Evaluation of FTO rs9939609 and MC4R rs17782313 Polymorphisms as Prognostic Biomarkers of Obesity: A Population-based Cross-sectional Study.

OBJECTIVES: Obesity is a significant risk factor for a number of chronic diseases, including diabetes, cardiovascular diseases, and cancer. Obesity usually results from a combination of causes and contributing factors, including genetics and lifestyle choices. Many studies have shown an association of single nucleotide polymorphisms (SNPs) in the fat mass and obesity-associated (FTO) and the melanocortin-4 receptor (MC4R) genes with body mass index (BMI). Therefore, recognizing the main genes and their relevant genetic variants will aid prediction of obesity risk. The aim of our study was to investigate the frequency of rs9939609 and rs17782313 polymorphisms in FTO and MC4R genes in an Iranian population.
METHODS: We enrolled 130 obese patients and 83 healthy weight controls and calculated their BMI. Genomic DNA was extracted from peripheral blood and the frequency of rs9939609 and rs17782313 polymorphisms in FTO and MC4R genes was determined using the tetra-primer amplification refractory mutation system-polymerase chain reaction (ARMS-PCR).
RESULTS: Significant associations were found between FTO rs9939609 and BMI. Where homozygous risk allele carriers (A-A) have significant higher odds ratio (OR) of being obese than individuals with normal BMI (OR = 6.927, p < 0.005, 95% confidence interval (CI): 3.48-13.78). No significant correlation between MC4R rs17782313 and obesity were observed when compared to healthy weight individuals. Although subjects with C-C genotype had higher odds of obesity (OR = 1.889, p = 0.077, 95%CI: 0.92-3.84).
CONCLUSIONS: This study shows a relationship between FTO polymorphism and increased BMI, therefore, SNP in the FTO gene influence changes in BMI and can be considered a prognostic marker of obesity risk.

Introduction

The prevalence of obesity and overweight are increasing and is a worldwide health epidemic.[1] Obesity is a complex disorder, which results from an imbalance between energy intake and expenditure, in which excessive body fat has accumulated to the extent that it may have a significant influence on morbidity and mortality.[2] Twin and family studies have demonstrated that genetic factors may also contribute to levels of physical activity and eating behaviors, which ultimately affect obesity. The estimates of the heritability of body mass index (BMI) is significantly high (30 to 70%).[2,3] In recent decades, there has been an impressive propagation in our knowledge base regarding obesity. It was found that the genetic components of obesity are key contributors to individual risk.[4] Obesity is a global issue with no current effective treatment.[5] Changes in diet cause the increasing prevalence of non-communicable diseases in developing countries, the Middle East, and North Africa so that 77.9% of chronic diseases are related to these countries.[6] Based on a systematic analysis of studies in 2008 on the epidemiology of obesity in 199 countries, 1.46 billion adults were overweight and 502 million were obese.[7] According to an Iranian health study conducted in 2005, the prevalence of overweight and obesity was 42.8% in men and 57% in women. Sex, age, socioeconomic factors, physical activity, smoking status, number of children, and urbanization are the main unrelated factors associated with adult obesity in Iran.[8] Obesity is gaining acceptance as a very serious primary health burden, which impairs quality of life because of its associated complications, such as diabetes, cardiovascular disease, cancer, asthma, hepatic impairment, renal dysfunction, sleep disorder, and infertility.[9]

Genome-wide association studies are used as prescreening tools for the detection of genetic variants associated with obesity and other related diseases.[10,11] It has been suggested that obesity-related genes may be involved in energy intake and expenditure. Two obesity-associated candidate genes are the fat mass and obesity-associated (FTO) gene and the melanocortin-4 receptor (MC4R) gene.[2,12,13] FTO is one of the members of the AlkB family of non-heme Fe (II) and 2-oxoglutarate dependent dioxygenases, which are involved in the repair of DNA alkylation damage.[14] Human or mice FTO protein have been shown to demethylate 3-methylthymine (3-metT) in single-stranded oligonucleotides (ssDNA) and 3-methyluracil (3-meU) in single-stranded RNA in vitro.[15] In vivo studies have confirmed the role of FTO in energy homeostasis, as FTO knockout mice exhibit intensive decreased weight, the delay in growth, destruction of white adipose tissue, and eventually death.[16-18] In contrast, FTO overexpression in mice leads to increased food intake and fat mass.[19] Nevertheless the underlying link between the putative demethylase function of FTO and/or energy homeostasis remains unknown.[14] In humans, the MC4R gene is located on chromosome 18, and similar to the FTO gene, plays a regulatory role in overweight status.[20] MC4R is a component of the leptin system, which is expressed in the brain and is part of the melanocortin signaling pathway and is known to play an important role in control of food intake and metabolic rate.[12] Various studies indicated that the MC4R rs17782313 variant is related to high energy intake, dietary fat, weight change, and risk of obesity-related diseases.[21-25]

The aim of our study was to investigate the association between FTO (rs9939609) and MC4R (rs17782313) polymorphisms as possible genetic factors in individual susceptibility to obesity.

Methods

A total of 213 Iranian volunteers were enrolled in the study including 130 obese and 83 healthy individuals. The study groups were selected regardless of gender, physical activity levels, and family history of obesity. All cases were aged over 20 years old. The study groups were classified into three groups according to their BMI: normal/healthy weight (18.5 – < 25), overweight (25 – < 30), and obese (> 30).

All patients gave their informed consent, and all procedures were approved by the Ethics Committee at Nour Danesh Institute of Higher Education, Isfahan, Iran. Briefly, 3 mL peripheral blood was collected and transferred to the lab in a sterile falcon tube.

The polymerase chain reaction (PCR) primers used were designed with Oligo 7 Software after the alignment of available GenBank sequences. The primers used are given in Table 1. Total genomic DNA was extracted from peripheral blood using the GeNet Bio extraction kit (GeNet Bio, Makrozhen, Korea) according to the manufacturer’s instructions. The concentration and purity of the DNA extracted from each sample were determined followed by OD 260/280 spectrophotometry (NanoDrop, DeNovix Inc, Wilmington, DE, USA) as well as DNA qualitative assessment on 1.5% agarose gel.

Table 1

Polymerase chain reaction primers sequence.

Genes	Forward primer (5’–3’)	Reverse primer (5’–3’)
FT0 rs9939609 inner	CCTTGCGACTGCTGTGAATATA	CAGAGACTATCCAAGTGCATCTCA
FT0 rs9939609 outer	GCTGCTATGGTTCTACAGTTCCA	TGTTCAAGTCACACTCAGCCTC
MC4R rs17782313 inner	GAAGTTTAAAGCAGGAGAGATTGTATACC	GCTTTTCTTGTCATTTCCAGCA
MC4R rs17782313 outer	TCCACATGCTATTGGTTTAAGACAA	TGCTGAGACAGGTTCATAAAAAGAG

FTO: fat mass and obesity-associated; MC4R: melanocortin-4 receptor.

Tetra-primer amplification refractory mutation system (ARMS)-PCR was performed using Biometra GmbH System (Biometra GmbH, Kat#846-X070-141, Makrozhen, Korea). The amplification was performed in a 25 µL reaction mixture containing 1 µL of DNA, 0.7 μL of each outer FTO primer, 1 µL of each inner FTO primer, 3 µL of each inner MC4R primer, 1 µL of each inner MC4R, 0.5 µL of dNTPs, 2.5 µL of buffer (10X), 1 µL MgCl2 (1Mm), and 0.2 µL Taq polymerase. Both PCR assays were run under the optimized conditions [Table 2].

Table 2

Polymerase chain reaction temperature protocols.

Genes	Initial denaturation	Cycle (32 cycles)			Final extension
	One cycle	Denaturation	Annealing	Extension	One cycle
FTO	95 oC - 5 min	95o C - 30 sec	58 oC - 30 sec	72 oC - 30 sec	72 oC - 5 min
MC4R	95 oC - 5 min	95o C- 30 sec	59 oC - 30 sec	72 oC - 30 sec	72 oC - 5 min

FTO: fat mass and obesity-associated; MC4R: melanocortin-4 receptor.

PCR products were assessed by electrophoresis on a 1.5% agarose gel stained with SYBR® Safe DNA gel stain (Invitrogen). Also PCR products sequencing were performed on an ABI PRISM® 3100 Genetic Analyzer machine (Applied Biosystems, Thermo Fisher Scientific, and Waltham, MA, USA). The variants analysis were evaluated using Finch TV Software (PerkinElmer Inc., Waltham, MA, USA).

Statistical analyses were performed using SPSS (SPSS Inc. Released 2007. SPSS for Windows, Version 16.0. Chicago, SPSS Inc). Descriptive analyses were expressed as mean±standard deviation. The chi-squared tests and odds ratios (OR) was used to compare the proportions of the groups. Comparisons were considered statistically significant if p < 0.050.

Results

Two hundred and thirteen adults were genotyped. Fifteen (23%) were homozygous for the obesity risk allele (A-A) and for the FTO SNP rs9939609, 21 (32%) were heterozygous (A-T), and 29 (45%) were wild type (T-T).

In patients with the FTO rs9939609 variant, the proportion of homozygous A-A and T-T carriers was significant (p < 0.005). Those with the FTO risk allele (A-A) had significantly higher odds of being overweight (OR = 4.269, p < 0.005, 95% CI: 2.13–8.52) [Table 3] or obese (OR = 6.927, p < 0.005, 95% CI: 3.48–13.78) [Table 4] than healthy weight/control group individuals. Moreover, no significant association between MC4R rs17782313 and obesity were observed when compared to individuals with a healthy BMI. Compared to healthy weight patients, those with MC4R risk allele (C-C) had higher odds of obesity than individuals with the T alleles (T-T and T-C) (OR = 1.889, p = 0.077, 95% CI: 0.92–3.84) [Table 3]. Analysis of the Tetra ARMS-PCR products on agarose gel showed 296 bp and 211 bp bands lane for rs9939609 and rs17782313, respectively [Figure 1]. The results obtained from sequencing confirmed the above results. To detect mutations of the FTO and MC4R genes, introns sequenced and analyzed. Sequencing results of intron 1 of the FTO gene revealed two SNP at the positions of 207 (G to A) and 231 (T to A). Also, an SNP was found at position 135 (T to C) of the MC4R gene [Figure 2].

Table 3

Summary of detected nucleotide variations and comparison overweight patients (BMI 25 – < 30) with healthy weight/control group (BMI 18.5 – < 25)

Genotypes	Patients, n = 65	Patients, %	p-value	Odds ratio
A-A (FTO)	6	10	< 0.005	4.269
T-T (FTO)	28	43	< 0.005	0.171
A-T (FTO)	31	47	ns	1.224
T-T (MC4R)	14	22	ns	0.493
C-C (MC4R)	21	32	0.077	1.889
C-T (MC4R)	30	46	ns	1.291

A p-value < 0.005 was considered statistically significant; ns: non-significant. BMI: body mass index; FTO: fat mass and obesity-associated;
MC4R: melanocortin-4 receptor.

Table 4

Summary of detected nucleotide variations and comparison obese patients (BMI > 30) with healthy weight/control group (BMI 18.5 – < 25)

Genotypes	Patients, n = 65	Patients, %	p-value	Odds ratio
A-A (FTO)	15	23	< 0.005	6.927
T-T (FTO)	29	45	< 0.005	0.244
A-T (FTO)	21	32	ns	0.624
T-T (MC4R)	27	42	0.064	0.587
C-C (MC4R)	17	26	ns	1.079
C-T (MC4R)	21	32	ns	1.582

BMI: body mass index; FTO: fat mass and obesity-associated; MC4R: melanocortin-4 receptor; ns: non-significant.

Figure 1

Electrophoresis of polymerase chain reaction (PCR) products on agarose gel 1.5% using the Tetra ARMS-PCR for the (a) fat mass and obesity-associated and (b) melanocortin-4 receptor genes. M: DNA ladder (100 bp).

Figure 2

Nucleotide alignment of fat mass and obesity-associated (FTO) and melanocortin-4 receptor (MC4R) genes, matching of the above sequences with the target sequence (Accession no.NG_012969 and AC090621 rc) was confirmed by Vector NTI software. (a) FTO and (b) MC4R genes.

Discussion

We analyzed the SNPs rs9939609 of the FTO gene and rs17782313 of the MC4R gene in a group of obese and normal-weight Iranian patients. Our study showed that FTO genetic polymorphism increase the risk of obesity in our population. However, it is important also to consider that lifestyle factors may modulate the obesity risk associated to FTO. A recent study reported that FTO rs9939609 SNP was significantly associated with BMI (p = 0.01), weight (p = 0.03), and waist circumference (p = 0.04).[26] It has been suggested that FTO gene variants have a significant association with obesity; however, the mechanisms behind this association is not yet clear. Additionally, the obesity gene FTO may influence the methylation level of other genes. It has been suggested that the obesity gene FTO is correlated with methylation changes in multiple sites, where the effect of the FTO risk allele (rs9939609) can be mediated, at least in part, via epigenetic modifications.[27] The rs9939609 SNP located in the first intron of the FTO gene is of interest in the field of obesity.[28] Homozygous loss-of-function mutations in the FTO causes severe growth retardation and multiple abnormalities whereas the loss of one functional copy of this gene is compatible with both obese and lean phenotypes. Leanness, postnatal growth retardation, and a higher metabolic rate were shown in FTO knockout mice, and in mice with a missense mutation in exon 6.[29,30] It has been determined that both genetic and non-genetic factors contribute to the development of obesity and the risk of metabolic syndrome.[31] Our study indicated that FTO rs9939609 variant was significantly associated with BMI. Also, the genotype distribution of AA-homozygotes was significantly higher in people with obesity compared to normal-weight individuals, with an increased OR (OR = 6.927, p < 0.005). Like our results, another study showed that A-A genotype carriers have a two-times higher risk for obesity compared with A-T and T-T genotype carriers.[32]

The influence of FTO rs9939609 and MC4R rs17782313 polymorphisms on obesity was previously investigated. The authors of the study found a significant connection between the FTO risk genotypes (AA + AT) and BMI (p = 0.03), and the MC4R risk genotypes (CC + CT) were associated with a greater BMI (p = 0.03).[33]

In agreement with our study, the authors of a different study showed that the FTO rs9939609 A-A genotype was significantly higher in the obese population compared to normal-weight subjects.[34] Furthermore, the authors did not observe a significant association between MC4R polymorphisms and BMI.

In contrast with this data, it has also been reported that subjects with the MC4R rs17782313 SNP exhibited a positive association with BMI (p = 0.018).[2] Numerous studies reported that MC4R variants are associated with the incidence of obesity.[35-37]

FTO gene expressed at high levels in brain and hypothalamus, a region known to be responsible for appetite regulation.[38] Biochemical studies have shown that the mutation in the FTO gene as an obesity susceptibility gene may lead to an increased risk of obesity.[14,15,27,28,30,39] A recent report suggested that the obesity-associated elements within FTO region interact with an iroquois-class homeodomain protein 3 (IRX3) gene promoter and might be controlling expression of IRX3, therefore, it is possible that the IRX3 gene is also associated to obesity.[40] In addition, mutations to obesity-related FTO introns of the FTO gene are associated with increased risk of many chronic diseases, including type II diabetes and cardiovascular disease.[26,39,41] The IRX3 promoter, a gene several hundred thousand base pairs away, interacts with obesity-related FTO introns as well as a large number of other elements, therefore these introns act as regulatory elements of IRX3 expression, although evidence shows that the FTO gene itself does not play a role this interaction.[40] Mutations within regulatory elements, spanning from chromosomal abnormalities include translocations, deletions, duplications, inversions, and aneuploidies to SNP cause diverse human diseases.[42]

MC4R is an important obesity candidate gene. This receptor consisting of 322-amino acids is encoded by a single exon located on chromosome 18q22 and is expressed at highest levels in the brain.[43] Mutations in the MC4R gene contribute to disruption in energy homeostasis, weight gain, and the development of obesity.[44] Furthermore, MC4R in the central nervous system plays a key role in regulation of glucose homeostasis. Thus, mutations in the human MC4R gene could affect the level of insulin secretion and leads to hyperinsulinemia.[45] Extensive studies of the MC4R gene polymorphism showed that, among numerous variants, the rs17782313 genotype was significantly more frequent and associated with obesity.[20,31,45-47] The mechanism of the association for rs17782313 polymorphism with BMI has not yet been elucidated and requires further study. Nevertheless, various studies suggest that the correlation between MC4R rs17782313 variant and high energy intake is significant.[24,44,46]

Conclusions

Obesity has a multifactorial origin and its prevalence has increased dramatically, thus determining the genetic polymorphism of genes might be an important approach as a marker of genetic predisposition to obesity for all population groups. Our data confirms previous observations that A-A genotype carriers have a higher risk for obesity compared with A-T and T-T genotype carriers. This knowledge may have important implications in personalized lifestyle management strategies to prevent obesity in genetically susceptible individuals. Finally, these results suggest that evaluation of FTO and MC4R genetic polymorphisms could be considered a prognostic tool to identify people at higher risk of developing obesity.