Literature DB >> 30773771

Variation and inheritance of the Xanthomonas raxX-raxSTAB gene cluster required for activation of XA21-mediated immunity.

Furong Liu1, Megan McDonald2, Benjamin Schwessinger1,2, Anna Joe1, Rory Pruitt1, Teresa Erickson1, Xiuxiang Zhao1, Valley Stewart3, Pamela C Ronald1.   

Abstract

The rice XA21-mediated immune response is activated on recognition of the RaxX peptide produced by the bacterium Xanthomonas oryzae pv. oryzae (Xoo). The 60-residue RaxX precursor is post-translationally modified to form a sulfated tyrosine peptide that shares sequence and functional similarity with the plant sulfated tyrosine (PSY) peptide hormones. The 5-kb raxX-raxSTAB gene cluster of Xoo encodes RaxX, the RaxST tyrosylprotein sulfotransferase, and the RaxA and RaxB components of a predicted type I secretion system. To assess raxX-raxSTAB gene cluster evolution and to determine its phylogenetic distribution, we first identified rax gene homologues in other genomes. We detected the complete raxX-raxSTAB gene cluster only in Xanthomonas spp., in five distinct lineages in addition to X. oryzae. The phylogenetic distribution of the raxX-raxSTAB gene cluster is consistent with the occurrence of multiple lateral (horizontal) gene transfer events during Xanthomonas speciation. RaxX natural variants contain a restricted set of missense substitutions, as expected if selection acts to maintain peptide hormone-like function. Indeed, eight RaxX variants tested all failed to activate the XA21-mediated immune response, yet retained peptide hormone activity. Together, these observations support the hypothesis that the XA21 receptor evolved specifically to recognize Xoo RaxX.
© 2019 The Authors. Molecular Plant Pathology Published by British Society for Plant Pathology and John Wiley & Sons Ltd.

Entities:  

Keywords:  XA21; Xoo; plant immunity; raxX-raxSTAB gene cluster

Year:  2019        PMID: 30773771      PMCID: PMC6637879          DOI: 10.1111/mpp.12783

Source DB:  PubMed          Journal:  Mol Plant Pathol        ISSN: 1364-3703            Impact factor:   5.663


Introduction

Host receptors activate innate immunity pathways on pathogen recognition (Ronald and Beutler, 2010). The gene encoding the rice XA21 receptor kinase (Song et al., 1995) confers resistance against most strains of the gamma‐proteobacterium Xanthomonas oryzae pv. oryzae (Xoo) (Wang et al., 1996). Xoo causes bacterial leaf blight disease of rice, which seriously constrains yields in Africa, Asia and South America. This well‐studied XA21Xoo interaction provides a basis from which to understand the molecular and evolutionary mechanisms of host–microbe interactions. Four Xoo genes required for the activation of XA21‐mediated immunity are located in the raxX‐raxSTAB gene cluster (Fig. 1). The 60‐residue RaxX predicted precursor protein undergoes sulfation by the RaxST tyrosylprotein sulfotransferase at residue tyrosine‐41 (Tyr‐41) (Pruitt et al., 2015). The RaxB component of the RaxAB type I secretion complex (da Silva et al., 2004) further processes the sulfated RaxX precursor by removing its double‐glycine leader peptide prior to secretion (Holland et al., 2016; Luu et al., 2018). Core (‘housekeeping’) genes encode the predicted outer membrane TolC channel for the RaxAB complex (da Silva et al., 2004), as well as enzymes to assimilate sulfate into 3′‐phosphoadenosine 5′‐phosphosulfate (PAPS) (Shen et al., 2002), the sulfodonor for the RaxST sulfotransferase (Han et al., 2012).
Figure 1

The raxX‐raxSTAB gene cluster. The raxX‐raxSTAB gene cluster is located between the flanking gcvRP and ‘mfsX’ genes. Gene cluster acquisition through lateral gene transfer is hypothesized to occur by general recombination in the flanking gcvR and ‘mfsX’ sequences as described in the text. Sequences at the left and right boundaries are shown in Fig. S2 (see Supporting Information). Sequences for length polymorphisms in the gcvP gene are shown in Fig. S3 (see Supporting Information).

The raxX‐raxSTAB gene cluster. The raxX‐raxSTAB gene cluster is located between the flanking gcvRP and ‘mfsX’ genes. Gene cluster acquisition through lateral gene transfer is hypothesized to occur by general recombination in the flanking gcvR and ‘mfsX’ sequences as described in the text. Sequences at the left and right boundaries are shown in Fig. S2 (see Supporting Information). Sequences for length polymorphisms in the gcvP gene are shown in Fig. S3 (see Supporting Information). In both plants and animals, the post‐translational modification catalysed by tyrosylprotein sulfotransferase is restricted to a subset of cell surface and secreted proteins that influence a variety of eukaryotic physiological processes (Matsubayashi, 2014; Stone et al., 2009). For example, tyrosine sulfation of the chemokine receptors CCR5 and CXCR4 is essential for their functions, including as coreceptors for the human immunodeficiency virus gp120 envelope glycoprotein (Farzan et al., 1999; Kleist et al., 2016). In plants, sulfated tyrosine peptides influence cellular proliferation and expansion in root growth and/or plant immune signalling (Matsubayashi, 2014; Tang et al., 2017). In contrast with these and other examples of protein tyrosine sulfation in animals and plants, RaxX sulfation by the RaxST enzyme is the only example of tyrosine sulfation documented in bacteria (Han et al., 2012; Pruitt et al., 2015). Mature RaxX is predicted to comprise the carboxyl‐terminal residues 40–60, numbered according to the precursor protein (Pruitt et al., 2015, 2017). RaxX residues 40–52 share sequence similarity with mature plant sulfated tyrosine (PSY) peptide hormones (Amano et al., 2007; Pruitt et al., 2015, 2017) (Fig. 2). RaxX, like PSY1, can enhance root growth in diverse plant species (Pruitt et al., 2017). The XA21‐mediated response in rice requires residues 40–55, whereas growth stimulation requires only residues 40–52 (Pruitt et al., 2015).
Figure 2

RaxX and plant sulfated tyrosine (PSY) sequences. RaxX sequences show the presumed leader‐cleaved forms of RaxX, numbered from the beginning of the precursor sequence. The extent of sequence comprising the RaxX16 and RaxX13 synthetic peptides is indicated above the alignment. Residues are shaded according to conservation in PSY sequences (Pruitt et al., 2017): positions with nearly invariant residues are shaded black, and those with only two or three substitutions are shaded blue. The sulfated tyrosine (Tyr) residue is shaded red. Gaps are indicated by dots. Sequence groups are described elsewhere in detail (Pruitt et al., 2017). The subgroups B1–B3 differ only in the carboxyl‐terminal sequence beginning with residue 53. Xanthomonas oryzae strains X8‐1A and X11‐5A are non‐pathogenic and therefore do not have pathovar designations. The mature form of Arabidopsis thaliana PSY1 (Amano et al., 2007) and the corresponding region from Oryza sativa PSY1a (Amano et al., 2007; Pruitt et al., 2017) are shown for comparison. Residues Pro‐16 and Pro‐17 in AtPSY1 are both hydroxylated [†,‡], and Pro‐16 is glycosylated with L‐Ara3 [‡] (Amano et al., 2007).

RaxX and plant sulfated tyrosine (PSY) sequences. RaxX sequences show the presumed leader‐cleaved forms of RaxX, numbered from the beginning of the precursor sequence. The extent of sequence comprising the RaxX16 and RaxX13 synthetic peptides is indicated above the alignment. Residues are shaded according to conservation in PSY sequences (Pruitt et al., 2017): positions with nearly invariant residues are shaded black, and those with only two or three substitutions are shaded blue. The sulfated tyrosine (Tyr) residue is shaded red. Gaps are indicated by dots. Sequence groups are described elsewhere in detail (Pruitt et al., 2017). The subgroups B1–B3 differ only in the carboxyl‐terminal sequence beginning with residue 53. Xanthomonas oryzae strains X8‐1A and X11‐5A are non‐pathogenic and therefore do not have pathovar designations. The mature form of Arabidopsis thaliana PSY1 (Amano et al., 2007) and the corresponding region from Oryza sativa PSY1a (Amano et al., 2007; Pruitt et al., 2017) are shown for comparison. Residues Pro‐16 and Pro‐17 in AtPSY1 are both hydroxylated [†,‡], and Pro‐16 is glycosylated with L‐Ara3 [‡] (Amano et al., 2007). RaxX sequences are generally well conserved within different Xanthomonas species (Pruitt et al., 2017). In Xoo, however, RaxX from strain IXO685, which evades XA21‐mediated immunity, differs from active RaxX at the critical positions proline‐44 (Pro‐44) and Pro‐48 (Pruitt et al., 2015). Nevertheless, this RaxX protein stimulates root growth, as do two other RaxX Pro‐48 variants from other Xanthomonas spp. (Pruitt et al., 2017). These results suggest that RaxX recognition by XA21 is restrained by different sequence and length requirements compared with its recognition by the root growth‐promoting receptor(s) for PSY hormone(s). It also suggests that the recognition of RaxX by XA21 is specific to Xoo, whereas PSY mimicry is a general feature of RaxX from other Xanthomonas spp. Accordingly, we have hypothesized previously that PSY hormone mimicry is the original function of RaxX, whereas immune recognition by XA21 evolved later in response to Xoo (Pruitt et al., 2017). Here, we report tests of two general predictions derived from this hypothesis. The first prediction, that PSY hormone mimicry is broadly selective, is supported here by the presence of the raxX‐raxSTAB gene cluster in a range of Xanthomonas spp., and by the ability of all RaxX variants tested to stimulate root growth in an assay for PSY function. The second prediction, that recognition by XA21 is restricted to X. oryzae lineages, is validated here by the observation that XA21‐mediated immunity is not activated by RaxX variants from other Xanthomonas spp. These results illustrate how a pathogen protein has evolved to retain its ability to modulate host physiology without being recognized by the host immune system.

Results

The raxX‐raxSTAB gene cluster is present in a subset of Xanthomonas spp.

We searched databases at the National Center for Biotechnology Information (NCBI) to identify bacterial genomes with the raxX‐raxSTAB gene cluster. We found the intact raxX‐raxSTAB gene cluster exclusively in Xanthomonas spp., and detected it in more than 200 unique genome sequences (File S1, see Supporting Information) among 413 accessed through the RefSeq database (O'Leary et al., 2016). Xanthomonas taxonomy has undergone several changes over the years (Vauterin et al., 2000; Young, 2008) (for a representative example, see Midha and Patil, 2014). At one point, many strains were denoted as pathovars of either X. campestris or X. axonopodis, but, today, over 20 species are distinguished, several with multiple pathovars (Rademaker et al., 2005; Vauterin et al., 1995). Because many of the genome sequences we examined are from closely related strains, in some cases associated with different species designations, we constructed a whole‐genome phylogenetic tree as described in Experimental procedures in order to organize these sequences by relatedness (Fig. S1, see Supporting Information). The topology of the resulting tree shares broad similarity with several other Xanthomonas phylogenetic trees in defining relationships between well‐sampled species (Ferreira‐Tonin et al., 2012; Gardiner et al., 2014; Hauben et al., 1997; Midha and Patil, 2014; Parkinson et al., 2007, 2009; Rademaker et al., 2005; Triplett et al., 2015; Young, 2008). To examine raxX‐raxSTAB gene cluster organization and inheritance more closely, we selected 15 genomes from strains that represent the phylogenetic range of Xanthomonas spp. (Table 1 and Fig. S1). Where possible, we chose complete genome sequences that are accompanied by published descriptions. The close relative Stenotrophomonas maltophilia, which does not contain the raxX‐raxSTAB gene cluster, served as the outgroup (Moore et al., 1997).
Table 1

Reference strains for sequence comparisons.

SpeciesStrain raxX‐raxSTAB AccessionReference
Stenotrophomonas maltophilia K279aNC_010943.1Crossman et al. (2008)
Xanthomonas albilineans GPE PC73NC_013722.1Pieretti et al. (2015)
X. arboricola pv. juglandis Xaj 417NZ_CP012251.1Pereira et al. (2015)
X. axonopodis pv. manihotis UA536+NZ_AKEQ00000000Bart et al. (2012)
X. campestris pv. campestris ATCC 33913NC_003902.1da Silva et al. (2002)
X. campestris pv. musacearum NCPPB 4392+NZ_AKBI00000000.1Wasukira et al. (2012)
X. cannabis NCPPB 2877NZ_JSZE00000000.1Jacobs et al. (2015)
X. citri ssp. citri 306NC_003919.1da Silva et al. (2002)
X. euvesicatoria 85‐10+NZ_CP017190.1Thieme et al. (2005)
X. fragariae LMG 25863NZ_AJRZ00000000.1Vandroemme et al. (2013)
X. hyacinthi DSM 19077JPLD00000000.1Naushad et al. (2015)
X. maliensis M97+NZ_AQPR00000000.1Triplett et al. (2015)
X. oryzae pv. oryzae PXO99A +NC_010717.2Salzberg et al. (2008)
X. sacchari R1NZ_CP010409.1Studholme et al. (2011)
X. translucens DAR61454+GCA_000334075.1Gardiner et al. (2014)
X. vesicatoria 15bNZ_JSXZ00000000.1Vancheva et al. (2015)
Reference strains for sequence comparisons. To facilitate discussion, we represent phylogenetic relationships between these strains as a cladogram that emphasizes the relative positions of the raxX‐raxSTAB gene cluster‐positive lineages (Fig. 3). Six distinct Xanthomonas lineages contain the raxX‐raxSTAB gene cluster, one being X. oryzae. A second lineage includes related strains, currently denoted as X. vasicola or X. campestris pv. musacearum (Aritua et al., 2008); for concise presentation, we refer to these collectively as X. vasicola. The third lineage includes X. euvesicatoria and related species (Rademaker group 9.2; Barak et al., 2016; Rademaker et al., 2005). The fourth lineage includes strains denoted as X. axonopodis, such as pv. manihotis (Rademaker group 9.4; Mhedbi‐Hajri et al., 2013; Rademaker et al., 2005). The fifth lineage includes X. translucens (Langlois et al., 2017), within the distinct cluster of ‘early‐branching’ species whose divergence from the remainder apparently occurred relatively early during Xanthomonas speciation (Parkinson et al., 2007). The sixth lineage comprises X. maliensis, associated with, but non‐pathogenic on, rice (Triplett et al., 2015). Phylogenetic analyses place this species between the ‘early‐branching’ species and the remainder (Triplett et al., 2015).
Figure 3

Model for raxX‐raxSTAB inheritance during Xanthomonas speciation. The Xanthomonas spp. cladogram is based on published phylogenetic trees (see text for references). Red lines depict lineages for strains that lack the raxX‐raxSTAB gene cluster, whereas blue lines depict those that carry the cluster. Numbers indicate gcvP length polymorphism in each species (Fig. S3, see Supporting Information). Hypothetical events are: A, formation of the raxX‐raxSTAB gene cluster; B, lateral gene transfer to X. translucens relatively early during speciation (indicated by the long blue line); C, lateral gene transfer to X. maliensis relatively late during speciation (indicated by the short blue line); D, loss from X. citri. Strain numbers denote sources of RaxX proteins chosen for functional tests, as described in the text.

Model for raxX‐raxSTAB inheritance during Xanthomonas speciation. The Xanthomonas spp. cladogram is based on published phylogenetic trees (see text for references). Red lines depict lineages for strains that lack the raxX‐raxSTAB gene cluster, whereas blue lines depict those that carry the cluster. Numbers indicate gcvP length polymorphism in each species (Fig. S3, see Supporting Information). Hypothetical events are: A, formation of the raxX‐raxSTAB gene cluster; B, lateral gene transfer to X. translucens relatively early during speciation (indicated by the long blue line); C, lateral gene transfer to X. maliensis relatively late during speciation (indicated by the short blue line); D, loss from X. citri. Strain numbers denote sources of RaxX proteins chosen for functional tests, as described in the text. Notably, the raxX‐raxSTAB gene cluster is absent from the group of strains classified as X. citri pathovars (Rademaker group 9.5; Bansal et al., 2017; Rademaker et al., 2005). These strains (some of which are denoted as X. axonopodis or X. campestris) cluster phylogenetically among four of the raxX‐raxSTAB gene cluster‐positive groups: X. oryzae, X. vasicola, X. euvesicatoria and X. axonopodis pv. manihotis (Midha and Patil, 2014; Rademaker et al., 2005; Vauterin et al., 1995). The simplest explanation for this pattern is that the raxX‐raxSTAB gene cluster was lost from an ancestor of the X. citri lineage (Fig. 3); other explanations are not excluded.

Sequence conservation of the raxX‐raxSTAB gene cluster suggests lateral gene transfer between Xanthomonas spp.

Both the organization and size of the raxX‐raxSTAB gene cluster are conserved across all six lineages. To assess inheritance patterns, we constructed a phylogenetic tree for the raxX‐raxSTAB gene cluster (as the catenation of the four rax genes; Fig. 4) (Kuo and Ochman, 2009). The rax genes in X. translucens, in the early‐branching group, cluster separately from their homologues in the other lineages. This finding is consistent with the hypothesis that X. translucens acquired the raxX‐raxSTAB gene cluster relatively early during Xanthomonas speciation. For X. maliensis, the raxX‐raxSTAB genes are most similar to those from X. euvesicatoria and the X. axonopodis pathovars manihotis and phaseoli (Fig. 4), even though the X. maliensis genome sequence itself is more distantly related (Fig. 3). This finding suggests that X. maliensis acquired the raxX‐raxSTAB gene cluster relatively late during Xanthomonas speciation.
Figure 4

Phylogenetic tree for raxX‐raxSTAB nucleotide sequences. The best scoring maximum likelihood tree for the catenated raxA, raxB, raxX and raxST coding sequences. Numbers shown on the branches represent the proportion of branches supported by 10 000 bootstrap replicates (0–100). Bootstraps are not shown for branches with less than 50% support, or for branches too short to easily distinguish. Species names are coloured according to phylogenetic group.

Phylogenetic tree for raxX‐raxSTAB nucleotide sequences. The best scoring maximum likelihood tree for the catenated raxA, raxB, raxX and raxST coding sequences. Numbers shown on the branches represent the proportion of branches supported by 10 000 bootstrap replicates (0–100). Bootstraps are not shown for branches with less than 50% support, or for branches too short to easily distinguish. Species names are coloured according to phylogenetic group.

Boundaries flanking the raxX‐raxSTAB gene cluster and adjacent genes suggest lateral gene transfer through general recombination

The raxX‐raxSTAB gene cluster lies between two core (housekeeping) genes (Fig. 1). One, gcvP, encodes the pyridoxal‐phosphate subunit of glycine dehydrogenase. An approximately 170‐nucleotide riboswitch (gcvR in Fig. 1) controls GcvP protein synthesis in response to glycine (Mandal et al., 2004). The other, ‘mfsX’, encodes a major facilitator subfamily (MFS) transporter related to Bcr and CflA efflux proteins (da Silva et al., 2004). Here, ‘mfsX’ is only a provisional designation in the absence of functional characterization. Comparing the gcvP–[raxX‐raxSTAB]–‘mfsX’ region from the reference genomes reveals sharp boundaries flanking the position of the raxX‐raxSTAB gene cluster. On the left flank, substantial nucleotide identity spans the gcvP gene, the gcvR riboswitch and a predicted gcvR promoter –10 element (Mitchell et al., 2003) (Fig. S2, see Supporting Information). On the right flank, identity begins shortly after the ‘mfsX’ initiation codon. Accordingly, upstream sequence elements for initiating ‘mfsX’ gene transcription (Mitchell et al., 2003) and translation (Ma et al., 2002) are conserved within, but not between, raxX‐raxSTAB gene cluster‐positive and cluster‐negative sequences (Fig. S2). Between these boundaries in genomes that lack the raxX‐raxSTAB gene cluster, the compact (≤200 nucleotide) gcvP–‘mfsX’ intergenic sequence is modestly conserved in most genomes (about 60%–80% overall identity; Fig. S2). Much of this identity comes from the ‘mfsX’ potential transcription and translation initiation sequences described above. The overall intergenic sequence is less conserved in the early‐branching species (X. albilineans, X. hyacinthi and X. sacchari), displaying about 50%–65% overall identity. We hypothesize that raxX‐raxSTAB gene cluster phylogenetic distribution results from general recombination between conserved genes flanking each side (e.g. in or beyond the gcvP and ‘mfsX’ genes). Two observations are consistent with this hypothesis. First, we observed that the sequences flanking the raxX‐raxSTAB gene cluster are different from the gcvP–‘mfsX’ intergenic sequence in genomes that lack the raxX‐raxSTAB gene cluster (Fig. S2). This is inconsistent with a mechanism through which the raxX‐raxSTAB gene cluster integrated into the gcvP–‘mfsX’ intergenic sequence during lateral gene transfer events. The second observation consistent with lateral gene transfer via general recombination is that gcvP length polymorphisms (Figs 1 and S3, see Supporting Information) do not align with Xanthomonas phylogenetic relationships (Fig. 3). Inheritance patterns such as this often result from general recombination in the vicinity (Nelson et al., 1997). Notably, this gcvP–‘mfsX’ intergenic region is also conserved in the X. citri lineage (Fig. S2). If the raxX‐raxSTAB gene cluster was lost during formation of this lineage (see above), general recombination would replace the resident raxX‐raxSTAB gene cluster with a donor conserved gcvP–‘mfsX’ region.

raxST, but not raxX, homologues are present in genomes from diverse bacterial species

Our GenBank database searches identified raxX homologues and the raxX‐raxSTAB gene cluster only in Xanthomonas spp. However, these searches did identify raxST homologues encoding proteins with about 40% identity to, and approximately the same length as, the Xoo RaxST protein. These sequences include the PAPS binding motifs that define sulfotransferase activity (Negishi et al., 2001; da Silva et al., 2004). Regardless of its current function, a raxST homologue potentially could evolve to encode tyrosylprotein sulfotransferase activity. None of these raxST homologues is associated with a raxX homologue, and most are also not associated with raxA or raxB homologues. Presumably, the enzymes by these raxST homologues act on substrates other than RaxX. These raxST homologues support the hypothesis that the raxSTAB cluster arose from a new combination of pre‐existing raxST, raxA and raxB homologues. Proteolytic maturation and ATP‐dependent peptide secretion systems are broadly distributed, and so raxA and raxB homologues are plentiful in bacterial genomes (Holland et al., 2016). These raxST homologues occur in diverse genetic contexts in a range of bacterial phyla, including Proteobacteria and Cyanobacteria (Fig. S4, see Supporting Information). Nevertheless, for most species represented by multiple genome sequences, the raxST homologue was detected in a minority of individuals, and so it is not part of the core genome in these strains. Moreover, relationships between species in a raxST gene phylogenetic tree bear no resemblance to those in the overall tree of bacterial species. For example, in the raxST gene tree, sequences from Cyanobacteria are flanked on both sides by sequences from Proteobacteria (Fig. S4). Together, these findings provide evidence for lateral gene transfer of raxST homologues (Kuo and Ochman, 2009).

RaxX protein sequence variants representing all six raxX‐raxSTAB gene cluster‐positive lineages

RaxX protein sequences from diverse Xanthomonas spp. assort into several sequence groups differentiated by polymorphisms within the predicted mature peptide sequence (Fig. 2) (Pruitt et al., 2017). Many of these groups are subdivided further according to polymorphisms in the predicted leader protein sequence (residues 1–39) or carboxyl‐terminal region distal to residue Pro‐52. Most leader polymorphisms lie between residues 2 and 24, and are unlikely to affect the function of the mature RaxX protein. Here, we only consider polymorphisms in the predicted mature form. To assess the function of RaxX variants, we focused on frequently observed variants in species represented by numerous genome sequences (Fig. S1). These include sequence groups A, B and D from X. oryzae pv. oryzae and X. oryzae pv. oryzicola, as well as sequence groups E, G and H, representing most genomes for the X. euvesicatoria and X. vasicola groups (Fig. 2). Finally, sequence group K is most numerous among X. translucens genomes. The comparison reference is the RaxX protein sequence from the Philippines Xoo strain PXO99A (sequence group A). Examples from lower frequency (mostly unique) sequence groups were analysed by complementation, as described below.

RaxX variants promote root growth, but fail to activate the XA21‐mediated immune response

We generated and purified tyrosine‐sulfated, full‐length (unprocessed) RaxX peptides for these seven variants using an expanded genetic code approach (see Experimental procedures) (Fig. 2), together representing all five pathogenic lineages that contain the raxX‐raxSTAB gene cluster. The positive control is RaxX21‐sY, a synthetic 21‐residue tyrosine‐sulfated peptide with strong activity; non‐sulfated peptides have undetectable activity (Pruitt et al., 2015). The seven RaxX variant peptides were used in two separate assays for function. First, we performed root growth experiments with an Arabidopsis thaliana tpst‐1 mutant lacking tyrosylprotein sulfotransferase, which is required for all known sulfated tyrosine peptide hormones, including PSY (Matsubayashi, 2014). This eliminates endogenous PSY activity, so that the effects of the added peptides are more easily observed (Matsubayashi, 2014; Pruitt et al., 2017). Root lengths for seedlings grown without added peptide averaged 23.5 mm, whereas root lengths for seedlings grown with 100 nm peptide were at least twice as long (Fig. 5A,B). This observation is consistent with the hypothesis that these peptides mimic PSY1 peptide hormone activity. It should be noted that three of these variants (groups D, E and G) have been examined previously (Pruitt et al., 2017) and are included here to facilitate direct comparisons, as well as to monitor the consistency of the results.
Figure 5

RaxX variant peptides promote root growth. (A) Stimulation of Arabidopsis root growth. Fourteen‐day‐old tpst‐1 seedlings were grown on half‐strength Murashige and Skoog (½ MS) vertical plates with or without 100 nm of the indicated full‐length peptides. Bars indicate the average seedling root length measured after 14 days (n > 10). Error bars show the standard deviation. Asterisk indicates a statistically significant difference from Mock using Dunnett’s test (P < 0.05). Peptide RaxX sY21 is a 21‐residue sulfated peptide with potent RaxX activity (Pruitt et al., 2015). Strain abbreviations: Xvv, Xanthomonas vasicola pv. vasculorum; Xt, X. translucens; Xe, X. euvesicatoria; Xcm, X. campestris pv. musacearum; PXO99A, IXO685, AXO1947, strains of X. oryzae pv. oryzae. (B) Arabidopsis seedlings from a representative experiment. (C) Activation of rice PR10b gene expression. Purified peptide (500 nm) was used to treat detached leaves as described in Experimental procedures. Expression levels of the PR10b gene (normalized to actin gene expression) were determined after 12 h. Data are the mean values from four biological replicates. Error bars show the standard deviation. Asterisk indicates a statistically significant difference from Mock using Dunnett’s test (P < 0.05).

RaxX variant peptides promote root growth. (A) Stimulation of Arabidopsis root growth. Fourteen‐day‐old tpst‐1 seedlings were grown on half‐strength Murashige and Skoog (½ MS) vertical plates with or without 100 nm of the indicated full‐length peptides. Bars indicate the average seedling root length measured after 14 days (n > 10). Error bars show the standard deviation. Asterisk indicates a statistically significant difference from Mock using Dunnett’s test (P < 0.05). Peptide RaxX sY21 is a 21‐residue sulfated peptide with potent RaxX activity (Pruitt et al., 2015). Strain abbreviations: Xvv, Xanthomonas vasicola pv. vasculorum; Xt, X. translucens; Xe, X. euvesicatoria; Xcm, X. campestris pv. musacearum; PXO99A, IXO685, AXO1947, strains of X. oryzae pv. oryzae. (B) Arabidopsis seedlings from a representative experiment. (C) Activation of rice PR10b gene expression. Purified peptide (500 nm) was used to treat detached leaves as described in Experimental procedures. Expression levels of the PR10b gene (normalized to actin gene expression) were determined after 12 h. Data are the mean values from four biological replicates. Error bars show the standard deviation. Asterisk indicates a statistically significant difference from Mock using Dunnett’s test (P < 0.05). In the second assay, we tested each RaxX peptide for direct activation of XA21‐mediated immunity by assaying the induction of the PR10b marker gene as a readout for immune activation (Pruitt et al., 2015; Thomas et al., 2016). In contrast with the results from the root growth assay, only the group A RaxX protein (from Xoo strain PXO99A) was able to induce XA21‐mediated PR10b marker gene expression (Fig. 5C). In a separate test for the activation of XA21‐mediated immunity, we used a ∆raxX deletion mutant of Xoo strain PXO99A as a host for genetic complementation. We tested each of the raxX alleles shown in Fig. 2, which includes examples from lower frequency (mostly unique) sequence groups. We introduced each raxX allele into the ∆raxX test strain, and monitored disease progression in leaves of whole plants. Only the group A raxX allele (from Xoo strain PXO99A) was able to complement the Xoo PXO99A ∆raxX strain to activate XA21‐mediated immunity (Fig. 6). The expression of each raxX allele was confirmed by quantitative polymerase chain reaction (qPCR) (Fig. S5, see Supporting Information).
Figure 6

RaxX variants fail to activate XA21‐mediated immunity. Different raxX genes were cloned into vector pVSP6 (see Experimental procedures) to test for complementation of the Xanthomonas oryzae pv. oryzae (Xoo) strain PXO99A ∆raxX strain. Leaf tips of rice varieties TP309 (A) or XA21‐expressing TP309 (B) were inoculated by clipping with scissors dipped in bacterial suspensions (approximate cell density of 8 × 108 cells/mL). Lesion lengths were measured 14 days after inoculation. Data are the mean values from measurements of 10–20 leaves. Error bars show the standard error of the mean, and asterisks indicate a statistically significant difference from Xoo strain PXO99A according to Dunnett’s multiple comparison procedure (P < 0.05). Values in (A) are insignificantly different. Strain abbreviations: Xvv, X. vasicola pv. vasculorum; Xt, X. translucens; Xoc, X. oryzae pv. oryzicola; Xe, X. euvesicatoria; Xcm, X. campestris pv. musacearum; X8‐1A, X11‐5A, strains of X. oryzae; M97, X. maliensis M97; PXO99A, IXO685, AXO1947, strains of X. oryzae pv. oryzae.

RaxX variants fail to activate XA21‐mediated immunity. Different raxX genes were cloned into vector pVSP6 (see Experimental procedures) to test for complementation of the Xanthomonas oryzae pv. oryzae (Xoo) strain PXO99A ∆raxX strain. Leaf tips of rice varieties TP309 (A) or XA21‐expressing TP309 (B) were inoculated by clipping with scissors dipped in bacterial suspensions (approximate cell density of 8 × 108 cells/mL). Lesion lengths were measured 14 days after inoculation. Data are the mean values from measurements of 10–20 leaves. Error bars show the standard error of the mean, and asterisks indicate a statistically significant difference from Xoo strain PXO99A according to Dunnett’s multiple comparison procedure (P < 0.05). Values in (A) are insignificantly different. Strain abbreviations: Xvv, X. vasicola pv. vasculorum; Xt, X. translucens; Xoc, X. oryzae pv. oryzicola; Xe, X. euvesicatoria; Xcm, X. campestris pv. musacearum; X8‐1A, X11‐5A, strains of X. oryzae; M97, X. maliensis M97; PXO99A, IXO685, AXO1947, strains of X. oryzae pv. oryzae. Together, these results provide direct evidence that the activation of XA21‐mediated immunity is restricted to RaxX proteins from sequence group A, found in most strains of Xoo. None of the other X. oryzae RaxX variants tested (including RaxX from X. oryzae pv. oryzicola, for which the mature sequence is identical to that of Xoo strain IXO685), was able to activate XA21‐mediated immunity. The observation that all RaxX proteins tested stimulated Arabidopsis root growth suggests that the RaxX PSY peptide mimicry function is not restricted to rice.

African Xoo strain AXO1947 RaxX and RaxST natural variants both lead to evasion of the XA21 immune receptor

The raxX alleles from Xoo strains IXO685 and AXO1947 failed to complement the ∆raxX mutant of Xoo strain PXO99A for XA21 immune activation (Fig. 6). In addition to its variant raxX allele (Fig. 2), we noted that Xoo strain AXO1947 (Huguet‐Tapia et al., 2016) carries seven missense polymorphisms in the raxST gene (Fig. S6, see Supporting Information) not present in other Xoo strains, such as IXO685. To determine if the variant raxST allele from strain AXO1947 encodes a functional protein, we performed additional complementation tests. We found that the raxX allele from strain PXO99A conferred the XA21 immune activation phenotype on strain IXO685, but not on strain AXO1947 (Fig. 7B). This result suggests that the raxX variant allele is not the only factor that prevents strain AXO1947 from activating the XA21 immune response. Consistent with this hypothesis, the raxST allele from strain PXO99A failed to confer the XA21 immune activation phenotype on strain AXO1947 (Fig. 7D). In contrast, the addition of both the raxX and raxST alleles from strain PXO99A was sufficient to confer the XA21 immune activation phenotype on strain AXO1947 (Fig. 7F).
Figure 7

The raxX and raxST genes are dysfunctional in Xanthomonas oryzae pv. oryzae (Xoo) strain AXO1947. Different combinations of the raxX and raxST genes were cloned into vector pVSP61 (see Experimental procedures) to test for complementation. Leaf tips of rice varieties TP309 (A, C and E) or XA21‐expressing TP309 (B, D and F) were inoculated by clipping with scissors dipped in bacterial suspensions (approximate cell density of 8 × 108 cells/mL). Lesion measurements were taken 14 days after inoculation. Data are the mean values from measurements of 10–20 leaves. Error bars show the standard error of the mean, and asterisks indicate a statistically significant difference from Xoo strain PXO99A according to Dunnett’s multiple comparison procedure (P < 0.05). Values in (A), (C) and (E) are not significantly different. (A) and (B) show complementation results for the raxX gene, (C) and (D) show results for the raxST gene, and (E) and (F) show results for the combination of both the raxX and raxST genes. Specific combinations of genes and complementation hosts are described in the figure labels.

The raxX and raxST genes are dysfunctional in Xanthomonas oryzae pv. oryzae (Xoo) strain AXO1947. Different combinations of the raxX and raxST genes were cloned into vector pVSP61 (see Experimental procedures) to test for complementation. Leaf tips of rice varieties TP309 (A, C and E) or XA21‐expressing TP309 (B, D and F) were inoculated by clipping with scissors dipped in bacterial suspensions (approximate cell density of 8 × 108 cells/mL). Lesion measurements were taken 14 days after inoculation. Data are the mean values from measurements of 10–20 leaves. Error bars show the standard error of the mean, and asterisks indicate a statistically significant difference from Xoo strain PXO99A according to Dunnett’s multiple comparison procedure (P < 0.05). Values in (A), (C) and (E) are not significantly different. (A) and (B) show complementation results for the raxX gene, (C) and (D) show results for the raxST gene, and (E) and (F) show results for the combination of both the raxX and raxST genes. Specific combinations of genes and complementation hosts are described in the figure labels. Taken together, these results suggest that Xoo strain AXO1947 contains mutant versions of both genes, raxST and raxX. Analysis by quantitative reverse transcription‐polymerase chain reaction (qRT‐PCR) confirms that these genes are expressed in the complemented strains (Fig. S7, see Supporting Information).

RaxST variants from Xoo strain AXO1947

To determine which of the RaxST missense polymorphisms is responsible for the apparent reduction in enzyme activity, we used site‐specific mutagenesis to introduce each individually into the raxST gene from strain PXO99A. Genes encoding two of these [histidine‐50 (His‐50) to aspartic acid (Asp) (H50D) and arginine‐129 (Arg‐129) to leucine (Leu) (R129L)] were unable to complement the ∆raxST mutant of Xoo strain PXO99A for XA21 immune activation (Fig. 8), indicating that both His‐50 and Arg‐129 are necessary for RaxST activity.
Figure 8

Two missense substitutions inactivate RaxST in Xoo strain AXO1947. Each of the seven raxST missense polymorphisms from Xoo strain AXO1947 was introduced singly into the wild‐type raxST gene from Xoo strain PXO99A (see Experimental Procedures). These mutant alleles then were tested for complementation of the Xoo strain PXO99A ∆raxST strain. Leaf tips of rice varieties TP309 (panel A) or XA21‐expressing TP309 (panel B) were inoculated by clipping with scissors dipped in bacterial suspensions (approximate cell density of 8 × 108 cells mL−1). Lesion measurements were taken 14 days after inoculation. Data are the mean values from measurements of 10–20 leaves. Error bars show the standard error of the mean, and “*” indicates a statistically significant difference from Xoo strain PXO99A according to Dunnett’s multiple comparison procedure (P < 0.05).

Two missense substitutions inactivate RaxST in Xoo strain AXO1947. Each of the seven raxST missense polymorphisms from Xoo strain AXO1947 was introduced singly into the wild‐type raxST gene from Xoo strain PXO99A (see Experimental Procedures). These mutant alleles then were tested for complementation of the Xoo strain PXO99A ∆raxST strain. Leaf tips of rice varieties TP309 (panel A) or XA21‐expressing TP309 (panel B) were inoculated by clipping with scissors dipped in bacterial suspensions (approximate cell density of 8 × 108 cells mL−1). Lesion measurements were taken 14 days after inoculation. Data are the mean values from measurements of 10–20 leaves. Error bars show the standard error of the mean, and “*” indicates a statistically significant difference from Xoo strain PXO99A according to Dunnett’s multiple comparison procedure (P < 0.05). Little is known about RaxST structure and function. Diverse sulfotransferases share limited sequence similarity, mostly comprising two relatively short sequence motifs involved in PAPS binding (Negishi et al., 2001). These motifs are conserved in the Xoo RaxST sequence (da Silva et al., 2004). Research with diverse sulfotransferases has identified three essential residues: a positively charged residue (corresponding to Arg‐11 in RaxST) in one PAPS binding motif, an invariant serine (Ser) (corresponding to Ser‐118 in RaxST) in the other and a catalytic base [His or glutamic acid (Glu)] located between the two PAPS binding motifs (Negishi et al., 2001). We generated a RaxST molecular model with the program iTasser (Yang and Zhang, 2015) using the crystal structure of human tyrosylprotein sulfotransferase‐2 (TPST2) as a template (PDB: 3AP1). The sequence alignment is shown in Fig. S8 (see Supporting Information). TPST2 is a functional dimer (Teramoto et al., 2013), which is replicated in the RaxST structural model (Fig. S9, see Supporting Information). The two essential residues identified from Xoo strain AXO1947, His‐50 and Arg‐129, display surface‐exposed side chains in close proximity to the corresponding position for the bound substrate peptide co‐crystallized with TPST2. These residues are distal to the catalytic site. Therefore, we hypothesize that these RaxST residues are involved in RaxX peptide binding.

Discussion

Previously, we hypothesized that RaxX mimics the actions of PSY hormones, and that the XA21 receptor evolved specifically to recognize RaxX from Xoo (Pruitt et al., 2015, 2017). This prediction is supported here by our finding that all the RaxX variants tested stimulate root growth (Fig. 5A,B) (Pruitt et al., 2017), but fail to activate the XA21‐mediated immune response (Figs 5C and 6). Thus, RaxX sequence determinants are more stringent for XA21‐mediated immunity activation than for root growth stimulation. In this discussion, we consider two questions: (1) what are the potential selective pressures acting on RaxX that affect sequence variation; and (2) how was the raxX‐raxSTAB gene cluster inherited in Xanthomonas spp.?

Opposing selection pressures drive RaxX natural variation

Maintenance of the raxX‐raxSTAB gene cluster (Fig. 3) suggests that RaxX provides fitness benefits to diverse Xanthomonas spp., presumably during their interactions with hosts that collectively encompass a range of monocot and dicot species. This hypothesis is supported by in vivo data showing that Xoo strains lacking the raxX or raxST genes are compromised for virulence (Pruitt et al., 2015, 2017). On the other hand, rice‐restricted XA21‐mediated immunity would select specifically against RaxX maintenance by Xoo. Analysis of raxX‐raxSTAB gene cluster sequence polymorphisms suggests that both types of selection occur. The Xa21 gene has been introgressed into commercial rice varieties (Khush et al., 1990; Midha et al., 2017). Widespread planting of Xa21 rice presumably increases selection for Xoo variants that evade XA21‐mediated immunity. All RaxX missense variants examined mimicked PSY hormone activity (Fig. 5A,B) (Pruitt et al., 2017), suggesting that this property confers a selective advantage. Consistent with this, we did not observe any raxX frameshift or nonsense alterations. Instead, RaxX variant sequences contain a restricted set of missense substitutions, consistent with the hypothesis that selection acts to retain PSY‐like function (Fig. 2; see Pruitt et al., 2017). Among all RaxX variants tested, only that from Xoo strain PXO99A (which represents the large majority of Xoo raxX alleles) activated the XA21‐mediated immune response (Figs 5C and 6). This result demonstrates that recognition of RaxX by XA21 is strictly limited to Xoo, and confirms and extends a previous conclusion from our laboratory that residues Pro‐44 and Pro‐48 are both required for Xoo RaxX recognition by XA21 (Pruitt et al., 2015). Thus, it appears that some Xoo strains that evade activation of XA21‐mediated immunity arise from a restricted set of raxX missense substitution alleles encoding variants that retain PSY‐like function. This observation suggests that it may be possible to engineer novel XA21 variants that recognize these variant RaxX proteins. If so, it may then be possible to engineer broad‐spectrum resistance against Xoo (and other raxX‐raxSTAB gene cluster‐positive Xanthomonas spp.) by expressing multiple XA21 proteins that collectively recognize multiple RaxX variants. We also identified raxST and/or raxA gene loss‐of‐function alterations in Xoo field isolates (Fig. 7; da Silva et al., 2004), which presumably cannot express the PSY mimicry phenotype of RaxX. Such loss‐of‐function alterations could temper the effectiveness of production strategies that rely on engineered Xa21 alleles.

raxX‐raxSTAB gene cluster origin

The raxAB genes are homologous to those encoding proteolytic maturation and ATP‐dependent peptide secretion complexes (Lin et al., 2015; da Silva et al., 2004), related to type I secretion systems, but specialized for the secretion of small peptides, such as bacteriocins and peptide pheromones (Holland et al., 2016). Frequently, the gene encoding the secreted substrate is adjacent to genes encoding components of the secretion complex (Dirix et al., 2004). We hypothesize that the intact raxX‐raxSTAB gene cluster originated in an ancestor to the lineage containing X. oryzae, X. euvesicatoria and related species, with subsequent gains or losses through lateral gene transfer (Fig. 2). Relatively few events appear to have been necessary to form the raxX‐raxSTAB gene cluster. The raxX gene might have evolved from the gene for the secreted peptide substrate of the RaxAB ancestor. The complete cluster would result from the incorporation of the ancestral raxST gene, homologues of which are distributed broadly (Fig. S4).

Role of the raxX‐raxSTAB gene cluster in Xanthomonas biology

The raxX‐raxSTAB gene cluster does not exhibit features characteristic of self‐mobile genomic islands, such as a gene for a site‐specific recombinase (Hacker et al., 1997). Instead, evidence suggests that raxX‐STAB gene cluster lateral gene transfer occurred through general recombination between genes flanking each side of the raxX‐STAB gene cluster (Figs 1 and S2). In bacteria, gene acquisition through lateral gene transfer contributes to the emergence of new pathovars (for one example, see Ogura et al., 2009). Conceivably, lateral acquisition of the raxX‐raxSTAB gene cluster might allow a particular strain to infect a previously inaccessible host. Xanthomonas pathovar phenotypes (Jacques et al., 2016) are not predicted by the presence or absence of the raxX‐raxSTAB gene cluster. For example, some raxX‐raxSTAB gene cluster‐positive species can infect only monocots (e.g. X. oryzae, X. translucens) or only dicots (e.g. X. euvesicatoria), just as some raxX‐raxSTAB gene cluster‐negative species can also infect only monocots (e.g. X. arboricola, X. hyacinthi) or only dicots (e.g. X. campestris pv. campestris, X. citri). Similarly, some raxX‐raxSTAB gene cluster‐positive species are specific for vascular tissue (e.g. Xoo, X. vasicola) or for non‐vascular tissue (e.g. X. oryzae pv. oryzicola, X. euvesicatoria), just as some raxX‐raxSTAB gene cluster‐negative species are also specific for vascular tissue (e.g. X. hortorum, X. albilineans) or for non‐vascular tissue (e.g. X. citri, X. arboricola). Thus, selective function(s) for the raxX‐raxSTAB gene cluster in Xanthomonas spp. remain to be determined.

Experimental Procedures

Survey of raxX‐STAB homologues in publicly available databases

We used the 5‐kb‐long Xoo PXO99A raxX‐raxSTAB genomic region, including 600 bp upstream of raxST and 70 bp downstream of raxB, as query to search the following NCBI databases with blastn and megablast using an e‐value cut‐off of 1e‐3: nr/nt, htgs, refseq_genomic_representative_genomes, refseq_genomic and gss. To identify RaxX homologues, we used the protein sequence of RaxX from Xoo PXO99A as query to search the same databases using tblastn with a PAM30 scoring matrix to account for the short sequence length of RaxX. In case of raxST from Xoo PXO99A, we used the genomic coding sequence to search the same databases using the same cut‐offs. In addition, we used the RaxST protein sequence to search the following database using blastp with an e‐value cut‐off of 1e‐3 and a BLOSUM62 scoring matrix: nr, refseq_protein, env_nr. The databases were last accessed on 6 January 2016 for the initial manuscript submission and 25 June 2018 during preparation of the resubmission. Searches were restricted to bacteria (taxid: 2) in the case of refseq_genomic_representative_genomes. The observations of the specificity of raxX and the intact raxX‐raxSTAB gene cluster to the genus Xanthomonas were consistent across all queries.

Whole‐genome‐based phylogenetic tree for Xanthomonas spp.

All available Xanthomonas genomes were downloaded from the NCBI ftp server on 29 January 2016 (413 genome accessions). The genome fasta files were used to build a local blast database using blastv2.27+ (Camacho et al., 2009). For all genes in and surrounding the raxSTAB cluster, blastn (e‐value cut‐off of 1e‐3) was used to identify homologues in the local blast database. As a result of the small size of RaxX, tblastn was required to identify homologues (e‐value cut‐off of 1e‐3). Fasta files for each blast hit were generated using a custom python script (available on request). Alignments of all genes were performed with Muscle v3.5 (Edgar, 2004) implemented in the desktop tool Geneious v9.1.8 (Kearse et al., 2012). Alignment ends were trimmed so that each sequence was equal in length and in the first coding frame. Maximum likelihood (ML) trees were built with RaxML v8.2.4 (Stamatakis, 2014) with the following settings: (‐m GTRGAMMA F ‐f a ‐x 3298589 ‐N 10000 ‐p 23). Trees shown in all figures are the highest scoring ML trees, and the numbers shown on the branches are the resampled bootstrap values from 1000 replicates. Trees were drawn in FigTree v1.4.0 (http://tree.bio.ed.ac.uk/software/figtree/). Whole‐genome phylogenies were generated using the entire genome assembly with the program Andi v0.10 (Haubold et al., 2015; Klotzl and Haubold, 2016). These distance matrices were plotted as neighbour‐joining trees using Phylip v3.695 (Felsenstein, 1981). The numbers on the branches represent the proportion (0–100) that the branch appeared in the ‘bootstrapped’ distance matrices using Andi.

Sequence analyses

Nucleotide and deduced amino acid sequences were edited and analysed with the programs EditSeq™ (version 14.1.0), MegAlign™ (version 14.1.0) and SeqBuilder™ (version 14.1.0), DNASTAR, Madison, WI, USA. The Integrated Microbial Genomes interface (Chen et al., 2017) was used to compare genome segments from different species.

Bacterial growth

Xanthomonas strains were cultured at 28 °C. Solid medium was peptone sucrose agar (PSA; pH 7.0), which contains (per litre) peptone (10 g), sucrose (10 g), sodium glutamate (1 g) and agar (15 g). Liquid cultures were aerated at 230 rpm in YEB medium (pH 7.3), which contains (per litre) yeast extract (5 g), tryptone (10 g), NaCl (5 g), sucrose (5 g) and MgSO4 (0.5 g). Antibiotics were kanamycin, carbenicillin, spectinomycin (all at 50 µg/mL) and cephalexin (20 µg/mL).

Rice growth and inoculation

Oryza sativa ssp. japonica rice varieties were TP309 and XA21‐TP309, which is a 106‐17‐derived transgenic line of TP309 carrying the Xa21 gene expressed from its native promoter (Song et al., 1995). TP309 rice does not contain the Xa21 gene. Seeds were germinated in distilled water at 28 °C for 1 week and then transplanted into sandy soil (80% sand, 20% peat; Redi‐Gro, Sacramento, CA) in 5.5‐in square pots with two seedlings per pot. Plants were grown in tubs in a glasshouse, and were top watered daily with fertilizer water (N, 58 ppm; P, 15 ppm; K, 55 ppm; Ca, 20 ppm; Mg, 13 ppm; S, 49 ppm; Fe, 1 ppm; Cu, 0.06 ppm; Mn, 0.4 ppm; Mo, 0.02 ppm; Zn, 0.1 ppm; B, 0.4 ppm) for 4 weeks, followed by water for 2 weeks. Six weeks after planting, rice pots were transferred to a growth chamber with the following day/night settings: 28 °C/24 °C, 80%/85% humidity and 14‐h/10‐h lighting. Plants were inoculated 2–3 days after transfer using the scissors clipping method (Song et al., 1995). Bacteria for inoculation were taken from PSA plates and resuspended in water at a density of approximately 8 × 108 colony‐forming units (CFU)/mL. Water‐soaked lesions were measured 14 days after inoculation.

Complementation tests

The Xoo strain PXO99A marker‐free deletions ∆raxX and ∆raxST have been described previously (Pruitt et al., 2015). Site‐specific mutational alterations were introduced by PCR using the In‐Fusion HD cloning system (Takara, Mountain View, CA). The raxX and raxST genes from different Xanthomonas spp. were cloned into plasmid vector pVS61 and electrotransformed into the appropriate recipient strains, as described previously (Pruitt et al., 2015). qRT‐PCR was performed as described previously (Pruitt et al., 2015). Gene expression was normalized to the chromosomal gene PXO_01660 (annotated as a homologue of the ampC gene encoding β‐lactamase). DNA primers for qRT‐PCR were: ampC‐F, GACTCGTAATGCCTACGACC; ampC‐R, AATTGCTCGTAGAAGCTGCC; qraxST‐F, CTTCCAACGTGCAGATCGAC; qraxST‐R, TATCGACGATCCAACCAAC; qraxX‐F, AAAATCGCCCGCCAAGGGT; qraxX‐R, TCAATGGTGCCCGGGGTTG.

RaxX peptide stimulation of PR10b gene expression

Full‐length sulfated RaxX proteins were purified from an Escherichia coli strain with an expanded genetic code that directs the incorporation of sulfotyrosine at the appropriate position (Schwessinger et al., 2016). The resulting MBP‐3C–RaxX‐His fusion proteins were incubated with 3C protease, followed by anion exchange chromatography, in order to remove the amino‐terminal maltose binding protein tag, as described previously (Schwessinger et al., 2016). The control peptide, sulfated RaxX21‐sY, has been described previously (Pruitt et al., 2015). Rice plants were grown in a hydroponic system in growth chambers at 24 or 28 °C with a 14‐h/10‐h light–dark cycle at 80% humidity. Seedlings were grown in A‐OK Starter Plugs (Grodan, Milton, ON, Canada) and watered with Hoagland’s solution twice a week. Peptide influence on PR10b marker gene expression was measured as described previously (Pruitt et al., 2015). Briefly, leaves of 4‐week‐old hydroponically grown rice plants were cut into 2‐cm‐long strips and incubated for at least 12 h in double‐distilled H2O to reduce residual wound signals. Leaf strips were treated with the indicated peptides and then snap‐frozen in liquid nitrogen before processing. qRT‐PCR was performed as described previously (Pruitt et al., 2015). Gene expression was normalized to the actin gene expression level and to the respective mock‐treated control at 0 or 9 h. DNA primers for qRT‐PCR were: PR10b‐F, TGTGGAAGGTCTGCTTGGAC; PR10b‐R, CCTTTAGCACGTGAGTTGCG. Fig. S1 Whole‐genome‐based Xanthomonas phylogenetic tree. This tree was constructed by the analysis of whole‐genome sequences, as described in Experimental procedures. Blue indicates genomes that contain the raxX‐raxSTAB gene cluster; red indicates genomes that do not. Group numbers are arbitrary. Click here for additional data file. Fig. S2 Sequences flanking the raxX‐raxSTAB gene cluster. Sequences are from the reference strains described in Table 1. Sequences conserved within a group, but different from other groups, are coloured green (‘early‐branching’ species), brown (raxX‐raxSTAB cluster‐negative strains) or yellow (raxX‐raxSTAB cluster‐positive strains). For presentation, the sequence is divided into left and right boundaries. The green and brown sequences are contiguous, whereas the yellow sequences are interrupted by the c. 5‐kb raxX‐raxSTAB gene cluster, depicted as a yellow rectangle. For presentation, approximately 60–80 nucleotides with relatively low similarity were removed from the sequence shown in the right boundary panel. These conceptual deletions are denoted by the number of nucleotides removed in each case. Black sequences are conserved in all lineages, and include both coding regions as well as matches to transcription and translation initiation consensus sequences, which are described in the text. An ‘mfsX’ + 1 frameshift in Xoo sequences is indicated by the vertical red line. Abbreviations are in red for raxX‐raxSTAB cluster‐negative strains and in blue for raxX‐raxSTAB cluster‐positive strains: Sm, Stenotrophomonas maltophilia; Xa, Xanthomonas albilineans; Xac, X. citri ssp. citri; Xaj, X. arboricola pv. juglandis; Xam, X. axonopodis pv. manihotis; Xc, X. cannabis; Xcc, X. campestris pv. campestris; Xcm, X. campestris pv. musacearum; Xe, X. euvesicatoria; Xf, X. fragariae; Xh, X. hyacinthi; Xm, X. maliensis; Xoo, X. oryzae pv. oryzae; Xs, X. sacchari; Xt, X. translucens; Xv, X. vesicatoria. Click here for additional data file. Fig. S3 GcvP length polymorphisms in different Xanthomonas lineages. The relevant portion of the GcvP amino acid sequence is shown for each of the reference strains. Species in red lack the raxX‐raxSTAB gene cluster, whereas those in blue carry the cluster. Numbers denote different allelic types for reference to Fig. 3. The positions of residues Gly‐733 and Val‐738 (numbering for allelic type 1) are indicated. Abbreviations: Sm, Stenotrophomonas maltophilia; Xa, Xanthomonas albilineans; Xac, X. citri ssp. citri; Xaj, X. arboricola pv. juglandis; Xam, X. axonopodis pv. manihotis; Xc, X. cannabis; Xcc, X. campestris pv. campestris; Xcm, X. campestris pv. musacearum; Xe, X. euvesicatoria; Xf, X. fragariae; Xh, X. hyacinthi; Xm, X. maliensis; Xoo, X. oryzae pv. oryzae; Xs, X. sacchari; Xt, X. translucens; Xv, X. vesicatoria. Click here for additional data file. Fig. S4 Phylogenetic tree for raxST homologues. Distribution of raxST homologues across bacterial genera, including the major groups of proteobacteria as well as cyanobacteria. The tree shown was constructed by neighbour‐joining with 1000 bootstrap replicates; branches with <50% bootstrap support are not drawn. The raxST sequence from Xanthomonas oryzae pv. oryzae (Xoo) strain PXO99A was used as query for tblastn. Click here for additional data file. Fig. S5 raxX expression in Xanthomonas oryzae pv. oryzae (Xoo) PXO99A complemented strains. Data show raxX gene expression in the complemented strains with different raxX alleles with its promoter region on plasmids. The expression is shown as the logarithm of raw data using quantitative reverse transcription‐polymerase chain reaction (qRT‐PCR). Data are the mean values from two biological replicates. Error bars show the standard deviation. Click here for additional data file. Fig. S6  RaxST sequence polymorphisms in Xanthomonas oryzae pv. oryzae (Xoo) strain AXO1947. The RaxST sequence from Xoo strain PXO99A is shown. The seven missense substitutions in the sequence from Xoo strain AXO1947 (Huguet‐Tapia et al., 2016) are indicated. The boundaries of the 3′‐phosphoadenosine 5′‐phosphosulfate (PAPS) binding motifs (5′‐PSB and 3′‐PB; Negishi et al., 2001), enclosed in boxes, include the catalytic residues Arg‐11 and Ser‐118. Click here for additional data file. Fig. S7 raxX and raxST expression in Xanthomonas oryzae pv. oryzae (Xoo) PXO99A complemented strains. Data show raxX and raxST gene expression in the complemented strains (with raxX and raxST on plasmids) relative to expression in Xoo strain PXO899A (with raxX and raxST on the chromosome). Expression was determined by quantitative reverse transcription‐polymerase chain reaction (qRT‐PCR) (see Experimental procedures), and is shown as the logarithm of the fold change. Gene expression was normalized to the chromosomal gene PXO_01660 (annotated as an ampC gene homologue encoding‐lactamase). Data are the mean values from two biological replicates. Error bars show the standard deviation. Click here for additional data file. Fig. S8  RaxST structural alignment. Sequence alignment of the human tyrosylprotein sulfotransferase‐2 (TPST2) and Xanthomonas oryzae pv. oryzae (Xoo) RaxST sequences formatted with ESPript 3.0 (Robert & Gouet, 2014). Secondary structure elements derived from the respective structural models are shown. Stars show TPST2 residues involved in 3′‐phosphoadenosine 5′‐phosphosulfate (PAPS) binding, and arrows show RaxST missense substitutions. Click here for additional data file. Fig. S9  Model for RaxST structure. Predicted RaxST structure shown in cartoon and surface representation, based on the dimeric structure of tyrosylprotein sulfotransferase‐2 (TPST2). The two RaxST monomers are coloured in dark and light green. The 3′‐phosphoadenosine 5′‐phosphate (PAP) and C4 substrate peptide that were co‐crystallized with TPST2 are superimposed on the RaxST model. PAP is represented as labelled and the substrate peptide is shown in yellow cartoon with the acceptor tyrosine represented as labelled. Residues His‐50 and Arg‐129 are coloured in magenta and highlighted. Click here for additional data file. File S1 Xanthomonas strains analysed for whole‐genome phylogeny. Excel file (.XLS format). Click here for additional data file.
  70 in total

1.  Identification and analysis of 'extended -10' promoters in Escherichia coli.

Authors:  Jennie E Mitchell; Dongling Zheng; Stephen J W Busby; Stephen D Minchin
Journal:  Nucleic Acids Res       Date:  2003-08-15       Impact factor: 16.971

Review 2.  An overview of bacterial nomenclature with special reference to plant pathogens.

Authors:  J M Young
Journal:  Syst Appl Microbiol       Date:  2008-12       Impact factor: 4.022

Review 3.  Type I Protein Secretion-Deceptively Simple yet with a Wide Range of Mechanistic Variability across the Family.

Authors:  I Barry Holland; Sandra Peherstorfer; Kerstin Kanonenberg; Michael Lenders; Sven Reimann; Lutz Schmitt
Journal:  EcoSal Plus       Date:  2016-12

4.  The Xanthomonas oryzae pv. lozengeoryzae raxP and raxQ genes encode an ATP sulphurylase and adenosine-5'-phosphosulphate kinase that are required for AvrXa21 avirulence activity.

Authors:  Yuwei Shen; Parveen Sharma; Francisco G da Silva; Pamela Ronald
Journal:  Mol Microbiol       Date:  2002-04       Impact factor: 3.501

5.  Comparison of the genomes of two Xanthomonas pathogens with differing host specificities.

Authors:  A C R da Silva; J A Ferro; F C Reinach; C S Farah; L R Furlan; R B Quaggio; C B Monteiro-Vitorello; M A Van Sluys; N F Almeida; L M C Alves; A M do Amaral; M C Bertolini; L E A Camargo; G Camarotte; F Cannavan; J Cardozo; F Chambergo; L P Ciapina; R M B Cicarelli; L L Coutinho; J R Cursino-Santos; H El-Dorry; J B Faria; A J S Ferreira; R C C Ferreira; M I T Ferro; E F Formighieri; M C Franco; C C Greggio; A Gruber; A M Katsuyama; L T Kishi; R P Leite; E G M Lemos; M V F Lemos; E C Locali; M A Machado; A M B N Madeira; N M Martinez-Rossi; E C Martins; J Meidanis; C F M Menck; C Y Miyaki; D H Moon; L M Moreira; M T M Novo; V K Okura; M C Oliveira; V R Oliveira; H A Pereira; A Rossi; J A D Sena; C Silva; R F de Souza; L A F Spinola; M A Takita; R E Tamura; E C Teixeira; R I D Tezza; M Trindade dos Santos; D Truffi; S M Tsai; F F White; J C Setubal; J P Kitajima
Journal:  Nature       Date:  2002-05-23       Impact factor: 49.962

Review 6.  Tyrosine sulfation: an increasingly recognised post-translational modification of secreted proteins.

Authors:  Martin J Stone; Sara Chuang; Xu Hou; Menachem Shoham; John Z Zhu
Journal:  N Biotechnol       Date:  2009-06       Impact factor: 5.079

Review 7.  Structure and function of sulfotransferases.

Authors:  M Negishi; L G Pedersen; E Petrotchenko; S Shevtsov; A Gorokhov; Y Kakuta; L C Pedersen
Journal:  Arch Biochem Biophys       Date:  2001-06-15       Impact factor: 4.013

8.  Complete Genome Sequence of the African Strain AXO1947 of Xanthomonas oryzae pv. oryzae.

Authors:  J C Huguet-Tapia; Z Peng; B Yang; Z Yin; S Liu; F F White
Journal:  Genome Announc       Date:  2016-02-11

9.  Full Genome Sequence Analysis of Two Isolates Reveals a Novel Xanthomonas Species Close to the Sugarcane Pathogen Xanthomonas albilineans.

Authors:  Isabelle Pieretti; Stéphane Cociancich; Stéphanie Bolot; Sébastien Carrère; Alexandre Morisset; Philippe Rott; Monique Royer
Journal:  Genes (Basel)       Date:  2015-07-23       Impact factor: 4.096

10.  The rice immune receptor XA21 recognizes a tyrosine-sulfated protein from a Gram-negative bacterium.

Authors:  Rory N Pruitt; Benjamin Schwessinger; Anna Joe; Nicholas Thomas; Furong Liu; Markus Albert; Michelle R Robinson; Leanne Jade G Chan; Dee Dee Luu; Huamin Chen; Ofir Bahar; Arsalan Daudi; David De Vleesschauwer; Daniel Caddell; Weiguo Zhang; Xiuxiang Zhao; Xiang Li; Joshua L Heazlewood; Deling Ruan; Dipali Majumder; Mawsheng Chern; Hubert Kalbacher; Samriti Midha; Prabhu B Patil; Ramesh V Sonti; Christopher J Petzold; Chang C Liu; Jennifer S Brodbelt; Georg Felix; Pamela C Ronald
Journal:  Sci Adv       Date:  2015-07-24       Impact factor: 14.136

View more
  6 in total

Review 1.  Xanthomonas diversity, virulence and plant-pathogen interactions.

Authors:  Sujan Timilsina; Neha Potnis; Eric A Newberry; Prabha Liyanapathiranage; Fernanda Iruegas-Bocardo; Frank F White; Erica M Goss; Jeffrey B Jones
Journal:  Nat Rev Microbiol       Date:  2020-04-28       Impact factor: 60.633

Review 2.  Rice functional genomics: decades' efforts and roads ahead.

Authors:  Rongzhi Chen; Yiwen Deng; Yanglin Ding; Jingxin Guo; Jie Qiu; Bing Wang; Changsheng Wang; Yongyao Xie; Zhihua Zhang; Jiaxin Chen; Letian Chen; Chengcai Chu; Guangcun He; Zuhua He; Xuehui Huang; Yongzhong Xing; Shuhua Yang; Daoxin Xie; Yaoguang Liu; Jiayang Li
Journal:  Sci China Life Sci       Date:  2021-12-07       Impact factor: 6.038

Review 3.  Epidemiology, diversity, and management of bacterial spot of tomato caused by Xanthomonas perforans.

Authors:  Peter Abrahamian; Jeannie M Klein-Gordon; Jeffrey B Jones; Gary E Vallad
Journal:  Appl Microbiol Biotechnol       Date:  2021-08-03       Impact factor: 4.813

Review 4.  Recent advances in developing disease resistance in plants.

Authors:  Anuj Sharma; Jeffrey B Jones; Frank F White
Journal:  F1000Res       Date:  2019-11-19

5.  Plant immunity: Rice XA21-mediated resistance to bacterial infection.

Authors:  María Florencia Ercoli; Dee Dee Luu; Ellen Youngsoo Rim; Alexandra Shigenaga; Artur Teixeira de Araujo; Mawsheng Chern; Rashmi Jain; Randy Ruan; Anna Joe; Valley Stewart; Pamela Ronald
Journal:  Proc Natl Acad Sci U S A       Date:  2022-02-22       Impact factor: 11.205

6.  Loss of RND-Type Multidrug Efflux Pumps Triggers Iron Starvation and Lipid A Modifications in Pseudomonas aeruginosa.

Authors:  Justyna W Adamiak; Varsha Jhawar; Vincent Bonifay; Courtney E Chandler; Inga V Leus; Robert K Ernst; Herbert P Schweizer; Helen I Zgurskaya
Journal:  Antimicrob Agents Chemother       Date:  2021-07-12       Impact factor: 5.191

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.