Mcm4 Mcm2 MEFs caused >2–3 fold decreases in mRNAs for the pro-inflammatory cytokine IL6 and also PTGS2 (COX2), which is central for production of prostaglandins that cause inflammation and pain (Fig. 2b). Strikingly, administration of ibuprofen to pregnant females (from 7.5 days post-coitus onward in drinking water) completely abolished sex bias of Mcm4 Mcm2 offspring (Fig. 2a, Extended Data Table 1a) without affecting embryonic or placental MCM levels (Extended Data Fig. 2b, c).

Extended Data Table 1.

Segregation of genotypes from crosses.

a) Embryonic semilethality caused by the Mcm4 Mcm2 genotype is rescued by ibuprofen treatment of pregnant females. Cross: ♀ Mcm4 X ♂ Mcm4 Mcm2. Red numbers are plotted in Fig. 2A under “NSAID.” C3 = Chaos3. Data are from 29 litters. b) Embryonic semilethality caused by the Mcm4 Mcm2 genotype is affected by maternal genotype. Cross: ♀ Mcm4 Mcm2 X ♂ Mcm4 Red numbers are plotted in Fig. 3A under “C3/+ M2/+.” C3 = Chaos3, M2= Mcm2. Data are from 32 litters. c) Embryonic semilethality caused by the Mcm4 Il10rb genotype is rescued by ibuprofen treatment of pregnant females. Cross: ♀ Mcm4 Il10rb X ♂ Mcm4 Il10rb. d) Embryonic semi-lethality and female sex bias caused by the FancM genotype (is rescued by ibuprofen treatment of pregnant females.) Cross: ♀ Fancm X ♂ Fancm . Red numbers are plotted in Fig. 2A.

a							b
	Mcm4C3/+	Mcm4C3/+Mcm2Gt/+	Mcm4C3/C3	Mcm4C3/C3Mcm2Gt/+	Total			Mcm4C3/+	Mcm4C3/+Mcm2Gt/+	Mcm4C3/C3	Mcm4C3/C3Mcm2Gt/+	Total
Males	29	38	21	14	102		Males	31	39	29	10	109
Females	17	38	26	14	95		Females	25	38	17	14	94
Total	46	76	47	28	197		Total	56	77	46	24	203
%Female	36.9	50	55.3	50	48.2		%Female	44.6	49.4	36.9	58.3	46.3
c							d
	Mcm4C3/C3Il10rb−/−	Mcm4C3/C3Il10rb+/−	Mcm4C3/C3Il10rb+/+	Total				Fancm−/−	Fancm+/−	+/+	Total
Males	1	15	3	19			Males	32	70	34	136
Females	0	17	9	26			Females	19	63	32	114
Total	1	32	12	45			Total	51	133	66	250
%Female	0	53.5	75	58			%Female	37	47	48	46
		+NSAID							+NSAID
Males	7	16	5	28			Males	27	49	29	105
Females	9	21	10	40			Females	24	43	27	94
Total	16	37	15	68			Total	51	92	56	199
%Female	56	57	67	59			%Female	47	47	48	47

While these data indicate that GIN-driven inflammation underlies preferential female embryonic lethality, we considered the possibility that unrelated alterations in gene expression by ibuprofen and the androgen receptor (which is strongly induced by T; Fig. 2c) [22,23] were responsible. We therefore took the orthogonal approach of increasing inflammation by ablating the receptor (Il10rb) for the anti-inflammatory molecule IL10, hypothesizing that this would exacerbate Mcm4 Mcm2 lethality or sex bias. Remarkably, the genotype of Mcm4 Il10rb caused highly penetrant lethality to embryos of both sexes (Extended Data Table 1c). IL10 mediates a feedback loop under conditions of inflammation to induce degradation of Ptgs2/COX2 transcripts [24], and also counters the inflammation response triggered by the STING pathway [25]. This synthetic lethality was rescued by treating pregnant dams with NSAID, increasing viability of Mcm4Il10rb offspring (both sexes) from 8.9% to 94% (Extended Data Table 1c).

Successful pregnancy requires suppression of inflammation at the maternal:fetal interface. Because homozygosity for Chaos3 alone causes a ~20 fold increase in micronucleated erythrocytes without decreasing viability in the C3H background[4], and IL10 is thought to play a role in suppressing maternal inflammation at the fetal:maternal interface [26], we speculated that maternal genotype might influence viability of MCM compound mutant embryos. We mated females heterozygous for Chaos3 (Mcm4 Mcm2) to Mcm4 males (all data presented heretofore were from reciprocal crosses). Surprisingly, this cross abolished the sex bias against Mcm4 Mcm2 females (Fig. 3a; Extended Data Table 1b). We hypothesized that maternal homozygosity for Chaos3 imposes additional stress on the placentae of genetically susceptible female embryos, possibly via DNA damage-induced inflammation. We examined double strand break (DSB) levels (marked by γH2AX) in placentae of E13.5 embryos produced in various control and mutant reciprocal crosses. Regardless of fetal genotype, placentae from embryos within Mcm4 dams had more γH2AX-positive cells than when dams were of any other genotype (Fig. 4). NSAID treatment did not reduce the level of γH2AX staining, consistent with the rescue effect being related to inflammation, not GIN per se (Fig. 4). We therefore hypothesized that GIN-induced placental inflammation might underlie the lethality in our mice. Consistent with this, we observed significant reductions in placental, but not embryonic MCM2 and MCM4 (especially MCM4) in Chaos3 mutant genotypes, regardless of maternal genotype or whether the dams were NSAID-treated (Extended Data Fig. 2a-c). Thus, placental cells may be particularly sensitive to DNA replication defects that trigger downregulation of MCM production and consequent increases in GIN and inflammation [27,28]. RNA-seq analysis of male vs female placentae from either Mcm4Mcm2 or Mcm4 dams revealed increased expression of hallmark inflammation gene sets only in the lethal genotype combination of Mcm4 Mcm2 females from Mcm4 dams (Fig. 3b; Extended Data Fig. 3). The major upregulated gene sets included EMT transition (commonly associated with inflammatory responses [29]), allograft rejection, and interferon gamma response. All three of these categories contain genes involved in inflammation and the innate immune response (Extended Data Fig. 3). Overall, the results indicate that the combination of maternal and fetal GIN causes lethal levels of inflammation. However, it remains possible that the parental genotype-dependent, sex biased lethality may have an epigenetic component (i.e. imprinting).

Fig 3.

Maternal GIN genotype impacts female embryo viability and placental inflammation.

(a) Lethality of female (XX) Mcm4 Mcm2 embryos is dependent upon maternal genotype. C3 = Mcm4 ; M2 = Mcm2. Values above each bar are total mice, and those inside bars are XX. The P-value was calculated by a two-sided Fisher’s Exact Test. See Tables S2 and Extended Data Table 1b for primary data from the crosses. (b) Placentae of female E13.5 embryos with the Mcm4 Mcm2 lethal genotype have elevated expression of inflammation pathways when the dam has elevated GIN. RNA-seq was carried out on n=16 placentae: n=6 Mcm4 Mcm2 from Mcm4 dams, n=6 from Mcm4 Mcm2 dams, and n=4 from homozygous Mcm4 matings. Equal numbers of male and females were used. Shown are heatmaps of GSEA (Gene Set Enrichment Analysis) analysis of RNA-seq data, using the Hallmarks dataset of the Molecular Signatures Database (MSigDB; http://software.broadinstitute.org/gsea/msigdb/collections.jsp). Only those Hallmark pathways that were significantly different between sexes (FDR <0.25, nominal P value<0.05) were used to generate the heatmap. Multiple pathways involving inflammation are upregulated in Mcm4 Mcm2 female vs male embryos from Mcm4 dams, but not other combinations. Embryonic and maternal genotypes are listed at the top of the heatmaps.

Fig. 4.

Dams with intrinsic GIN cause elevated DNA damage in the placenta.

γH2AX staining in placentae from the indicated maternal genotypes. Each dot represents a single placenta. A minimum of 2 litters was examined per mating, total number of placentae analyzed is indicated. Significance was by unpaired, 2-tail t-tests. Centre value=mean, Error bars = standard deviation. ns = not significant.

Extended Data Fig 3.

Sex specific altered expression of inflammation genes in mutants.

a) Heatmap of the ratio of FPKM of key genes from top ranking genes from the following 3 GSEA Hallmarks: EMT, allograft rejection, and interferon gamma response. The ratios are expressed as female:male for each of the indicated embryo and dam genotypes. Data is from RNA-seq on n=16 placentas; n=6 Mcm4 Mcm2 from Mcm4 dams, n=6 from Mcm4 Mcm2 dams, and n=4 from homozygous Mcm4 matings. Equal numbers of male and females were used. C3 = Mcm4; M2 = Mcm2Gt/+. b) Maternal genotype affects the expression of inflammation genes. Plotted are the female:male FPKM values of C3/C3 M2/+ embryos for C3/C3 dams compared to C3/+ M2 dams for the same gene sets as in (a). The highest and lowest genes are all related to inflammation responses.

While the data presented thus far demonstrate that MCM depletion (e.g. Mcm2 hemizygosity) in conjunction with a destabilized replicative helicase in Chaos3 mice trigger inflammation and embryonic death, it is unclear exactly what defects are primarily responsible, and whether the sex-bias phenomena are entirely unique to these models. We therefore attempted to parse the key proximal defects that trigger the sex bias by exposing WT embryos to either exogenous RS alone or DSBs alone. Pregnant females, treated with hydroxyurea to induce RS, delivered pups without significant sex skewing (M:F 1.08; Table S8). Chronic exposure to ionizing radiation, which causes DSBs, also failed to produce a sex bias (M:F 1.00; Table S8). We then conjectured that replication-associated DNA damage that causes micronuclei might underlie the inflammation-driven lethality. Mice deficient for FANCM, involved in DNA replication fork repair, display elevated micronuclei [6] and underrepresentation of females [30]. We also observed a bias against Fancm females in heterozygote crosses (M:F 1.68; χ2 p = 0.03; Fig 1a, Extended Data Table 1d) that was rescued by ibuprofen treatment of dams (Fancm M:F 1.13 vs Fancm 1.07; Fig. 2a, Extended Data Table 1d).

Our results indicate that DNA damage caused by defective DNA replication and/or replication-associated repair cause a level of inflammation compromising female embryos lacking anti-inflammatory protection of testosterone. We hypothesize that since both genetic models tested have elevated micronuclei, a known trigger of the cGAS-STING cytosolic DNA sensing pathway, that this may precipitate lethal inflammation in a key compartment(s) of the embryo and/or uterine environment. Future experiments exploiting mouse mutants and mosaics will help resolve these questions, and guide studies into whether similar phenomena occur in humans.

Methods

Mice.

All breeding and husbandry all crosses were performed in the same animal facility and room at Cornell’s Veterinary College (East Campus Research Facility), and under the same environmental conditions and health status. Use of mice was performed in compliance with all relevant ethical regulations, having been conducted under a protocol (0038–2004) approved by Cornell University’s Institutional Animal Care and Use Committee (IACUC). Sample sizes for original sex skewing observations, since they were taken from historical colony breeding data, were not planned, and selection of individuals was entirely genotype-based, thus not randomized. Sexing of animals was done before genotyping, thus there was no blinding. Sample sizes with T and ibuprofen were also not pre-determined, as potential effect size was unknown yet proved to be dramatic.

Testosterone Injections and Sex Reversal.

Mcm4 Mcm2 males were mated to Mcm4 females and 100uL of a 3mg/ml solution of testosterone propionate (Sigma) was injected sub-cutaneously into the hind leg of pregnant females daily from E7.5 to E.16.5 (20µg/g/day). This dose has been shown to increase female fetal testosterone by 80% in a rodent model without serious toxicological effect [31]. The testosterone propionate was dissolved in corn oil and filter sterilized prior to injection. MEFs were derived from E13.5 embryos using Mcm4 Mcm2 males mated to Mcm4 females. MEFs were genotyped and treated with Plasmocin (InvivoGen) to prevent mycoplasma. For treatment of MEFs, a 50mM solution of testosterone propionate was prepared in ethanol and cells were treated with 10nM for 1 hour. The media was then removed and the cells collected at indicated timepoints. Sex reversal of XX Mcm4 Mcm2 embryos was carried out using an autosomally-linked Sry transgene (Tg(Sry129)4Ei) [32].

Ibuprofen Treatment.

Mcm4 Mcm2 males were mated to Mcm4 females and at E7.5-E9.5 the pregnant females were provided with water bottles containing ibuprofen (Children’s Advil) 5mL(100mg) in 250mL. They were allowed to drink ad libitum (50–80mg/kg/day). Newborns were genotyped at birth for sex with Sry primers and Mcm mutation status. Control mice utilized the same male with another Mcm4 female and no drug treatment. For Il10rb, the strain was obtained from Jax Mice (stock#005027) and backcrossed into the C3Heb/FeJ (Jax stock#000658) background for six generations (N6) before crossing into the Mcm4 strain for 2 additional generations (N2). Mcm4Il10rb males were mated to Mcm4Il10rb females and provided with ibuprofen as described above. Newborns were genotyped with primers for Il10rb (Table S9).

Genotyping.

Genomic DNA was isolated from animal tissue using the hot-shot lysis procedure [33]. Genotyping PCR was carried out using Taq1 and gene-specific primer pairs (Table S9). For Chaos3 genotyping, the PCR products were digested with MboII to identify mutant alleles as Chaos3 but not wild-type alleles are digestible with this enzyme. For Mcm5, ES cells were verified using primers containing regions outside of the gene trap insertion to verify. To determine the sex of early embryos, primers for Sry (Sex-determining region Y) were used to identify males, females are Sry negative. Genotyping for Mcm2–7 genetraps has been previously described [3].

Generation of Mcm5 mutant mice.

Mcm5 genetrap ES cells (Mcm5_F10, ESC#477873) were obtained from the Mouse Biology Program (MBP) at UC Davis and injected into B6(Cg)-Tyr/J blastocyst donors to generate chimeras. Disruption of Mcm5 was confirmed by PCR as described in genotyping section (Table S9). Following germline transmission, the mutation was backcrossed into C3H for ≥ 4 generations before crossing to C3H-Mcm4 mice.

Generation of FancM mice.

Fancm was generated using CRISPR/Cas9-mediated genome editing. In summary, an optimal guide sequence targeting the first exon of Fancm was designed using the mit.crispr.edu website. Oligos to generate the sgRNA DNA template were ordered from Integrated DNA Technologies (IDT) and the sgRNA was in vitro transcribed as described previously [34] (CRISPR-FancF: GAAATTAATACGACTCACTATAGGCCAGCTGGTAGTCGCGCACGGTTTTAGAGCTAGAAATAGC, CRISPR-FancR: CAAAATCTCGATCTTTATCGTTCAATTTTATTCCGATCAGGCAATAGTTGAACTTTTTCACCGTGGCTCAGCCACGAAAA). Embryo microinjection into C57BL/6J zygotes was performed as described previously [35] using 50ng/uL of sgRNA and 50ng/uL of Cas9 mRNA (TriLink Biotechnologies). The resulting 7bp deletion was identified via Sanger sequencing and subsequent genotyping was performed with primers sets specific to the mutant and wild-type alleles. (Table S9).

Flow cytometry to monitor X-inactivation.

A transgenic mouse [36] containing an X-linked EGFP was crossed to Mcm4 mice, and FACS analysis of embryos was carried out as described in that citation. Mcm4 Mcm2 males bearing an ubiquitously-expressed X-linked GFP transgene were bred to Mcm4 females. E10.5 female embryos (littermates from 7 different pregnancies), all of which must bear the GFP transgene, were genotyped, dispersed into single cells, and analyzed by flow cytometry to determine the fraction of GFP+ cells. Theoretical maximum of GFP-positive cells in controls is 50%.

Quantitative real-time reverse transcription-PCR (qRT-PCR).

RNA was isolated from cells using a kit per manufacturer’s instructions (Zymo or Qiagen RNeasy). 500ng of RNA was reverse transcribed into cDNA using qScript (Quanta) and analyzed on an ABI7300 or a Bio-Rad CFX96 using the following primers and iTaq (Bio-Rad). All reactions were normalized to Gapdh and/or Tbp. Primer sequences are available in Table S10. Il6, Ptgs2, Mcm2, Mcm3, Mcm4, Mcm5.

RNA-seq.

Total RNA was isolated from E13.5 placentas by homogenizing placentas in RNA lysis buffer followed by column purification per manufacturers’ instructions (Omega Biotech). RNA sample quality was confirmed by spectrophotometry (Nanodrop) to determine concentration and chemical purity (A260/230 and A260/280 ratios) and with a Fragment Analyzer (Advanced Analytical) to determine RNA integrity. Ribosomal RNA was subtracted by hybridization from total RNA samples using the RiboZero Magnetic Gold H/M/R Kit (Illumina). Following cleanup by precipitation, rRNA-subtracted samples were quantified with a Qubit 2.0 (RNA HS kit; Thermo Fisher). TruSeq-barcoded RNAseq libraries were generated with the NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs). Each library was be quantified with a Qubit 2.0 (dsDNA HS kit; Thermo Fisher) and the size distribution was be determined with a Fragment Analyzer (Advanced Analytical) prior to pooling. Libraries will be sequenced on a NextSeq500 instrument (Illumina). At least 20M single-end 75bp reads were generated per library. For analysis, reads were trimmed for low quality and adaptor sequences with cutadapt v1.8 using parameters: -m 50 -q 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAG --match-read-wildcards. Reads were mapped to the mouse reference genome/transcriptome using tophat v2.1 with parameters: --library-type=fr-firststrand --no-novel-juncs -G . For gene expression analysis: cufflinks v2.2 (cuffnorm/cuffdiff) was used to generate FPKM values and statistical analysis of differential gene expression [37]. For the GSEA analysis, all expressed genes were analyzed using the Hallmarks dataset [38]. The placental gene sets used were comparisons between male and female Mcm4 Mcm2 placentae from Mcm4 dams or Mcm4 Mcm2 dams, and male versus female Mcm4 from Mcm4 dams.

Immunoblotting.

Protein was isolated from E13.5 placentas and embryos by acetone precipitation from RNA-isolation buffer (Buffer RLT or TRK) and resuspending in SUTEB loading buffer (8M Urea, 1% SDS, 10mM EDTA, 10mM Tris-HCl, pH 6.8). Protein lysates were run on 4–20% SDS-PAGE acrylamide gels and transferred to PVDF membrane (Millipore). Immunoblots were probed with anti-Mcm2 (Epitomics/Abcam), anti-MCM2(Cell Signaling Technology), anti-androgen receptor (Epitomics/Abcam), anti-SMAD2/3(Cell Signaling), anti-p21(Santa Cruz), anti-MCM4(Cell Signaling Technology), anti-actin (Sigma). Secondary antibodies used included goat anti-rabbit-HRP (Cell Signaling) and goat anti-mouse-HRP (Sigma). Crescendo ECL substrate(Millipore) was used and immunoblots digitally scanned using a cDigit scanner. Quantification of immunoblots was performed using ImageStudio software.

γH2ax Staining.

Placentae from E13.5 embryos were dissected from individual embryos and washed in PBS. Decidua were separated from placenta and uterine tissue with fine forceps. Genotyping was carried out using a piece of the embryo. Placentae were flash-frozen in OCT and 10μM sections cut on a cryostat and affixed to slides. Sections were fixed for 10 minutes with 4% paraformaldehyde in PBS, and stained with mouse anti-γH2ax-phospho ser41 (Millipore) using a M.O.M kit and Biotin-Streptavidin blocking kit (Vector Labs) according to manufacturer’s instructions. Alexa-488 or Alexa 647-streptavidin (Invitrogen) was used to visualize. Slides were scanned using a Scanscope FL with a 20X objective. Images were quantified using Fiji or HALO(Indica Labs) and foci were detected as described [39] with an added size parameter to differentiate between nuclei and cytoplasmic signals [40]

Hydroxyurea and IR treatment of embryos.

For irradiation experiments, pregnant females were irradiated with 5 Rads (50mGy), 3 times a week during gestation, beginning at E1.5. For HU experiments, hydroxyurea (Sigma) was dissolved at 10mg/ml in sterile 1X PBS for injection. Pregnant C3H females were subjected to daily i.p. injections of 30–50ug/kg beginning at E3.5. Control females received daily i.p injections of sterile 1X PBS alone. All pregnancies were carried to term and the number and sex of animals determined at birth.

Data Availability.

All data underlying the findings of this study are presented in the paper, except for RNA-seq data, which has been deposited into the GEO database (accession number GSE119710). Note that a source data file is online for the γH2AX and MCM protein quantifications.