Molecular detection of Anaplasma infections in ixodid ticks from the Qinghai-Tibet Plateau.

Anaplasma species are tick-transmitted obligate intracellular bacteria that infect many wild and domestic animals and humans. The prevalence of Anaplasma spp. in ixodid ticks of Qinghai Province is poorly understood. In this study, a total of 1104 questing adult ticks were investigated for the infection of Anaplasma species. As a result, we demonstrated the total infection rates of 3.1, 11.1, 5.6, and 4.5% for A. phagocytophilum, A. bovis, A. ovis and A. capra, respectively. All of the tick samples were negative for A. marginale. The positive rates of A. phagocytophilum, A. ovis and A. capra in different tick species were significantly different. The positive rates of A. capra and A. bovis in the male ticks were significantly higher than that in the female ticks. Sequence analysis of A. ovis showed 99.5-100% identity to the previous reported isolates. The sequences of A. phagocytophilum had 100% identity to strains Ap-SHX21, JC3-3 and ZAM dog-181 from sheep, Mongolian gazelles, and dogs. Two genotypes of A. capra were found based on 16S rRNA, citrate synthase (gltA) gene and heat shock protein (groEL) gene analysis. In conclusion, A. bovis, A. ovis, A. phagocytophilum, and A. capra were present in the ticks in Qinghai Province. Anaplasma infection is associated with tick species, gender and distribution. These data will be helpful for understanding prevalence status of Anaplasma infections in ticks in Qinghai-Tibet Plateau.

Multilingual abstracts

Please see Additional file 1 for translations of the abstract into the five official working languages of the United Nations.

Background

Ticks are important vectors of many viral, bacterial, and protozoal pathogens that infect to humans and animals, and tick species are widely distributed all over the world. Among tick-borne pathogens, the genus Anaplasma (order Rickettsiales, family Anaplasmataceae) is composed of tick-transmitted obligate intracellular bacteria, which include A. ovis, A. bovis, A. marginale, A. phagocytophilum, A. platys, A. centrale and A. capra [1, 2]. A. ovis is an obligate intra-erythrocytic organism of small ruminants. A. centrale has relatively mild virulence and it has been used as a live vaccine against A. marginale infection in several countries [3]. A. bovis infects monocytes of small mammals and ruminants [4, 5]. A. phagocytophilum infects neutrophils of many wild and domestic animals and humans, is the etiological agent of human granulocytic anaplasmosis and tick-borne fever [6]. A. platys is unique in infecting the platelets of dogs and it is the etiological agent of the infectious canine cyclic thrombocytopenia [7]. A. capra has been identified in China as a novel tick-transmitted zoonotic pathogen but its vectors and infected cell types are unclear [1]. Ixodid ticks play a critical role in the transmission and maintenance of Anaplasma species [8]. Dermacentor nuttalli, Hyalomma asiaticum and Rhipicephalus pumilio are the main vectors of A. ovis in China [9]. Although ixodid tick infestation of livestock is common, little is known about the Anaplasma infection in the ticks in Qinghai Province.

Qinghai Province is located in the northeastern part of Qinghai-Tibet Plateau in western China. Qinghai has an average attitude of more than 3000 m with 54% of the total area being between 4000 m and 5000 m. The provincial climate is characterized by being relatively arid, windy, and cold. Qinghai contains significant amounts of pastures and is an important region for animal production. Qinghai has 33.45 million ha of grassland. The grassland meadows are classified as alpine, swamp, Gobi, forest, and prairie. Yaks, Tibetan sheep, sheep and goats are adapted for survival and growth on these grasslands. Ixodid ticks infestation of livestock is often found in Qinghai Province, including 54.5, 24.0, 36.1% infection rates of A. ovis in sheep [10], Babesia spp. in wild yaks [11], and Theileria spp. in yaks [12], respectively. However, very little is known about the Anaplasma infection in animals and ticks. In this study, we identified and analyzed the infections of A. phagocytophilum, A. bovis, A. ovis, A. marginale and A. capra in ticks. The data provide an overview of Anaplasma infections and the potential threats to both livestock and humans in the study areas.

Methods

Sampling sites and tick collection

Samples were collected in the Qinghai Province, the Qinghai-Tibetan Plateau at an average altitude of > 3000 m. From February to October in 2015–2017, a total of 1104 questing adult ticks were collected from vegetation on 22 counties of Qinghai by using the flagging method. All of the tick specimens were identified according to morphological criteria [13] and a few were confirmed by sequence analysis of a partial fragment of the 16S rRNA gene.

DNA extraction, PCR amplification and sequencing

DNA extraction of each individual ticks was conducted as described previously [2]. DNA samples were detected for the presence of the agents in the genus Anaplasma by PCR targeting the msp4 gene for A. ovis and A. marginale, the 16S rRNA gene for A. phagocytophilum and A. bovis, and the citrate synthase (gltA) gene for A. capra, respectively. For further confirmation of the A. capra, the 16S rRNA gene and the heat-shock protein gene (groEL) were amplified from A. capra positive samples. The 16S rRNA gene was amplified for the molecular identification of the tick species. The PCR was carried out by using an automatic thermocycler (Bio-Rad, Hercules, USA). The reaction system for the PCRs was the same as described in our previous study [14] and the PCR primers and cycling conditions were shown in Table 1. The DNAs extracted from the animals infected with A. ovis, A. marginale, A. phagocytophilum, A. bovis and A. capra were used as positive controls, and double distilled water was used as a negative controls. The PCR products were visualized under UV illumination in a 1.2% agarose gel followed by electrophoresis and treated with GoldView I (Solarbio, Beijing, China).

Table 1

Primers used for PCR for the identification of tick species and detection and of Anaplasma spp. in the ticks from Qinghai

Target species	Target gene	Primer(5′ → 3′)	Annealing temperature (°C)	No. of cycles	Expected size (bp)	References
Anaplasma spp.	16S rRNA	EE1: TCCTGGCTCAGAACGAACGCTGGCGGCEE2: AGTCACTGACCCAACCTTAAATGGCTG	55	35	1400	[37]
A. bovis	16S rRNA	AB1f: CTCGTAGCTTGCTATGAGAACAB1r: TCTCCCGGACTCCAGTCTG	55	35	551	[26]
A. phagocytophilum	16S rRNA	SSAP2f: GCTGAATGTGGGGATAATTTATSSAP2r: ATGGCTGCTTCCTTTCGGTTA	55	35	641	[26]
A. marginale	msp4	Amargmsp4F: CTGAAGGGGGAGTAATGGGAmargmsp4R: GGTAATAGCTGCCAGAGATTC	60	30	344	[38]
A. ovis	msp4	MSP43: CCGGATCCTTAGCTGAACAGAATCTTGCMSP45: GGGAGCTCCTATGAATTACAGAGAATTGTTTAC	60	35	869	[39]
A. capra	gltA	gltAouterF: GCGATTTTAGAGTGYGGAGATTGgltAouterR: TACAATACCGGAGTAAAAGTCA	55	35	1031	[1]
		gltAinnerF: GCGATTTTAGAGTGYGGAGATTGgltAinnerR: GCGATTTTAGAGTGYGGAGATTG	60	35	594
	16S rRNA	Forward: GCAAGTCGAACGGACCAAATCTGTReverse: CCACGATTACTAGCGATTCCGACTTC	58	35	1261	[35]
	groEL	Forward: TGAAGAGCATCAAACCCGAAGReverse: CTGCTCGTGATGCTATCGG	55	35	874	[35]
Tick	16S rRNA	16SrRNA-F: CTGCTCAATGATTTTTTAAATTGCTGTGG16SrRNA-R: CCGGTCTGAACTCAGATCAAGT	55	35	450	Designed for this study

The PCR products were purified with the TaKaRa Agarose Gel DNA Purification Kit Ver.2.0 (TaKaRa, Dalian, China). Purified PCR products were cloned into a pGEM-T Easy vector (Promega, Madison, WI, USA), and then transformed into Escherichia coli JM109 competent cells (TaKaRa, Dalian, China). Three positive colonies from each sample were subjected to sequencing. The obtained sequences were used to conduct BLAST search in GenBank® of the National Center for Biotechnology Information (https://blast.ncbi.nlm.nih.gov/Blast.cgi).

Data analysis

The data were grouped into three variables in terms of tick species, tick gender and the altitude of the sampling sites, respectively. Differences in each group were statistically calculated using a Chi-square test in Predictive for Analytics Software Statistics 18 (PASW, SPSS Inc.,Chicago, IL, USA). A P-value of < 0.05 was considered significant.

Results

Identification of the tick species

A total of 1104 questing adult ticks (512 female, 592 male) were collected from vegetation in 22 counties of Qinghai Province. The ticks included seven species in three genera. There were 454 Haemaphysalis qinghaiensis, 263 D. abaensis, 246 D. nuttalli, 94 D. silvarum, 42 H. danieli, 3 Ixode crenulatus and two H. tibetensis respectively (Fig. 1). The species of ticks identified by morphology and supported by sequence analysis. The 16S rRNA sequence of H. qinghaiensis showed 100% identity to H. qinghaiensis isolate HY21 (GenBank accession number: MF629877) from Huangyuan in Qinghai; D. nuttalli and D. silvarum showed 99% similarity to D. nuttalli isolate HBS5(GenBank accession number: KU558731) and D. silvarum isolate Hebei (GenBank accession number: JF979379) from Hebei Province in China. The 16S rRNA sequences of H. danieli, H. tibetensis, D. abaensis and I. crenulatus were obtained for the first time.

Fig. 1

Map of the Sampling sites and the distribution of the collected tick species in Qinghai Province

Detection of the Anaplasma spp. in ticks

Five Anaplasma species were investigated in the ticks. Of the 1104 samples tested, the average infection rates were 3.1, 11.1, 5.6, and 4.5% for A. phagocytophilum, A. bovis, A. ovis, and A. capra, respectively. All of the samples were negative for A. marginale. A. phagocytophilum was detected in four tick species from ten sampling sites, and it was detected for the first time in D. abaensis, D. nuttalli, and H. danieli. A. bovis was detected in five tick species from 14 sampling sites, whereas A. ovis was detected in three tick species from nine sampling sites. Three tick species including H. qinghaiensis, D. abaensis and D. nuttalli were infected by A. capra. The prevalence of Anaplasma spp. in each sampling site is shown in Table 2.

Table 2

Detection of Anaplasma spp. in the ticks collected from 22 counties in Qinghai Province

County/Average altitude	Tick species	Number of tested	Number of infected (n)/Infection rate (%)
			A. phagocytophilum	A. bovis	A. ovis	A. capra
Ledu/2000 m	H. qinghaiensis	57	0	0	10/17.5	17/29.8
Huangzhong/2645 m	H. qinghaiensis	57	7/12.3	14/24.6	5/8.8	14/24.6
Qumalai/4223 m	D. abaensis	51	0	2/3.9	0	5/9.8
Yushu/4493 m	D. abaensis	55	0	16/29.1	0	7/12.7
Maduo/4300 m	H. qinghaiensis	48	1/2.1	9/18.8	0	1/2.1
	D. abaensis	3	0	0	0	0
Maqin/3730 m	D. abaensis	38	2/5.3	7/18.6	3/7.9	1/2.6
	H. qinghaiensis	5	0	1/33.3	0	0
Mengyuan/2880 m	H. qinghaiensis	58	1/1.7	19/32.8	0	0
	D. silvarum	1	0	0	0	0
Tianjun/3180 m	D. silvarum	54	0	0	0	0
Delingha/2980 m	D. silvarum	39	0	0	0	0
Chengduo/4500 m	D. nuttalli	16	0	0	0	2/12.5
	H. qinghaiensis	30	5/16.7	4/15.2	0	0
	H. tibetensis	2	0	0	0	0
	I. crenulatus	3	0	1/33.3	0	0
Banma/3560 m	H. qinghaiensis	43	0	0	0	0
Gangcha/3300 m	D. nuttalli	29	0	0	0	0
Huangyuan/2666 m	H. qinghaiensis	56	8/14.3	11/19.6	0	1/1.8
Qilian/2810 m	D. abaensis	66	0	2/3.0	6/9.1	0
	D. nuttalli	17	0	0	0	0
Dulan/3180 m	D. nuttalli	31	1/3.2	0	4/12.9	0
Guinan/3100 m	D. nuttalli	51	0	1/2.0	14/27.5	0
Huzhu/2520 m	H. qinghaiensis	50	0	5/10.0	0	0
Zaduo/4200 m	D. abaensis	50	4/8.0	5/10.0	0	0
Guide/2200 m	H. danieli	42	4/8.5	5/100	0	0
Henanxian/3600 m	D. nuttalli	51	1/2.0	20/39.2	11/21.6	2/3.9
Minhe/1650 m	H. qinghaiensis	50	0	0	3/6.0	0
Geermu/2800 m	D. nuttalli	51	0	0	6/11.8	0
Total		1104	34/3.1	122/11.1	62/5.6	50/4.5

Molecular characterization was based on the partial sequences of 16S rRNA gene (642 and 551 bp) for A. phagocytophilum and A. bovis, msp4 gene (869 bp) for A. ovis, 16S rRNA, gltA and groEL genes (1261 bp, 594 bp and 874 bp) for A. capra. These sequences were generated from positive samples representing the different sampling sites. As listed in Table 3, A. ovis were grouped into four genotypes. A. phagocytophilum were classified into three genotypes, and they were 100% identical to sequences of strains Ap-SHX21, JC3–3, and ZAM dog-181 from sheep, Mongolian gazelles, and dogs, respectively. A. bovis were classified into five genotypes. The 16S rRNA gene sequences of A. capra showed 99.8–100% similarity to strain S62b from sheep and strain 9-13a from goat, and the groEL gene sequences were identical with strain tick102/China/2013 and M141a, respectively. These sequences showed a close relation to the sequences of strain HLJ-14 from a patient. In addition, two genotypes of gltA gene sequences of A. capra were obtained in this study.

Table 3

Genotyping of Anaplasma spp. in the ticks in Qinghai Province

Anaplasma spp.	Gene marker	Number of obtained sequences	Number of genotypes	GenBank accession numbers of obtained sequences	Reference sequences from GenBank
A. ovis	16S rRNA	47	4	MG940865, MG940866, MG940868, MG940867	MF071305, HQ456347, EF067341, HQ456350
A. phagocytophilum	16S rRNA	56	3	MG940877, MG940878, MG940879	KU321304, KM186948, LC269823
A. bovis	16S rRNA	40	5	MG940884, MG940881, MG940880, MG940882, MG940883	KU509990, HQ913645, EU682764, KJ639885, KF465981
A. capra	16S rRNA	28	2	MG940874, MG940873	MF066917 KX417196
	groEL	20	2	MG940875, MG940876	KR261634, KX685888
	gltA	18	2	MG940871 MG940872	KX417308, KX685885

Risk factors for Anaplasma infection to in the tick species

Risk factors, including tick species, gender, and altitude of sampling sites, were used as variables for statistical analysis of the infection patterns of Anaplasma spp. (Table 4). As a result, tick species was positively associated with the presence of A. phagocytophilum, A. capra, and A. ovis. H. danieli had a higher risk than other tick species to be infected with A. phagocytophilum. D. nuttalli had a higher risk to be infected with A. ovis. H. qinghaiensis was most likely to be infected by A. capra. Male ticks were more likely to be infected by A. bovis or A. capra than female ticks. Altitude was a risk factor to A. phagocytophilum, A. bovis and A. capra infections. Ticks collected below 3000 m areas had a higher risk for being infected by A. phagocytophilum and A. capra than in the ticks collected at elevations greater than 3000 m. A. bovis infection rates in ticks collected above 4000 m were higher than in the ticks collected below 4000 m.

Table 4

Patterns of Anaplasma spp. prevalence in the ticks, grouped by tick species, tick gender and the altitude of the sampling sites

Group		Number of tested	Number of infected (n)/Infection rate (%)
			A. phagocytophilum	P-value	A. bovis	P-value	A. ovis	P-value	A. capra	P-value
Tick	H. qinghaiensis	454	22/4.8	0.0032	63/13.9	0.230	18/4.0	0.000057	33/7.3	0.0056
	H. tibetensis	2	0		0		0		0
	H. danieli	42	4/9.5		5/11.9		0		0
	D. abaensis	263	6/2.3		32/12.2		9/3.4		13/4.9
	D. silvarum	94	0		0		0		0
	D. nuttalli	246	2/0.8		21/8.5		35/14.2		4/1.6
	I. crenulatus	3	0		1/33.3		0		0
Gender	Female	512	16/3.1	0.935	47/9.2	0.045	23/4.5	0.312	14/2.7	0.0077
	Male	592	18/3.0		75/12.7		39/6.6		36/6.1
Altitude	≤ 3000 m	461	20/4.3	0.015	54/11.7	0.037	30/6.5	0.316	32/6.9	0.000066
	3000–3900 m	385	4/1.0		31/8.1		32/8.3		3/0.8
	≥ 4000 m	258	10/3.9		37/14.3		0		15/5.8

Discussion

Qinghai is one of the five largest animal grazing regions in China. Grazing animal production is a supporting industry in this region. The Qinghai ecosystem is very suitable for ixodid tick infestation and 25 tick species in six genera has been reported [15]. In this study we collected seven tick species from three genera. These were H. qinghaiensis, H. tibetensis, H. danieli, D. abaensis, D. nuttalli, D. silvarum, and I. crenulatus. H. qinghaiensis is common in northwestern China, and it has been the dominant tick species in Qinghai since it was initially discovered in Huangyuan County [13]. In the present study, 41.1% of the collected ticks were H. qinghaiensis. Three Dermacentor spp. ticks (D. abaensis, D. nuttalli and D. silvarum) were frequently encountered on grazing livestock in high altitude areas (2800 to 4300 m), whereas I. crenulatus and H. tibetensis were rare. To verify the morphological identification of the tick species, the 16S rRNA gene sequences were analyzed. The sequences from H. qinghaiensis, D. nuttalli, and D. silvarum ticks were identical to their corresponding reference sequences in Genbank. The sequences of H. danieli, H. tibetensis, D. abaensis and I. crenulatus were compared with our reference sequences (data unpublished) because of the lack of the reference sequences in GenBank.

Aanaplasma prevalence in ticks demonstrated a wide distribution of A. phagocytophilum, A. bovis, A. ovis and A. capra. Among the Anaplasma species, A. phagocytophilum is an emerging tick-borne zoonotic pathogen of public health significance [16], and it has been detected in many tick species, including H. qinghaiensis, H. concinna, H. longicornis, I. persulcatus, and D. silvarum in China [17-20]. We detected A. phagocytophilum in H. qinghaiensis, and, for the first time, found it in D. abaensis, D. nuttalli, and H. danieli. The 16S rRNA gene sequences represented three genotypes, which showed high identities to the sequences found in goats from Central and Southern China [21], these genotypes were different from the genotype identified from human samples. Therefore, the significance of these genotypes to public health needs further investigation. A. bovis was initially found as a pathogen of cattle but has also been reported in sheep, goats, wild deer, and dogs [5, 22, 23], indicating this agent has a broad host range. We detected A. bovis in five tick species (H. qinghaiensis, D. abaensis, D. nuttalli, I. crenulatus, and H. danieli) from 14 sampling sites and it has the highest infection rate when compared with A. phagocytophilum, A. ovis and A. capra. Five genotypes of A. bovis were found, demonstrating its diversity in the ticks of Qinghai. A. bovis can be found in many tick species, such as H. longicornis in China [24], Korea [25] and Japan [26]. A. bovis was also found in H. lagrangei in Thailand [27], H.concinna in Russia [28], H. megaspinosa in Japan [29]; Amblyomma variegatum and R. appendiculatus in Africa [30], Rhipicephalus evertsi in South Africa [31], and R. turanicus in Israel [32]. We found A. bovis in H. qinghaiensis, D. abaensis, D. nuttalli, I. crenulatus, and H. danieli ticks. Statistics analysis indicated that A. bovis was more likely to infect male ticks and ticks at altitude above 4000 m. This result may be related to the distribution of its mammal hosts, since the majority of the yak population lives at altitudes more than 4000 m.

A. ovis is widely distributed in Asia, Europe, Africa and North American. Several msp4 gene variants of A. ovis have been identified in sheep and goats in northwest regions of China [14, 33, 34]. D. nuttalli, Hyalomma asiaticum and Rhipicephalus pumilio are vectors of A. ovis in China [9]. We detected A. ovis in D. abaensis, D. nuttalli, H. tibetensis, and four msp4 gene variants were identified in ticks. These variants showed high similarities to those from Chinese and Spanish strains, indicating diversity of A. ovis in the study ticks.

A. capra was initially identified in goats, and was subsequently considered to be an emerging human pathogen [1]. A. capra was previously identified in H. qinghaiensis in Gansu Province, in H. longicornis in Shandong Province, and in I. persulcatus in Heilongjiang Province [35, 36]. We detected A. capra in H. qinghaiensis, D. abaensis, and D. nuttalli, and two genotypes were identified on the basis of gltA, 16S rRNA, groEL gene analysis. One genotype showed high sequence identity to the A. capra HLJ-14 strain, which had been reported in both goats and humans in China [1]. Another genotype showed low sequence identity to the strain HLJ-14 of A. capra, but high identity to an A. capra-like bacteria from H. qinghaiensis ticks [35]. Additionally, H. qinghaiensis is the dominant tick species for the infection of A. capra, and high prevalence occurs in the ticks found at altitudes less than 3000 m.

Although the present study has revealed the current status of ixodid tick infestation with Anaplasma spp. in the investigated areas, the specific biological vector for the individual Anaplasma species need to be further studied by transmission experiments. In addition, the infections of Anaplasma species in animals or humans should be investigated to understand the true impact of anaplasmosis in Qinghai Province.

Conclusions

We demonstrated the prevalence of A. bovis, A. ovis, A. phagocytophilum, and A. capra in ticks from 22 counties of Qinghai Province. Anaplasma infection in ticks is associated with the species, gender and distribution of the ticks. The prevalence of A. capra in ticks may be a threat to public health in Qinghai Province.

Multilingual abstracts in the five official working languages of the United Nations. (PDF 726 kb)