Literature DB >> 30733736

Improvement of cellulose degradation by cloning of endo-β-1, 3-1, 4 glucanase (bgls) gene from Bacillus subtilis BTN7A strain.

Wafaa K Hegazy1, Mohamed S Abdel-Salam1, Azhar A Hussain2, Hoda H Abo-Ghalia2, Safa S Hafez2.   

Abstract

The aim of this study is to construct a new recombinant strain able to degrade cellulose efficiently. The endo-β-1, 3-1, 4 glucanase (bgls) gene was cloned from Bacillus subtilis BTN7A strain by using PCR technique. The specific primers of bgls gene were deduced. Optimization of PCR mixture and program were identified. The nucleotide sequence of bgls was placed in the public domain (GenBank accession number KM009051.1). The obtained bgls DNA was cloned with pGEM®-T Easy Vector. The recombinant plasmid designated as Bgls-NRC-1 was transformed into E. coli DH5α. The successful cloning of the bgls gene was tested either by PCR or by evaluating its expression in its new bacterial host. The bgls gene was expressed efficiently in E. coli and the enzyme activity of the transformant was compared to the enzyme activity of the donor bacterial strain. The new constructs produce much higher enzyme yields than the donor bacterial strain, they produce about 29% and about 57% higher cellulase specific activity at 37 °C and 55 °C respectively. Optimization of cellulolytic activity of the new recombinant strain were described. The effect of minimal medium supplemented with CMC or cellulose, or complete medium (LB) on bgls expression were tested, the order of cellulase activity production was CMC27.2 > cellulose 21.9 > LB 19.8 U/mg protein, respectively at 24 h. CMC was proved to be the best medium for cellulase production. Results also showed that double the initial inoculum resulted in more cellulase activities in all media.

Entities:  

Keywords:  Bacillus subtilis; Cellulolytic activity; Endo-β-1, 3-1, 4 glucanase; Gene cloning; Gene expression; PCR

Year:  2018        PMID: 30733736      PMCID: PMC6353759          DOI: 10.1016/j.jgeb.2018.06.005

Source DB:  PubMed          Journal:  J Genet Eng Biotechnol        ISSN: 1687-157X


Introduction

The major part of plant cell walls are cellulose and hemicelluloses and the major constituents of cell walls of cereals consisting of a mixed linked 1, 3-1, 4-β-glucans. The bioconversion of lignocellulosic feedstock to bioethanol has been a global interest as alternative to petroleum fuels. For commercializing this approach, several technical improvements are needed [16], [17]. The high cost of enzymes involved in the conversion of the cellulose component into fermentable sugars is one of the major limitations for lignocellulosic-base bioethanol processes [16]. Cellulose is degraded by enzymes belonging to the glycosyl hydrolase families, which hydrolyze oligosaccharides and polysaccharides [17]. Three types of β-glucan endohydrolase able to degrade 1, 3-1,4-β-glucans but distinguished by fine differences in substrate specificity are known. Two of them, endo-1,4-β-glucanase or carboxymethyl cellulase (CMCase, cellulase, EC 3.2.1.4) and endo-l,3-1,4-β-glucanaseorlichenase (EC 3.2.1.73) are secreted by Bacillus subtilis. The third β-glucan endohydrolase (endo-l,3(4)- β –glucanase, EC 3.2.1.6) able to hydrolysel aminarin and barley glucan was detected only in Rhizopus arrhizus [4]. The β-1,3-1,4-glucanase activity was assayed using 1% (w/v) barley β-glucan, 1%(w/v) lichenan, and 1% (w/v) CM-cellulose as the substrate [24]. Lichenase encoded by the bgls gene is restricted in its substrate range to mixed linked β-glucans. Only 1,4-linkages adjacent to 1,3-linkages are hydrolysed. The bgls gene has been isolated from B. subtilis strains and the amino acid sequences of their products have been deduced [18]. Different cellulolytic bacterial strains have been collected and isolated including different B. subtilis strains among them B. subtilis subsp. subtilis BTN7A strain which was isolated from Egypt environment had the highest cellulase activity [10], [11]. Among the possible ways to produce high production of cellulases, different attempts have been made to clone and express the genes encoding for cellulases in a heterologous host, E. coli [13], [1]. Extracellular production of the recombinant protein in E. coli, could allow the potential to develop E. coli system as a cell factory for extracellular production of bacterial enzyme [2]. The air pollution in Cairo is a matter of seriousconcern. In 2007 the World Bank ranked Cairo’s air worst in the world for pollution by particulates, the tiny fragments of soot or dust that are most damaging to human lungs. One of the most notable sources of pollution is openairwaste-burning. A black cloud over Cairo has been noticed each year for many decades during harvest time where farmersburn leftover rice husks at the end of the growing season. The black cloud brings pollution levels up to ten times the limits set by the World Health Organization, and can persist for days or weeks at a time. It sends people to the hospital with exacerbated lung infections and asthma attacks at unusually high rates, and contributes to cancer and other long-term health problems. Different strategies have been planned to overcome this problem including using rice husks instead of them. Our research group aimed to solve this problem by biodegradation of plant wastes and use them for production of economic value products using biotechnological approach. The present study concerning with cloning of endo-β-1, 3-1, 4 glucanase (bgls) gene from B. subtilis BTN7A strain, and optimize its expression in cellulose degradation, as an essential step to accomplish this goal.

Materials and methods

Bacterial strains

Bacillus subtilis subsp. subtilis BTN7A is a highly cellulolytic strain isolated by the research team from Egypt [11], GenBank accession number KC438368. E. coli DH5α was used for transformation.

Media

Luria-Bertani agar medium (LB) was used for bacterial growth. Bunshell Haas medium (BHM) containing carboxymethyl cellulose (CMC) or cellulose as a sole carbon source [6]. All molecular biology manipulations were performed according to standard protocols [22] and kit’s suppliers’ instructions unless specified.

Bioinformatics

Different internet sites have been used through this study. They included, The National Center for Biotechnology Information (NCBI), Webcutter 2.0 software, primer design (Primer3), Plasmid Mapping [8], and SnapGene®Viewer program. The Sequence Similarity Search was done using BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome). Agarose gel electrophoresis (1%) was used in the present study for DNA analysis. The obtained DNA bands were visualized using UV transilluminator, and then photographed for analysis. Plasmid DNA was isolated using DNA-spin™ plasmid DNA purification Kit (INtRON BIOTECHNOLOGY).

Amplification of endo-β-1,3-1,4 glucanase (bgls) gene

Total genomic DNA was extracted using fresh crude extract method [7] Bacillus subtilis subsp. subtilis BTN7A was grown on LB agar medium for overnight at 37 °C. Two colonies were suspended in100 µl sterile distilled water and boiled for 10 min, and then were centrifuged for five minutes at10,000 rpm. The supernatant was used as DNA template in PCR amplification. PCR amplification was carried out using Go Taq® Flexi DNA Polymerase Kit (Promega Co, Madison, USA). PCR amplification was performed in a thermal cycler Amplitronyx™ (NYXTECHNIK, USA) programmed for one cycle at 95 °C for two minutes, then 30 cycles were performed as follows: one minute at 95 °C for denaturation, one minute at 52 °C for annealing, one minute at 72 °C for elongation and 5 min at 72 °C for final extension then reaction mixtures were held at 4 °C. The selected primers were bgls reverse primer (ATTGCAGCAGGCTCTTTCAC) and bgls forward primer (AATGAAAGGGGAATGCCAAT). After the program was completed, 10 µl of amplified bgls gene were analyzed by 1% agarose gel electrophoreses.

Cloning of bgls gene

Bgls gene was purified from gel using MEGAquick-spin TM Total Fragment DNA purification kit (iNtRON BIOTECHNOLOGY). Bgls gene was then cloned with pGEM®-T Easy Vector (Promega Co. Madison, USA). Five µl of ligated DNA were used to transform E. coli DH5α using heat shock technique and transformants were selected using ampicillin resistance and white/blue screening method (i.e., IPTG/X-gal).

Cellulase activity assay

Cellulase activity was determined using (3,5-dinitrosalisylic acid) DNS which measures the amount of reducing sugar liberated from CMC or cellulose, according to [19]. The tested bacterial strain was grown in BHM minimal medium or LB broth medium up to three days at 37 °C, and then centrifuged at 13,000 rpm for 5 min. One ml of the supernatant (enzyme solution) was mixed with one ml of CMC solubilized in phosphate buffer (1%) and incubated at 37 °C for 30 min under shaking (120 rpm). One ml dinitrosalisylic (DNS) acid reagent was added and the mixture was boiled for 5 min, then the absorbency was measured at 540 nm. One unit of enzyme activity was defined as µmol substrate consumed or product formed per minute. Total protein concentration was determined according to [5] and absorbance was measured at 595 nm. Different concentrations of Bovine serum albumin (BSA) were conducted for plotting standard curve according to [15]. Cellulase specific activity was calculated by dividing the end product concentration expressed as units by the total protein (mg) of the sample.

Results

Isolation of endo-β-1,3-1,4 glucanase (bgls) gene

B. subtilis bgls sequencing available data presented in GenBank was used by Primer3 software to select the appropriate primers which amplify the bgls complete CDS and few surrounding nucleotides. The amplified PCR product of bgls gene (777 bp) obtained after PCR amplification was represented in Fig. 1. However the highest bgls DNA concentration produced followed the addition of 6 µl of 25 mM MgCl2 in PCR program (Fig. 1, lane 6).
Fig. 1

An agarose gel (1%) electrophoresis showing the amplification of bgls gene from Bacillus subtilis subsp. subtilis BTN7A. Lane M, 100 bp DNA ladder; lane 1, no MgCl2 in the PCR reaction mixture; lane 2, 2 µl MgCl2; lane 3, 3 µl MgCl2; lane 4, 4 µl MgCl; lane 5, 5 µl MgCl2; lane 6, 6 µl MgCl2; lane 7, 7 µl MgCl2 and lane 8, 8 µl MgCl2.

An agarose gel (1%) electrophoresis showing the amplification of bgls gene from Bacillus subtilis subsp. subtilis BTN7A. Lane M, 100 bp DNA ladder; lane 1, no MgCl2 in the PCR reaction mixture; lane 2, 2 µl MgCl2; lane 3, 3 µl MgCl2; lane 4, 4 µl MgCl; lane 5, 5 µl MgCl2; lane 6, 6 µl MgCl2; lane 7, 7 µl MgCl2 and lane 8, 8 µl MgCl2. The product band of PCR was purified from the gel by using MEGAquick-spin TM Total Fragment DNA purification kit and sequenced by Macrogen Co., Korea and then analyzed using different softwares. The nucleotide sequence of bgls was placed in the public domain (GenBank accession number KM009051.1). Nucleotide sequence of B. subtilis subsp. subtilis BTN7A bgls CDS and their deduced amino acid were presented in Fig. 2. It was contains729 bp which encodes for 243 amino acids.
Fig. 2

Bacillus subtilis subsp. subtilis strain BTN7A endo-beta-1,3-1,4 glucanase (bgls) gene, complete CDS (A) and its deduced amino acids sequence (B).

Bacillus subtilis subsp. subtilis strain BTN7A endo-beta-1,3-1,4 glucanase (bgls) gene, complete CDS (A) and its deduced amino acids sequence (B). The bgls gene was ligated with pGEM®-T Easy and the recombinant plasmid, named Bgls-NRC-1 (3794 bp) (Fig. 3).
Fig. 3

Bgls-NRC-1 recombinant plasmid containing B. subtilis subsp. subtilis BTN7Abgls gene.

Bgls-NRC-1 recombinant plasmid containing B. subtilis subsp. subtilis BTN7Abgls gene.

Detection of bgls gene in Bgls-NRC-1 plasmid

To detect the presence of bgls gene in the transformants colonies, seven white colonies were selected, named T-bgls1 to T-bgls7 and grown in LB broth containing ampicillin at 37 °C for 24 h. The recombinant plasmid Bgls-nrc-1 was isolated and then PCR amplification was carried out using the designed pair of bgls primers. Fig. 4 shows the amplified fragments from the seven chosen transformants. All lanes contained one band about 777 bp bgls gene as an evidence of its existence in the recombinant plasmid.
Fig. 4

Agarose gel (1%) electrophoresis of the amplification of bgls gene from seven E. coli DH5α (Bgls-NRC-1) transformants. Lane M: 100 bp DNA ladder, lane1: T-bgls1; lane2: T-bgls2; lane3: T-bgls3; lane4: T-bgls4; lane5: T-bgls5; lane6: T-bgls6 and lane7: T-bgls7 transformants.

Agarose gel (1%) electrophoresis of the amplification of bgls gene from seven E. coli DH5α (Bgls-NRC-1) transformants. Lane M: 100 bp DNA ladder, lane1: T-bgls1; lane2: T-bgls2; lane3: T-bgls3; lane4: T-bgls4; lane5: T-bgls5; lane6: T-bgls6 and lane7: T-bgls7 transformants.

Cellulase specific activity of bgls gene

Cellulase specific activity of bgls clones was determined. Bgls - transformants, E. coli DH5α and B. subtilis BTN7A (donor strain) were grown in LB broth medium at 37 °C for 24 h under shaking conditions (120 rpm). After incubation period, cultures were centrifuged. The cellulase specific activity was assayed using the supernatant at temp. 37 and 55 °C and the protein concentration was measured in both supernatant and pellets. Cellulase specific activity was then calculated. It is noted that B. subtilis BTN7A (the donor strain of bgls gene) cellulase enzyme was active at 37 °C and 55 °C, where cellulase specific activities were 15.11 U/mg protein and 10.51 U/mg protein at 37 °C and 55 °C, respectively (Table 1). In this case the cellulase activity was reduced by about 44% at 55 °C than at 37 °C. It is also observed that, although E. coli DH5α had negligible cellulase activity, the recombinant E. coli DH5α, which contains the bgls gene, showed high cellulase activities. The results also revealed that bgls gene has the ability to hydrolyse CMC at 37 °C and 55 °C. Moreover, bgls constructed plasmid had more cellulase activity, at both temperatures than the donor B. subtilis BTN7A strain, in spite of the donor strain had different cellulase enzymes, the recombinant straincontainBgls-NRC-1 plasmid had 19.5 U cellulase activities at 37 °C which was about 29% more than B. subtilis BTN7A donor strain, and 16.47 U/mg at 55 °C which was about 57% more than B. subtilis BTN7A donor strain.
Table 1

Cellulase specific activity of E. coli DH5α, B. subtilis BTN7A, and E. coli DH5α (T-bgls1).

Bacterial strainsCellulase specific activity (U/mg protein) at
37 °C55 °C
E. coli DH5α0.05 c*0.01 c
B. subtilis BTN7A15.11 b10.51 b
E. coli DH5α(T-bgls1)19.50 a16.47 a

Means not followed by the same letter are significantly different by Duncan’s Multiple Range Test [9] (P ≤ 0.05).

Cellulase specific activity of E. coli DH5α, B. subtilis BTN7A, and E. coli DH5α (T-bgls1). Means not followed by the same letter are significantly different by Duncan’s Multiple Range Test [9] (P ≤ 0.05).

Medium effects on cellulase activity of bgls

To determine the medium effect on cellulase activity by time, overnight cultures of bgls transformant (i.e., T-bgls1) or E. coli DH5α were grown in minimal media supplemented with CMC or cellulose and in LB broth at 37 °C up to 3 days with shaking (120 rpm). The cellulase activities presented in Table 2 showed different indications. First, bgls gene had more reducing sugars when using CMC than cellulose powder. Second, reducing sugars were decreased by increasing the incubation period. Third, double the initial inoculums resulted in more cellulase activities, e.g., after 24 hrs bgls had 15.1 U/mg comparing with 27.2 U/mg.
Table 2

Medium effects on bgls expression.


Cellulase specific activity (U/mg protein)
Bacterial strainsBHM medium + CMC
BHM medium + cellulose
LB Medium
24 h48 h72 h24 h48 h72 h24 h48 h72 h
E. coli DH5α0.51c*0.14b0.081c0.41c0.029c0.037c0.061c0.042c0.03c
T-bgls1(X)**27.20b25.80a23.53b21.93b21.01b19.51b19.83b15.90b15.11b
T-bgls1(2X)35.10a29.43a82.53a30.20a28.83a26.90a25.36a21.51a20.10a

Means not followed by the same letter are significantly different by Duncan’s Multiple Range Test [9] (P ≤ 0.05).

X = Bacterial inoculum corresponding to OD620 = 0.01 in 20 ml medium.

On the other hand, another three indications were observed in (Table 2): Firstly, the successful bgls gene expression by using complex medium (i.e., LB medium) up to three days. Secondly, bgls gene expression was less than those expressed when CMC or cellulose was used as sole carbon sources. Thirdly, double initial inoculum resulted in more cellulase activities e.g., after 24 h bgls had 25.36 U/mg comparing with 19.83 U/mg. Medium effects on bgls expression. Means not followed by the same letter are significantly different by Duncan’s Multiple Range Test [9] (P ≤ 0.05). X = Bacterial inoculum corresponding to OD620 = 0.01 in 20 ml medium.

Discussion

The obtained data revealed that in spite of the donor B. subtilis BTN7A strain, had bgls gene beside different other cellulase genes, it had less cellulase activity than constructed plasmid, the higher cellulase activities of the cloned gene may be probably due to one or both of the high copy number of the cloning vectors and hence multi gene copies per cell. Another possible explanation of the higher activity of the constructed plasmid may also be due to the promoter effect where the cloned gene was under the control of T7 promoter of the pGEM®-T Easy (Fig. 3). Similar results have been reported by [12] who cloned bgls gene from Bacillus circulans and transfer it to each of B. subtilis and B. megaterium. The B. subtilis enzyme was 83 folds more active than that of the gene donor cells. The B. megaterium enzyme was 7 folds more active than that of the gene of donor cells. While E. coli secreted only about 10% of the produced enzyme, B. subtilis excreted the enzyme completely into the medium and B. megaterium by about 98%. A four folds increase in cellulase production by the recombinant cell to that of wild type suggests the applicability of the E. coli system as a cell factory for cellulase over-production due to the higher level of recombinant expression as mentioned by [25]. E. coli is one of the most widely used host for the production of recombinant proteins as it is the best characterized host with many available expression systems [20]. Maximum bgls production was obtained when using CMC (Table 2) this result confirmed the recently reported that Bacillus sp. produced maximum cellulases production in the presence of CMC as a carbon source [3], [21], [14], [23]. This finding indicates the positive regulation effect of CMC in cellulases gene expression in Bacillus.

Conclusions

In conclusion in the present work, endo-β-1, 3-1,4glucanase (bgls) gene was cloned from Bacillus subtilis strain BTN7A using PCR. The optimized conditions for amplifying bgls gene was identified including DNA, primers and MgCl2 concentrations, and PCR program. The obtained recombinant plasmid was tested for its new constructs. The bgls gene was intact physically in the recombinant plasmid as confirmed by PCR and by its expression in the new bacterial host. Furthers studies are planned to use the cellulose-efficient bgls clone in degradation of different celluloses waste matters. The obtained degradation products will be used to produce economical products such as alcohol and single cell protein when using yeasts.
  13 in total

1.  Overproduction and secretion of Bacillus circulans endo-beta-1,3-1,4-glucanase gene (bglBC1) in B. subtilis and B. megaterium.

Authors:  Ji-Yeon Kim
Journal:  Biotechnol Lett       Date:  2003-09       Impact factor: 2.461

Review 2.  Microbial cellulose utilization: fundamentals and biotechnology.

Authors:  Lee R Lynd; Paul J Weimer; Willem H van Zyl; Isak S Pretorius
Journal:  Microbiol Mol Biol Rev       Date:  2002-09       Impact factor: 11.056

3.  The Utilization of Certain Hydrocarbons by Microorganisms.

Authors:  L D Bushnell; H F Haas
Journal:  J Bacteriol       Date:  1941-05       Impact factor: 3.490

Review 4.  How biotech can transform biofuels.

Authors:  Lee R Lynd; Mark S Laser; David Bransby; Bruce E Dale; Brian Davison; Richard Hamilton; Michael Himmel; Martin Keller; James D McMillan; John Sheehan; Charles E Wyman
Journal:  Nat Biotechnol       Date:  2008-02       Impact factor: 54.908

5.  Protein measurement with the Folin phenol reagent.

Authors:  O H LOWRY; N J ROSEBROUGH; A L FARR; R J RANDALL
Journal:  J Biol Chem       Date:  1951-11       Impact factor: 5.157

6.  Cloning of the thermostable cellulase gene from newly isolated Bacillus subtilis and its expression in Escherichia coli.

Authors:  Wang Li; Wei-Wei Zhang; Ming-Ming Yang; Yu-Lin Chen
Journal:  Mol Biotechnol       Date:  2008-06-25       Impact factor: 2.695

7.  Cloning of beta-1,3-1,4-glucanase gene from Bacillus licheniformis EGW039 (CGMCC 0635) and its expression in Escherichia coli BL21 (DE3).

Authors:  Da Teng; Jian-hua Wang; Ying Fan; Ya-lin Yang; Zi-gang Tian; Jin Luo; Guan-pin Yang; Fan Zhang
Journal:  Appl Microbiol Biotechnol       Date:  2006-02-10       Impact factor: 4.813

8.  Construction of a cellulase hyper-expression system in Trichoderma reesei by promoter and enzyme engineering.

Authors:  Gen Zou; Shaohua Shi; Yanping Jiang; Joost van den Brink; Ronald P de Vries; Ling Chen; Jun Zhang; Liang Ma; Chengshu Wang; Zhihua Zhou
Journal:  Microb Cell Fact       Date:  2012-02-08       Impact factor: 5.328

9.  Cloning, expression of b-1,3-1,4 glucanase from Bacillus subtilis SU40 and the effect of calcium ion on the stability of recombinant enzyme: in vitro and in silico analysis.

Authors:  Revathi Masilamani; Om Prakash Sharma; Suresh Kumar Muthuvel; Sakthivel Natarajan
Journal:  Bioinformation       Date:  2013-12-06

10.  Cloning and recombinant expression of a cellulase from the cellulolytic strain Streptomyces sp. G12 isolated from compost.

Authors:  Antonella Amore; Olimpia Pepe; Valeria Ventorino; Leila Birolo; Chiara Giangrande; Vincenza Faraco
Journal:  Microb Cell Fact       Date:  2012-12-26       Impact factor: 5.328

View more
  1 in total

Review 1.  Exploring plant growth-promoting rhizobacteria as stress alleviators: a methodological insight.

Authors:  Arnoldo Wong Villarreal; Ivana F Della Mónica; Pablo J Stefanoni Rubio; Rocío Vaca-Paulín; Gustavo Yañez-Ocampo
Journal:  Arch Microbiol       Date:  2022-05-13       Impact factor: 2.552

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.