Comparative analysis of complete chloroplast genome sequences of four major Amorphophallus species.

Amorphophallus (Araceae) contains more than 170 species that are mainly distributed in Asia and Africa. Because the bulbs of Amorphophallus are rich in glucomannan, they have been widely used in food, medicine, the chemical industry and so on. To better understand the evolutionary relationships and mutation patterns in the chloroplast genome of Amorphophallus, the complete chloroplast genomes of four species were sequenced. The chloroplast genome sequences of A. albus, A. bulbifer, A. konjac and A. muelleri ranged from 162,853 bp to 167,424 bp. The A. albus chloroplast (cp) genome contains 113 genes, including 79 protein-coding genes, 30 tRNA genes and 4 rRNA genes. The A. bulbifer cp genome contains 111 genes, including 78 protein-coding genes, 29 tRNA genes and 4 rRNA genes. A. muelleri contains 111 and 113 genes, comprising 78 and 80 protein-coding genes, respectively, 29 tRNA genes and 4 rRNA genes. The IR (inverted repeat) region/LSC (long single copy) region and IR/SSC (short single copy) region borders of the four Amorphophallus cp genomes were compared. In addition to some genes being deleted, variations in the copy numbers and intron numbers existed in some genes in the four cp genomes. One hundred thirty-four to 164 SSRs (simple sequence repeats) were detected in the four cp genomes. In addition, the highest mononucleotide SSRs were composed of A and T repeat units, and the majority of dinucleotides were composed of AT and TA. SNPs (single nucleotide polymorphisms) and indels (insertion-deletions) were calculated from coding genes and noncoding genes, respectively. These divergences comprising SSRs, SNPs and indel markers will be useful in testing the maternal inheritance of the chloroplast genome, identifying species differentiation and even in breeding programs. Furthermore, the regression of ndhK was detected from four Amorphophallus cp genomes in our study. Complete cp genome sequences of four Amorphophallus species and other plants were used to perform phylogenetic analyses. The results showed that Amorphophallus was clustered in Araceae, and Amorphophallus was divided into two clades; A. albus and A. konjac were clustered in one clade, and A. bulbifer and A. muelleri were clustered in another clade. Phylogenetic analysis among the Amorphophallus genus was conducted based on matK and rbcL. The phylogenetic trees showed that the relationships among the Amorphophallus species were consistent with their geographical locations. The complete chloroplast genome sequence information for the four Amorphophallus species will be helpful for elucidating Amorphophallus phylogenetic relationships.

Introduction

The Amorphophallus (Araceae) genus contains more than 170 species, mainly distributed throughout Asia and Africa. Twenty-six species were found in Sichuan, Chongqing, Yunan, Guizhou and Hubei Provinces in China[1]. Because the bulbs of Amorphophallus are rich in glucomannan, they have been widely used in food, medicine, the chemical industry and so on[2]. In general, the Amorphophallus genus produces starch and glucomannan, depending on the species. Much research has focused on in vitro propagation systems, due to the accumulation of pathogens from normal asexual reproduction, to increase the yield of Amorphophallus[3,4]. The nucleotide sequences (ITS1) and plastid sequences (rbcL and matK) revealed a new subgeneric delineation by large-scale phylogenetic analysis of Amorphophallus[5].

The genome size of Amorphophallus is quite large, approximately 20 times larger than the rice genome[6]. Furthermore, large variation exists in the genomic sequences of Amorphophallus species. Therefore, sequencing the whole genome of Amorphophallus species is very difficult. Complete sequencing of chloroplast (cp) genomes is much easier to achieve in Amorphophallus species. The plant chloroplast is a key plastid involved in photosynthesis and carbon fixation[7]. Chloroplast genomes are more conserved than nuclear genomes and contain four important regions: a large single-copy (LSC) region, a small single-copy (SSC) region and a pair of inverted repeats (IRA, IRB)[8]. The cp genome contains important information and genetic markers for phylogenetic and taxonomic analyses between plant species and individuals[9-11] because of the low rates of polymorphisms, indels and SNPs in cps. More than 800 cp genomes have been sequenced and deposited in the NCBI. The first cp genome was discovered in Zea mays[12], and a complete sequence was determined in Nicotiana tabacum and Marchantia polymorpha[13,14]. A circular cp genome of Aquilaria sinensis was found to be 159,565 bp long and contained 82 protein-coding genes. Zhang et al. reported sequences for five Epimedium species cp genomes, which provided valuable genetic information for accurately identifying species and assisted in the utilization of Epimedium plants[15]. These complete cp genome sequences have been widely used in the development of molecular markers for phylogenetic research[16,17]. Because of the ability for intracellular gene transfer and the conservation, diversity, and genetic basis of chloroplasts, transgene development has allowed for the engineering of high-value agricultural or biomedical products[18]. With the advent of high-throughput sequencing technology, it has become both standard practice and inexpensive to obtain cp genome sequences.

In this study, for the first time, we sequenced the complete cp genomes of four major Amorphophallus species using high-throughput sequencing technology and the Illumina HiSeq2500 platform. This study had four aims: (1) determine the size range and structure of four Amorphophallus species cp genomes; (2) compare the variations of simple sequence repeats (SSRs) among four major Amorphophallus cp genomes; (3) examine the indels and SNPs among four major Amorphophallus cp genomes; (4) confirm the phylogenetic relationship among four Amorphophallus species, as well as other species, using the complete cp genomes. These results will provide valuable and basic sequence information for taxonomic study and the development of molecular markers for further species identification of Amorphophallus. After the completion of the whole cp genome sequence, it is possible to build a database of the species. Based on the differences in the gene sequences of the four cp genomes, a DNA barcode can easily be developed to allow for the building of an efficient platform for postgenomics species research, such as subsequent gene excavation and functional verification of DNA sequence information.

Results and Discussions

Organization of four chloroplast genomes

Approximately 2G of data for each cp genome was obtained with a 300 bp read length. Gap closing was based on the sequence of the complete cp genome from Colocasia esculenta (NC_016753)[19]. The chloroplast genome sequences of the four genomes ranged from 162,853 bp (A. bulbifer) to 167,424 bp (A. konjac) (Fig. 1, Table 1). The same typical quadripartite structure was displayed in the four cp genomes. Two IR regions (25,379-26,120 bp) were separated by an LSC region (90,467-92,660 bp) and an SSC region (21,628-22,839 bp) (Table 1). The IRB region was 39 bp longer than the IRA region in the A. konjac cp genome. The IR/LSC and IR/SSC borders of the four Amorphophallus cp genomes were compared (Fig. S1). The variation of the IR/LSC and IR/SSC borders was considered to be the primary mechanism causing the length differences of angiosperm cp genomes[20]. The GC content ranged from 35.39% to 35.90% for the four cp genomes (Table 1). These four Amorphophallus cp genome data were deposited in GenBank.

Figure 1

Gene maps of the four Amorphophallus cp genomes. (A) A. albus, (B) A. bulbifer, (C) A. konjac, (D) A. muelleri. The annotation of the genome was performed using DOGMA. The genes that are drawn on the outside of the circle are transcribed clockwise, while those inside are transcribed counter clockwise. Genes belonging to different functional groups are color coded. Small single copy (SSC), large single copy (LSC), and inverted repeats (IRa, IRb) are indicated.

Table 1

Summary of the sequencing data for the four Amorphophallus species.

Species	Raw reads no.	Clean reads no.	Gene no.	Protein coding genes no.	tRNA genes no.	rRNA genes no.	Cp genome length (bp)	LSC length (bp)	IRa length (bp)	SSC length (bp)	IRbLength (bp)	GC content (%)
Amorphophallus albus	7383690	6572597	113	79	30	4	166867	92249	25926	22766	25926	35.47
Amorphophallus bulbifer	8590079	7645378	111	78	29	4	162853	90467	25379	21628	25379	35.90
Amorphophallus konjac	7282525	6532968	111	78	29	4	167424	92660	25973	22839	26012	35.39
Amorphophallus muelleri	10581954	8610905	113	80	29	4	164669	90789	26120	21640	26120	35.69

Divergence hotspots in four chloroplast genomes

The A. albus cp genome contains 113 genes, including 79 protein-coding genes, 30 tRNA genes and 4 rRNA genes. The A. bulbifer cp genome contains 111 genes, including 78 protein-coding genes, 29 tRNA genes and 4 rRNA genes. Both the A. konjac and A. muelleri cp genomes contain 112 genes, comprising 79 protein-coding genes, 29 tRNA genes and 4 rRNA genes. All of the features are shown in Table 1 and annotated in Fig. 1. All these genes play different roles in the chloroplast, and the classification is shown in Table 2.

Table 2

List of genes encoded by the four Amorphophallus chloroplast genomes.

Category for genes	Group of genes	Name of genes
Self-replication	rRNA genes	rrn16a, rrn23a, rrn4.5a, rrn5a
	tRNA genes	trnA-UGC*,a, trnC-GCA, trnD-GUC, trnE-UUC, trnF-GAA, trnfM-CAU, trnG-GCC (Aa, Ab, Am), trnG-UCC, trnH-GUG, trnI-CAU a, trnI-GAU *,a, trnK-UUU, trnL-CAA a (Aa, Ak), trnL-UAA*, trnL-UAG, trnM-CAU a, trnN-GUU a, trnP-GGG, trnP-UGG, trnQ-UUG, trnR-ACGa, trnR-UCU, trnS-GCU, trnS-GGA, trnS-UGA, trnT-UGU, trnT-GGU (Aa, Ab a, Ak, Am a), trnV-GAC,a, trnV-UAC*, trnW-CCA, trnY-GUA
	Small subunit of ribosome	rps2, rps3, rps4, rps7a, rps8, rps11, rps12 b, rps14, rps15, rps16, rps18, rps19
	Large subunit of ribosome	rpl2 (Aa*, Ab*, a, Am*, a, Ak*, a), rpl20, rpl23 (Aa*, Aba, Am*, a, Ak*, a), rpl33, rpl36, rpl14, rpl16, rpl22, rpl32
	RNA polymerase	rpoA, rpoB, rpoC1*, rpoC2
Phytosynthesis	NADH-dehydrogenase	ndhA a, ndhB*, a, ndhC, ndhD, ndhE, ndhF, ndhG, ndhH, ndhI, ndhK, ndhJ psbG,
	Photosystem I	psaA, psaB, psaC, psaI, psaJ, ycf3**
	Photosystem II	psbA, psbB, psbC psbD, psbE (Aa, Ab, Am), psbF (Aa, Ab, Am, Ak*), psbH, psbI, psbJ, psbK, psbL, psbM, psbN, psbT, psbZ
	Cytochrome b/f complex	petA, petB, petD, petL, petG, petN,
	ATP synthase	atpA, atpB, atpE, atpF*, atpH, atpI
	Large subunit to rubisco	rbcL
Other genes	Maturase	matK
	Protease	clpP(Aa**, Ab, Am, Ak**)
	Envelope membrane protein	cemA
	Subunit of Acetyl-CoA-Carboxylase	accD(Am)
	c-type cytochrome synthesis gene	ccsA
	Translational initiation factor	infA**
Genes of unknown function	Open Reading Frames	ycf1 (Aa, Ak, Am), ycf2 (Aaa, Aba, Am*, a, Aka), ycf4,
Putative pseudogenes		ycf15 (Aa*, a, Aba, Am*, a, Aka), ycf68 a

aGene with two copies; bGene with three copies; *Gene with one intron; **Gene with two introns.

( )Gene existed in which species cp genome as well as copy number and intron number in each cp genome.

Aa, Amorphophallus albus cp genome; Ab, Amorphophallus bulbifer cp genome; Ak, Amorphophallus konjac cp genome; Am, Amorphophallus muelleri cp genome.

The estimated deletion of some genes was detected in some Amorphophallus cp genomes (Table 3). The ycf1 gene was present in three cp genomes but not in the A. bulbifer cp genome. Another gene named trnL-CAA appeared in the A. albus and A. konjac cp genomes. The trnG-GCC gene was lost in the A. konjac cp genome. The accD gene was found only in the A. muelleri cp genome, and psbE was missing only in the A. konjac cp genome. The rpl2 and rpl23 genes were annotated in the IRA and IRB regions of the four cp genomes, but they were only found in the IRA region and were lost in the IRB region in the A. albus cp genome.

Table 3

Summary of genes estimate deletion in the four Amorphophallus cp genomes.

Gene	Species (cp genome)				Region
	A. albus	A. bulbifer	A. konjac	A.muelleri
ycf1	+	−	+	+	SSC
rpl23	IRA+; IRB−	+	+	+	IR
rpl2	IRA+; IRB−	+	+	+	IR
trnL-CAA	+	−	+	−	IR
trnG-GCC	+	+	−	+	LSC
accD	−	−	−	+	LSC
psbE	+	+	−	+	LSC

+ Gene existing. − Gene estimate deletion.

In addition to some genes being deleted, variations in the copy numbers and intron numbers of some genes were also found in the four cp genomes. Eight protein-coding genes, four rRNA genes, nine tRNA genes and two putative genes were present in two copies. Moreover, trnT-GGU was found to have two copies only in the A. bulbifer and A. muelleri cp genomes. In addition, three copies of the rps12 gene were found. Fifteen genes contained introns, including four tRNA genes, ten protein-coding genes and one putative gene. The psbF and ycf2 genes containing one intron were only found in the A. muelleri cp genome. There were no introns in the clpP gene in the A. bulbifer and A. muelleri cp genomes, but there were two introns in this gene in the A. albus and A. konjac cp genomes, while ycf3 and infA had two introns in each of the four cp genomes. All of the above divergences are shown in Table 2. The development of molecular markers for the identification of Amorphophallus species was much easier based on the divergence hotspot regions of the four Amorphophallus cp genomes.

COG analysis

COG (clusters of orthologous groups of proteins) and KOG (eukaryotic ortholog groups) are based on the relationship between orthologous genes in the NCBI annotation system for prokaryotes and eukaryotes[21], respectively. Homologous genes from different species can be divided into different ortholog clusters combining evolutionary relationships. There are 4,873 categories in COG and 4,852 in KOG. Genes that are orthologs have the same function, and the functional annotation can be inferred to other members of the same COG/KOG clusters. All of the genes from the four cp genomes were classified into six categories: energy production and conversion; translation, ribosomal structure and biogenesis; posttranslational modification, protein turnover and chaperones; transcription; carbohydrate transport and metabolism; and lipid metabolism. The number of genes classified under each function in the four Amorphophallus genomes is shown in Fig. S2.

SSR polymorphisms and SNP/Indel analysis

SSRs are important molecular markers for plant evolutionary and ecological studies[15], and they are widely present in the cp genome. With MISA analysis, 134–164 SSRs were detected in the four cp genomes (Table 4). Among these SSRs, mono-, di-, tri-, tetra-, and hexanucleotides were detected. The mononucleotide SSRs were most common, with 70.15% of the SSRs observed in A. bulbifer. In addition, most of the mononucleotide SSRs were composed of A and T repeat units, and the majority of the dinucleotides were composed of AT and TA. The cp SSRs are normally composed of short polyA or polyT repeats[22]. Higher contents of A/T and AT/TA repeats in cp SSRs were also detected in the Metasequoia glyptostroboides cp genome[23]. Hexanucleotide repeat unit SSRs were in the A. muelleri cp genome only at a portion of 2.08%. In short, the cp SSRs represented rich variation and were absolutely useful for polymorphism analysis in the Amorphophallus species.

Table 4

Simple sequence repeats (SSRs) in the four Amorphophallus species cp genomes.

Species	SSR loci no.	P1 loci no.	P2 loci no.	P3 loci no.	P4 loci no.	P5 loci no.	P6 loci no.
Amorphophallus albus	163	86	49	27	1	/	/
Amorphophallus bulbifer	134	94	25	14	1	/	/
Amorphophallus konjac	164	82	51	30	1	/	/
Amorphophallus muelleri	144	80	45	15	1	/	3

Using the A. albus cp genome as the reference sequence, we compared the SNP/indel loci of the four cp genomes. SNP markers were detected in 65 protein-coding genes in A. bulbifer, A. konjac and A. muelleri cp genomes. Eleven genes were in the SSC region, and 54 genes were in the LSC region, indicating that the protein-coding genes in the IR region were more conserved. These 65 genes were divided into four categories according to their different functions in plant chloroplasts, including photosynthetic apparatus, photosynthetic metabolism, gene expression, and other genes. Nine hundred sixty-nine and 943 SNP markers were detected between A. albus and A. bulbifer in protein-coding genes and noncoding regions, respectively. One hundred and four and 176 SNP markers were detected between A. albus and A. konjac in protein-coding genes and noncoding regions, respectively. Nine hundred and seventy-eight and 926 SNP markers were detected between A. albus and A. muelleri in protein-coding genes and noncoding regions, respectively. The SNPs in the A. konjac cp genome were significantly fewer than those in the A. bulbifer and A. muelleri cp genomes. One hundred and fifty-nine SNP sites were found in Oryza. sativa and Oryza. nivara chloroplast genomes[24], 591 SNP markers were detected between the Solanum tuberosum and S. bulbocastanum plastomes[25], and 464 were detected between the plastomes of P. ginseng and P. notoginseng[26].

All of the SNPs were classified into two types, including synonymous (S) and nonsynonymous (N) (Table 5, Fig. 2). For the 969 and 978 SNP markers in the gene coding regions of the A. bulbifer and A. muelleri cp genomes, respectively, 696 and 708 belonged to the nonsynonymous type, and 273 and 270 belonged to the synonymous type. Synonymous and nonsynonymous SNP makers from the gene coding genes shared very similar numbers in these two cp genomes. There were 32 synonymous SNPs and 72 nonsynonymous SNPs in the protein coding regions of the A. konjac cp genome. Forty-eight nonsynonymous and 47 synonymous SNP sites were detected in the Machilus cp genome, implying that a substitution constraint mechanism existed[27]. Genes ycf3, rpoC1 and clpP were detected with SNP markers in their introns. Six, 1 and 6 SNP markers were found in one intron from rpoC1; 6, 1 and 5 SNP markers were found in one intron from ycf3; 23, 7 and 25 SNP markers were found in two introns from clpP in the A. bulbifer, A. konjac and A. muelleri cp genomes, respectively. ClpP and ycf1 were the variation hotspots for SNPs and indels, and they were usually used for investigating sequence variation in seed plants[28,29].

Table 5

Comparisons of mutation changes, number of synonymous (S) and nonsynonymous (N) substitutions per gene of protein coding cp genes among A. bulbifer, A. konjac and A. muelleri.

	Gene	A. bulbifer		A. konjac		A. muelleri		Region
		S	N	S	N	S	N
Photosynthetic apparatus	psbA	9	0	0	0	9	0	LSC
	psbB	7	2	0	0	8	2	LSC
	psbD	2	1	0	0	2	1	LSC
	psbC	3	1	0	0	3	1	LSC
	psbF	2	0	1	0	2	0	LSC
	psbG	2	5	1	0	2	5	LSC
	psbH	2	0	0	0	2	0	LSC
	psbI	3	1	0	0	3	1	LSC
	psbL	1	0	1	0	1	0	LSC
	psbN	1	0	0	0	1	0	LSC
	psaA	10	4	0	0	10	4	LSC
	psaB	10	2	2	2	9	2	LSC
	psaC	1	0	0	0	2	0	SSC
	psaI	1	0	0	0	1	0	LSC
	psaJ	0	1	0	0	0	0	LSC
	petA	3	3	1	0	3	3	LSC
	petB	3	0	0	0	3	0	LSC
	petD	2	1	0	0	3	1	LSC
	petG	1	0	1	0	1	0	LSC
	petL	0	0	0	0	0	1	LSC
	ycf3*	3	1	0	0	1	1	LSC
	Total	66	22	7	2	66	22
Photosynthetic metabolism	atpA	9	5	0	1	8	6	LSC
	atpB	7	5	0	0	8	5	LSC
	atpE	2	1	0	0	2	1	LSC
	atpF	0	4	0	0	0	4	LSC
	atpH	1	1	0	0	1	1	LSC
	atpI	3	3	2	1	3	3	LSC
	ndhA	10	12	2	4	10	12	SSC
	ndhC	1	2	1	1	1	2	LSC
	ndhD	17	6	2	0	16	5	SSC
	ndhE	4	0	0	0	4	0	SSC
	ndhF	13	14	2	4	11	16	SSC
	ndhG	2	4	1	2	2	5	SSC
	ndhH	11	7	3	0	12	6	SSC
	ndhI	3	1	0	0	3	1	SSC
	ndhJ	1	0	0	0	0	0	LSC
	rbcL	12	2	2	0	12	2	LSC
	Total	96	67	15	13	93	69
Gene expression	rpoA	3	5	0	0	2	5	LSC
	rpoB	10	23	1	3	11	22	LSC
	rpoC2	18	41	3	8	17	41	LSC
	rpoC1*	12	13	1	2	14	13	LSC
	rps2	4	30	1	1	4	31	LSC
	rps3	1	40	0	1	1	39	LSC
	rps4	3	22	0	1	3	24	LSC
	rps8	1	5	0	0	1	5	LSC
	rps11	7	30	0	0	7	33	LSC
	rps12	2	5	0	0	1	5	LSC
	rps14	2	11	0	1	2	12	LSC
	rps15	0	13	0	5	0	13	SSC
	rps16	0	6	0	0	0	8	LSC
	rps18	1	14	0	3	1	14	LSC
	rps19	2	27	1	1	3	26	LSC
	rpl14	1	19	0	0	0	17	LSC
	rpl16	1	10	0	0	1	10	LSC
	rpl20	2	11	0	1	2	10	LSC
	rpl22	4	8	0	1	4	8	LSC
	rpl32	1	2	0	0	1	2	SSC
	rpl33	1	2	0	1	1	3	LSC
	rpl36	1	9	0	0	1	10	LSC
	Total	77	346	7	29	77	351
Other genes	ycf1	12	170	0	24	12	174	SSC
	ycf4	2	3	0	0	2	3	LSC
	cemA	2	6	0	1	2	6	LSC
	clpP*	15	73	2	3	14	74	LSC
	infA	1	2	0	0	1	2	LSC
	cemA	2	7	1	0	3	7	LSC
	Total	34	261	3	28	34	266

*SNP markers were detected in their introns.

Figure 2

SNPs statistics of A. bulbifer, A. konjac and A. muelleri cp genomes. The Amorphophallus albus cp genome was used as the reference sequence for SNPs analyses for the other three cp genomes. SNPs belonging to different type groups are color coded. (A) Number of SNPs in the A. bulbifer cp genome sequence. (B) The number of SNPs in the A. konjac cp genome sequence. (C) The number of SNPs in the A. muelleri cp genome sequence.

cpSSR and SNP markers will be useful in testing maternal inheritance of the cp genome, identifying species differentiation and even in breeding programs[30]. cpSSRs have been demonstrated to be useful in gene flow studies to estimate seed and pollen contribution[31] and in phylogeographic analyses[32].

Twenty-two protein-coding genes from three Amorphophallus cp genomes contained indels (Table 6). Only two coding genes were detected to contain indels in the A. konjac cp genome; one indel was in rps15, and two indels existed in ycf1. The indel numbers of each coding gene from the A. bulbifer and A. muelleri cp genomes are shown in Fig. 3A,B. The gene ycf1 was a hotspot for indel variation, and almost half of the number of indels existed in this gene (Fig. 3). Such mutational loci in cp genomes showed highly variable regions in the genomes.

Table 6

Comparisons of InDels of protein coding cp genes among A. bulbifer, A. konjac and A. muelleri.

Gene	motif	size	Direction
matK	Ab: accaaataccaa	12	Deletion
	Am: accaaataccaa	12	Deletion
psbI	Ab: aaaa	4	Insertion
	Am: aataa	5	Insertion
rps2	Ab: cttttt	6	Insertion
	Am: tctttt	6	Insertion
rpoC2	Ab: aat	3	Deletion
rpoC2	Ab: act	3	Insertion
	Am: cat	3	Insertion
rpoC1	Ab: a	1	Insertion
	Am: tta	3	Insertion
rps14	Ab: tttttt	6	Insertion
	Am: tttttt	6	Insertion
psbG	Ab: ttt	3	Deletion
	Am: ttt	3	Deletion
ndhK	Ab: aaaaaaaa	8	Insertion
	Am: ttggaattgggagaataaccca	22	Insertion
atpB	Ab: a	1	Insertion
	Am: a	1	Insertion
cemA	Ab: tgat	4	Deletion
	Am: tgat	4	Deletion
rpl33	Ab: a	1	Insertion
	Am: t	1	Deletion
rps18	Ab: aaaaaaaaaa	10	Insertion
clpP	Ab: t	1	Insertion
	Am: a	1	Deletion
clpP	Ab: t	1	Insertion
	Am: t	1	Insertion
clpP	Ab: c	1	Deletion
	Am: c	1	Deletion
clpP	Ab: c	1	Deletion
	Am: c	1	Deletion
clpP	Ab: g	1	Insertion
	Am: g	1	Insertion
clpP	Ab: g	1	Deletion
	Am: g	1	Deletion
rps11	Ab: a	1	Insertion
	Am: a	1	Insertion
rps11	Ab: t	1	Deletion
	Am: t	1	Deletion
rps11	Ab: c	1	Insertion
	Am: c	1	Insertion
rps8	Ab: tttccctag	9	Deletion
	Am: tttccctag	9	Deletion
rps8	Ab: cggg	4	Insertion
	Am: ctggttg	7	Insertion
rpl14	Ab: aaaacg	6	Insertion
	Am: aatatacg	8	Insertion
rpl14	Ab: aatttt	6	Insertion
rps3	Am: ta	2	Insertion
rpl22	Ab: c	1	Insertion
rpl22	Am: c	1	Insertion
rps19	Ab: aaa	3	Deletion
	Am: aaa	3	Deletion
ndhF	Ab: tttgaca	7	Deletion
ndhF	Ab: aaa	3	Insertion
	Am: aatcca	6	Insertion
ndhF	Am: ttttttt	7	Insertion
rps15	Ab: g	1	Deletion
rps15	Ab: gttgaattaacg	12	Deletion
rps15	Am: cgaga	5	Deletion
rps15	Ab: gtttttg	7	Deletion
rps15	Am: aaa	3	Deletion
rps15	Am: g	1	Deletion
rps15	Ab: aaaa	4	Insertion
rps15	Ak: aaaa	4	Insertion
ycf1	Ab: agg	3	Insertion
	Am: tagg	4	Insertion
ycf1	Ab: ctttt	5	Insertion
	Am: tcttt	5	Insertion
ycf1	Am: gttttttaa	9	Deletion
ycf1	Am: ttatta	6	Insertion
ycf1	Ab: aaaaaaaccccccccggggttttttttttt	30	Insertion
	Am: tcgtccaggcatcaatatcgctatttattt	30	Insertion
ycf1	Ab: aacctt	6	Insertion
	Am: ctcaat	6	Insertion
ycf1	Ab: aaaaccgg	8	Insertion
	Am: atatcgatatcg	12	Insertion
ycf1	Ab: ccatataga	9	Deletion
	Am: ccatataga	9	Deletion
ycf1	Ab: ttttctgtg	9	Deletion
	Am: ttttctgtg	9	Deletion
ycf1	Ab: aagttt	6	Insertion
	Am: gtatat	6	Insertion
ycf1	Ab: cat	3	Deletion
	Am: cat	3	Deletion
ycf1	Ab: ccgtaataa	9	Deletion
	Am: ccgtaataa	9	Deletion
ycf1	Ab: acc	3	Insertion
	Am: tctatc	6	Insertion
ycf1	Ab: aaaacgttttttttt	15	Insertion
ycf1	Am: tga	3	Insertion
ycf1	Am: ttc	3	Insertion
ycf1	Am: tt	2	Insertion
ycf1	Am: t	1	Insertion
ycf1	Ab: act	3	Insertion
	Am: cat	3	Insertion
ycf1	Ab: c	1	Insertion
	Am: ttc	3	Insertion
ycf1	Ab: a	1	Insertion
	Am: tta	3	Insertion
ycf1	Am: g	1	Deletion
ycf1	Ab: cctttt	6	Insertion
	Am: tccttt	6	Insertion
ycf1	Ab: gattttcgccatcgtacttt	20	Deletion
	Am: gattttcgccatcgtacttt	20	Deletion
ycf1	Ak: atcgatctttagattttcgcc	21	Deletion
ycf1	Ab: g	1	Deletion
	Am: g	1	Deletion
ycf1	Am: tctttctttctctttttctttct	23	Insertion
ycf1	Am: tt	2	Insertion
ycf1	Am: tc	2	Insertion
ycf1	Ab: cccccgtttttttttttttttttt	24	Insertion
ycf1	Ak: tcagaa	6	Insertion
ycf1	Ab: ctt	3	Insertion
ycf1	Am: gttcattattatcattatcattat	24	Insertion
ycf1	Am: a	1	Insertion
ycf1	Am: atc	3	Insertion
ycf1	Am: attatcattatcatt	15	Insertion
ycf1	Ab: g	1	Insertion
	Am: g	1	Insertion
ycf1	Ab: a	1	Insertion
	Am: a	1	Insertion
ycf1	Ab: c	1	Insertion
	Am: c	1	Insertion
ycf1	Ab: c	1	Insertion
	Am: ttc	3	Insertion
ycf1	Ab: gg	2	Insertion
	Am: gg	2	Insertion
ycf1	Ab: c	1	Insertion
	Am: c	1	Insertion
ycf1	Am: atcattcctgat	12	Insertion
ycf1	Am: cg	2	Insertion
ycf1	Am: ga	2	Insertion
ycf1	Am: tc	2	Insertion
ycf1	Ab: ttaaaaagg	9	Deletion
	Am: ttaaaaagg	9	Deletion
ycf1	Ab: aaccccgggg	10	Insertion
	Am: ttgttccagttgttccgg	18	Insertion
ycf1	Am: caa	3	Insertion

Ab Amorphophallus bulbifer cp genome, Ak Amorphophallus konjac cp genome, Am Amorphophallus muelleri cp genome

Figure 3

InDels statistics of A. bulbifer and A. muelleri cp genomes. The Amorphophallus albus cp genome was used as the reference sequence for InDels analyses for the other three cp genomes. InDels belonging to different coding genes are color coded. Only three InDels were detected in the A. konjac cp genome, so the statistics results are shown in the main text. (A) The number of InDels of each coding gene in the A. bulbifer cp genome sequence, (B) The number of InDels of each coding gene in the A. muelleri cp genome sequence.

ndhK regression in four Amorphophallus species cp genomes

The ndhK gene was a new gene represented in the four Amorphophallus species cp genomes. It was 744 bp in length in the A. albus and A. konjac cp genomes, and 741 bp in length in the A. bulbifer and A. muelleri cp genomes. The gene ndhK is present in a novel protein complex of the thylakoid membrane and shows homology to a mitochondrial gene that encodes a subunit of the NADH-ubiquinone oxidoreductase of the mitochondria[33]. ndhK was reported as a gene encoding a subunit of PSII, but later, this protein was classified as a subunit of NADH dehydrogenase, and the gene has been renamed ndhK[34,35]. In many plants, such as Glycine max, Epimedium acuminatum, Psilotum nudum, Machilus yunnanensis, Actinidia chinensis, Veronica persica, and Aquilaria sinensis (Lour.) Gilg., ndhK was lost from their cp genomes[15,18,27,36-39]. ndhK has been found in the Paramecium aurelia mitochondrial (mt) genome[40]. The presence of this gene in the mt genome raises interesting questions concerning its evolutionary origin. The gene ndhK may play a crucial role in photosynthesis in four Amorphophallus species, and its presence in the cp genomes can be used as a marker for distinguishing them from other family species.

Phylogenetic analysis

Phylogenetic analysis of Amorphophallus species has been reported using different aspects, such as several chloroplast genes[41], two chloroplast genes, leafy intron sequences[42], plastid DNA markers and fingerprinting[43]. These studies simply demonstrated Amorphophallus sample species relationships and did not include the four Amorphophallus species that are the major commercial cultivation species used in our study. In addition, whole chloroplast sequences were much more accurate than individual gene sequences for phylogenetic analysis. In the present study, complete cp genomes sequences of four Amorphophallus species and other plants (Table S1) were used to perform phylogenetic analyses (Fig. 4). The clade of the four species of Amorphophallus was grouped with other Araceae species as expected. A. albus and A. konjac were clustered into one clade, and A. bulbifer and A. muelleri were clustered into another clade. These results showed that A. albus and A. konjac had a close relationship, and A. bulbifer and A. muelleri were closely related. The matK and rbcL genes were also used for phylogenetic analysis among the Amorphophallus genus (Figs S3 and S4). Both of the phylogenetic trees indicated that the Amorphophallus species were grouped into three major clades named Africa, southeast Asia, and Continental Asia. The Continental Asia clade covered the taxa distributed from India to China and Thailand, which were subdivided into two subclades, Continental Asia I and II. The four Amorphophallus species in our study were all derived from the Chinese mainland; A. albus and A. konjac were grouped as Continental Asia I, and A. bulbifer and A. muelleri were grouped as Continental Asia II. The first two species came from the central region of China, and the other two species were collected from the southern region of China near Burma. The matK and rbcL genes well supported clades in consensus trees and the resolution of ingroup relationships within Amorphophallus[44]. All the results suggested that the relationship in Amorphophallus was consistent with the biogeographical distribution. A. konjac and A. bulbifer were also classified in two different clades by Sedayu[42]. A. albus and A. konjac have the same chromosome number (2N = 2X = 26), while A. bulbifer and A. muelleri are triploid (3N = 3X = 39). The propagation coefficient of A. albus and A. konjac did not exceed single digits, while the propagation coefficient in A. bulbifer and A. muelleri increased significantly because of aerial bulbs growing in the stems. The aerial bulbs diminish the need for sexual reproduction and lead to a significantly increased reproductive capacity. In many cases, the evolutionary process is closely linked with the reproduction system of the species. A. muelleri and A. bulbifer reproduce, thus far, through apomictic processes. The corm of A. bulbifer is light red, and that of A. muelleri is light yellow. These phenotypes also demonstrated the relationship among the four Amorphophallus species. The sequenced cp genomes of the four Amorphophallus species provide a large amount of genetic information for phylogenetic analysis and taxonomic study.

Figure 4

Phylogenetic tree based on 30 complete cp genome sequences.

Conclusion

We sequenced the chloroplast genomes of four Amorphophallus plants: A. albus, A. bulbifer, A. konjac, and A. muelleri. We annotated the four cp genomes and analyzed the structural divergence among the four cp genomes; moreover, we identified the SSR loci and SNPs in protein-coding genes. These SSRs and SNPs could be selected for use in developing markers and in phylogenetic analysis. Comparing the cp genomes among some plants suggested that psbG regressed in the A. albus, A. konjac, A. bulbifer and A. muelleri cp genomes. We also detected that some genes and introns were lost, in addition to copy differences of some genes among the four cp genomes. The results of SNP detection demonstrated that very few of the SNPs were identified between the A. albus and A. konjac cp genomes; on the contrary, a large number of SNPs between A. bulbifer and A. muelleri were identified when the A. albus cp genome was used as the reference sequence. Interestingly, the SNPs were almost the same in the A. bulbifer and A. muelleri cp genomes. The indel results were very similar between A. albus and A. konjac because only three indels were detected in the A. konjac cp genome. In addition, phylogenetic analysis using complete cp genome sequences showed that A. albus and A. konjac were in a clade and A. bulbifer and A. muelleri were in a different clade. The clustering analysis results verified the results of the SNP data. All the data will be very helpful in further research on Amorphophallus plants and chloroplasts and in expanding our understanding of the evolutionary history of the Amorphophallus cp genomes. All of these divergences in the four cp genomes were significant for taxonomic and evolutionary studies, as well as for genetic engineering developments in the future.

Methods

Plant material preparation and sequencing

Fresh young leaves of A. albus, A. bulbifer, A. konjac and A. muelleri were collected from live individuals at the greenhouse of Wuhan University in China. Five micrograms of cp DNA was isolated from leaves and sheared into 300 bp DNA fragments using a Covaris M220 (Covaris, United States). NEB Next ® UltraTM DNA Library Prep Kit for Illumina (NEB, United States) was used to build the library after DNA fragmentation. The genomic DNA of four species was sequenced on a single HiSeq2500 flow cell lane (Illumina Inc.) by the Chinese National Human Genome Center (http://www.chgc.sh.cn/), Shanghai, China.

Plant cp genome assembly and annotation

Trimmomatic v 0.32[45] was used for raw data processing, and the resulting clean data were used for assembly and post analysis. Fastqc v0.10.0[46] was used to evaluate the quality of the data visually. Velvet v1.2.07[47] was used to assemble the clean data, and the complete chloroplast genome sequence was obtained after gap closing. DOGMA[48] was used to annotate the cp genomes and predict the rRNA/tRNA of A. albus, A bulbifer, A. konjac, and A. muelleri. COGs (clusters of orthologous groups of proteins) were analyzed through rpsblast v2.2.30+[49]. The circular cp genome maps were drawn using the OrganellarGenomeDRAW program[50].

Mutation events analysis

To compare the mutations among the four complete cp genomes, MISA and MUMMER 3.23 software was used for SSR and SNP/indel analyses, respectively. The A. albus cp genome was used as a reference sequence for SNP/indel analyses. Definition of microsatellites (unit size/minimum number of repeats): (1/10) (2/5) (3/4) (4/4) (5/4) (6/4).

We selected twenty-six cp genomes (Table S1), representing the nine families, for phylogenetic analysis. The matK and rbcL genes were used for phylogenetic analysis among the Amorphophallus genus, and the selected species are shown in Tables S2 and S3. MEGA 6.06 software was used for building the evolutionary tree. The analysis was carried out based on the complete cp DNA sequences.

Figure S1-S4, Table S1-S3