miRNA-30d serves a critical function in colorectal cancer initiation, progression and invasion via directly targeting the GNA13 gene.

MicroRNAs (miRNAs or miRs) are reported to be dysregulated in the progression and invasion of various human cancer types, including colorectal cancer (CRC). They are also reported to be molecular biomarkers and therapeutic targets in CRC. miRNAs serve functions in a plethora of biological processes, including proliferation, migration, invasion and apoptosis, and several miRNAs have been demonstrated to be involved in CRC carcinogenesis, invasion and metastasis. Aberrant miR-30d expression and its effects have been reported in certain cancer types. However, the function and underlying mechanism of miR-30d in the progression of CRC remains largely unknown. In the current study, reverse transcription-quantitative polymerase chain reaction (RT-qPCR) was performed to quantify miR-30d expression in CRC tissues. In vivo and in vitro functional assays indicated that miR-30d inhibits CRC cell proliferation. Target prediction online software packages, miRBase, TargetScan and miRANDA, and luciferase reporter assays were used to confirm the target gene GNA13. Specimens from 45 patients with CRC were analyzed for correlation between the expression of miR-30d and the expression of target gene GNA13, evaluated by RT-qPCR. miR-30d was downregulated in CRC tissues and cell lines. Ectopic expression of miR-30d inhibited cell proliferation and invasion and tumor growth ability. By contrast, inhibition of endogenous miR-30d promoted cell proliferation and tumor growth ability of CRC cells. It was indicated that miR-30d directly targets the 3'-untranslated region of the GNA13 gene. Downregulation of miR-30d led to the activation of cell proliferation in CRC. In addition, miR-30d expression was negatively correlated with the expression of GNA13 in CRC tissues. In conclusion, miR-30d inhibits cancer initiation, proliferation and invasion in colorectal cancer via targeting GNA13.

Introduction

Colorectal cancer (CRC) is the third most common cancer type for both men and women worldwide (1), and is characterized by the abnormal and malignant growth of cells in the colon and rectum. In the USA in 2017, an estimated 135,430 new cases of CRC and 50,260 cases of mortality caused by CRC were reported (2). In China in 2015, an estimated 376,300 new cases of CRC and 191,000 cases of mortality caused by CRC were reported (3). The overall CRC incidence in the general population is 5%, and the 5-year survival rate ranges from 40 to 60% (2). Over the past decade, substantial improvements have been made in currently available treatment strategies, including surgical resection, radiotherapy and chemotherapy, which have improved the survival rate to some extent (4–6). However, approximately 50% of the patients diagnosed with CRC succumb to the disease, primarily due to metastasis to the liver (7,8). Thus, it is of great importance to achieve earlier diagnosis with more advanced detection methods and improved tailoring of treatments, in order to lower the metastasis and mortality rates of advanced high-grade CRC.

MicroRNAs (miRNAs or miRs) are characterized as a group of small, highly conserved, non-coding RNAs, approximately 22–25 nucleotides in length. miRNAs interact with their complementary sequences located in the 3′-untranslated region (UTR) of target mRNAs, and therefore regulate gene expression post-transcriptionally (9). Bioinformatics predictions have indicated that miRNAs are able to modulate up to 60% of the protein-coding genes in the human genome at the translational level (8,10). Furthermore, miRNAs are reported to be dysregulated in the progression and invasion of various human cancer types and serve functions in a plethora of biological processes, including proliferation, migration, invasion and apoptosis (11,12). The miR-30 family consists of six distinct mature miRNA sequences: miR-30a/miR-30c-2, miR-30d/miR-30b and miR-30e/miR-30c-1 (13). miR-30 family members have been implicated in tumor development and progression. They act both as tumor suppressors (14–17) and as oncomirs (18–21), suggesting that they may have varying functions in different types of tumor. miR-30d is a member of the miR-30 family; its amplification has been reported to be involved in >30% of cases in multiple types of human epithelial tumor (22,23). Furthermore, dysregulation associated with miR-30d expression has been reported in various human cancer types (15,18,19,22–33).

Among the cell surface receptor classes, G protein-coupled receptors (GPCRs) are considered one of the most significant, since they serve critical functions in cell physiology (Fig. 1) (34,35). The G12 subfamily, consisting of Gα12 (GNA12) and Gα13 (GNA13), is of particular interest to oncologists since it has been reported to promote tumorigenesis (36–38). GNA12 and GNA13 are known to be upregulated in aggressive and advanced cancer tissues and potentially mediate cancer cell invasion and metastasis in various cancer types (39–44). Furthermore, the use of a specific inhibitor, p115-RGS, to suppress GNA12/13 signaling has been demonstrated to inhibit invasion and migration and prevent distant metastasis in mice (Fig. 1) (40,45,46). In addition, loss of wild type GNA13 alone has been indicated to significantly inhibit invasion and migration in vitro (47,48) and to serve a critical function in lysophosphatidic acid-stimulated invasive migration of pancreatic cancer cells (49). Furthermore, increased GNA13 expression has been reported to promote tumorigenicity and proliferative effects in gastric cancer and human small cell lung cancer cells (50,51). In the current study, the potential effect of miR-30d on colon cancer progression was evaluated. It was identified that the interaction between miR-30d and GNA13 serves a critical function in colon cancer development.

Figure 1.

Schematic diagram of G protein-coupled receptors and the underlying GNA13 mechanism leading to carcinogenesis and metastasis. LPA, lysophosphatidic acid.

Materials and methods

Clinical specimens

A total of 45 pairs of infiltrating carcinoma and adjacent non-cancerous tissue samples were collected between September 2013 and March 2016 from patients with CRC (29 men, 16 women; age range, 41–72 years; median age 59.1 years), who underwent surgical resection at The Second Affiliated Hospital of Harbin Medical University (Harbin, China). Detailed clinicopathological informations of the patients are mentioned in Table I. The samples were collected and immediately stored in liquid nitrogen until use. CEA and CA19-9 levels were measured using immunometric chemiluminecent UniCel™ DxI 800 Access immunoassay system (Beckman Coulter, Inc., Brea, CA, USA). None of the patients had undergone radiotherapy or chemotherapy prior to the surgery. Written informed consent was obtained from all patients and the protocol was approved by the Ethics Committee of The Second Affiliated Hospital of Harbin Medical University. All clinical investigation was conducted according to the principles expressed in the Declaration of Helsinki.

Table I.

Clinicopathological features of 45 patients.

Clinicopathological feature	Number of patients (%)	miR-30d level, log2 transformed, mean ± standard deviation	P-value
Age, years			0.81
≤66	23 (51.1)	2.11±1.83
>66	22 (49.9)	2.09±2.40
Sex			0.33
Female	16 (35.6)	1.69±1.83
Male	29 (64.4)	2.14±1.70
TNM stage			0.289
I	3 (6.6)	2.05±2.20
I	1 (2.2)	2.06±1.74
III	15 (33.3)	2.78±2.66
IV	26 (57.7)	1.72±2.09
Tumor size, cm2			0.05
≤15	28 (62.2)	1.491±0.203
>15	17 (37.7)	0.911±0.168
Differentiation			0.001
Poor	15 (33.3)	0.816±0.159
High	30 (66.6)	1.694±0.192

Cell lines and agents

Five human colon adenocarcinoma cell lines, HCT116 (CCL247), SW480 (CCL-228), SW620 (CCL-227), LOVO (CCL-229) and HT29 (HTB-38) were obtained from American Type Culture Collection (Manassas, VA, USA). The cells were cultured overnight, prior to transfection, in Dulbecco's modified Eagle's medium (DMEM) or L15 medium (each, Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) with 10% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.) and 1% streptomycin in a humidified environment at 5% CO2 and 37°C. 293 cells (Gibco; Thermo Fisher Scientific, Inc.) were grown in DMEM medium, supplemented with 10% FBS, 100 U/ml penicillin G and 100 µg/ml streptomycin (Gibco; Thermo Fisher Scientific, Inc.). All cells were maintained at 37°C in a humidified 5% CO2 atmosphere.

Vector construction and cell transfection

The Homo sapiens miR-30d RNA precursor (pre-miR-30d; 5′-GTTGTTGTAAACATCCCCGACTGGAAGCTGTAAGACACAGCTAAGCTTTCAGTCAGATGTTTGCTGCTAC-3′; cat. no. HmiR-SN0398), negative control (NC) miRNA precursor (pre-control; cat. no. CmiR-SN0001), miR-30d inhibitor (anti-miR-30d; cat. no. HmiR-AN0398) and anti-miRNA negative control (anti-control; cat. no. CmiR-AN0001) were purchased from GeneCopoeia, Inc. (Rockville, MD, USA). SiRNA for GNA13 (cat. no. MBS8207766) and siRNA negative control (cat. no. MBS8241404) were obtained from MyBioSource, Inc. (San Diego, CA, USA). GNA13 cDNA without its 3′-UTR (3,204 bp) was inserted into pcDNA3.1(+) (Invitrogen; Thermo Fisher Scientific, Inc.) to generate the recombinant vector pcDNA3.1(+)-GNA13. All the primer sequences utilized are presented in Table II. Cells were transfected with 100 nM anti-control, anti-miR-30d, pre-control or pre-miR-30d, and/or pCDNA3.1-GNA13. Lipofectamine 2000 transfection reagent (Invitrogen; Thermo Fisher Scientific, Inc.) was used to transfect cells. Following 48 h of transfection at 37°C, the remaining experiments were performed within 12 h.

Table II.

Oligonucleotide sequences for plasmid construction.

Name	Sequence (5′-3′)
pcDNA3.1(+)-GNA13	F: AGGAATTCACCTATGTGAAGCGGCTG
	R: CCCTCGAGGGAAACATTCCACCAGGA
GNA13-3′UTR-WT	F: TCGGACTAGTGAAAAGACCTATGTGAA
	R: CAACAAGCTTCAGCACCCTCATACCT
GNA13-3′UTR-MUT	F: TCGGACTAGTGAAAAGACCTATGTGAA
	R: GTGGAAGCTTACAGAAGATCATTTCCAGTGGAA

Stable transfection of miR-30d

A total of 2×105 SW480 cells were plated in a 60-mm plate to 60–70% confluence in DMEM and then transfected with 100 nM miR-30d mimic (5′-GCAGCAAACAUCUGACUGAAAG-3′) or negative control (5′-GGUUCGUACGUACACUGUUCA-3′) using the Xtreme GENE siRNA transfection reagent (catalog no. 04476093001; Roche Diagnostics, Mannheim, Germany) according to the manufacturer's protocol. The remaining experiments were performed within 12 h following transfection. Stable cell lines were selected with 1 mg/ml G418 (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) and reverse transcription-quantitative polymerase chain reaction (RT-qPCR) was performed to validate the positive clones.

RT-qPCR

Total RNA was isolated from HCT116 cells or frozen tissues using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. Then, 1 µg of RNA from each sample was reverse transcribed into cDNA using a TaqMan MicroRNA Reverse Transcription kit (Applied Biosystems; Thermo Fisher Scientific, Inc.) using random primers, and the cDNA was subjected to qPCR for GNA13. In addition, 1 µg RNA was transcribed into cDNA using a miR-30d-specific stem-loop primer, and qPCR with miR-30d-specific primers was performed using a TaqMan miRNA assay kit (Invitrogen; Thermo Fisher Scientific, Inc.). The SYBR Green PCR Master Mix kit (cat. no. 4309155; Applied Biosystems; Thermo Fisher Scientific, Inc.) was used and real-time PCR was performed with the 7500 FAST Real Time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.). The thermocycling conditions were as follows: 95°C for 10 min, followed by 40 cycles of denaturation at 95°C for 15 sec, annealing at 59°C for 1 min and a final elongation step at 72°C for 10 min. The annealing temperature for GNA13 and miR-30d was 59°C. All the reactions were performed in triplicate. For relative quantification, the crossing point (Cp) value of GNA13 or miR-30d was normalized to the Cp value of β-actin or U6 (catalog no. HmiRQP9001; GeneCopoeia, Inc.), respectively, as a control. All primer sequences are presented in Table III. The 2−ΔΔCq method was used for relative quantification (52) and each sample was examined in triplicate.

Table III.

Primer sequences for reverse transcription-quantitative polymerase chain reaction.

Name	Sequence (5′-3′)
miR-30d-5p-Loop	GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACCTTCCAG
U6 reverse transcription primer	CGCTTCACGAATTTGCGTGTCAT
Hsa-miR-30d	F: GGGTGTAAACATCCCCGACT
	R: CGTATCCAGTGCGTGTCGTG
snRNA U6	F: GCTTCGGCAGCACATATACTAAAAT
	R: CGCTTCACGAATTTGCGTGTCAT
pre-miR-30d	F: GTTGTTGTAAACATCCCCGAC
	R: GTAGCAGCAAACATCTGACTGAA
GNA13	F: TCTGCATGACAACCTCAAGC
	R: TTGAATTGTTTACAAATGTTTATTAAATGTC
β-actin	F: TCCCTGGAGAAGAGCTACGA
	R: AGCACTGTGTTGGCGTACAG
miR-30d Inhibitor	5′-GCAGCAAACAUCUGACUGAAAG-3′
miR-30d mimic	5′-CUUUCAGUCAGAUGUUUGCUGC-3′
miR-30d precursor	5′-GTTGTTGTAAACATCCCCGACTGGAAGCTGTAAGACACAGCTAAGCTTTCAGTCAGATGTTTGCTGCTAC-3′

Western blot analysis

CRC cells or tissues were collected and proteins were extracted in cell lysis buffer containing a protease inhibitor cocktail (Sigma-Aldrich; Merck KGaA). A Bicinchoninic acid Protein Assay kit was used to measure protein concentration. A total of 10 µg per lane of protein was separated using 10% SDS-PAGE and then transferred onto polyvinylidene difluoride membranes (EMD Millipore, Billerica, MA, USA). Membranes were then blocked using 5% non-fat milk (OriGene Technologies, Inc., Beijing, China) at room temperature for 2 h. Immunoblotting with anti-GNA13 (cat. no. ab128900; 1:1,000; Abcam, Cambridge, UK) and anti-β-actin (cat. no. SC-47778; 1:2,000; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) was performed as described previously (53). A Bio-Rad ChemiDocMP system was used for western blot imaging (Bio-Rad Laboratories, Inc., Hercules, CA, USA). ImagePro Plus 7.0 software (Media Cybernetics, Inc., Rockville, MD, USA) was used to quantify bands, and β-actin was used as the endogenous control.

Cell migration and invasion assay

A Transwell chamber assay was performed to determine the migration ability of cells in vitro. A 24-well Transwell unit (2×105 cells/well) with 8-µm-pore polycarbonate nucleopore filters was used. Cells were placed in the upper chamber containing serum-free medium, while the lower compartment contained medium with 10% FBS and the cells were incubated at 37°C in a 5% CO2 humidified atmosphere for 48 h. The cells adhering to the lower surface were fixed with 100% methanol at room temperature for 10 min. Following staining with 0.1% crystal violet for 15 min at room temperature, the number of cells were counted using a light microscope (magnification, ×200). The cells from at least five representative fields were analyzed. For the invasion assay, a reconstructed basement membrane was formed by coating the membrane of the Transwell unit with 40 µl of Matrigel (BD Biosciences, San Jose, CA, USA) at 37°C for 4 h. The cells were treated in the same way as for the migration assay. Cell migration ability was also determined by a wound-healing assay. Cells were cultured to a density of 70–80% in 3.5 cm plates. Then, an artificial wound was constructed by scratching the plates with 200 µl pipette tips. The migrating distance was measured after 48 h. To eliminate the potential of confounding factors, the cell proliferation inhibitor, mitomycin C (20 µM; Sigma-Aldrich; Merck KGaA) was applied to cells.

Cell proliferation and colony formation assay

Cell viability was determined by MTT assay as described previously (54). To determine colony formation ability, HCT116 or SW480 cells were seeded in 3.5-cm plates (1,000 cells/dish), and incubated at 37°C for 2 weeks. The colonies were fixed with 20% methanol at the room temperature for 10 min, stained with 0.1% crystal violet (Sigma-Aldrich; Merck KGaA) for 5 min at room temperature and counted after 2 weeks.

Luciferase reporter assay

In order to construct the pMIR-GNA13-3′UTR plasmid containing the potential binding sites of the GNA13 3′-UTR, downstream of the firefly luciferase gene, a 275 bp sequence was inserted into the SpeI and HindIII sites of the pMIR-REPORT luciferase vector (Ambion; Thermo Fisher Scientific, Inc.) following amplification. A plasmid containing the GNA13 3′-UTR with the miR-30d target site deleted was also constructed. Luciferase activity was measured using SW480 cells. The cells were co-transfected with 100 ng luciferase plasmid and 50 ng Renilla plasmid (Ambion; Thermo Fisher Scientific, Inc.) using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) along with 650 ng miR-30d mimic or NC, when they grew to 60–70% confluence, according to the aforementioned method. The Dual Luciferase Reporter 1000 Assay system (Promega Corporation, Madison, WI, USA) was used to detect luciferase activity following incubation for 48 h at 37°C. Transfection efficiency was assessed using renilla luciferase activity and was normalized to firefly activity.

In vivo tumor growth assays

A total of 8 athymic BALB/c (nu/nu) female mice (aged 4 weeks; weight, 14–17 g) were purchased from Shanghai Laboratory Animal Center (Shanghai, China). The animals were housed (temperature, 20–23°C; humidity, 55±5%; 12 h light/dark cycle) as described previously (53). For tumor growth assays, miR-30d stably transfected SW480 cells (5×106) were injected subcutaneously into the right flank of nude mice. A total of two groups were formed, with 4 mice in each. A caliper was used to measure tumor size every 5 days. Both length (L) and width (W) of the tumor were measured and the tumor size was calculated as ½(LW2). The mice were sacrificed at day 30 and photographed. Tumors were harvested and weighed. Sodium pentobarbital anesthesia (Fujian Mindong Rejuvenation Pharmaceutical Co., Ltd., Fujian, China) was used during all surgical procedures (45 mg/kg, intraperitoneal) and all efforts were made to minimize suffering. All animal procedures were conducted according to the guidelines of Harbin Medical University Institutional Animal Care and Use Committee, and the committee approved the study.

Statistical analysis and online miRNA binding prediction tools

The software package SPSS version 20.0 (IBM Corp., Armonk, NY, USA) was used for statistical analysis. Data are presented as the mean ± standard error of the mean. Experiments were generally performed in triplicate and at least three biological replicates were performed. Correlation analysis for miR-30d, CEA and CA19-9 were performed using Spearman's correlation coefficient. The TargetScan prediction tool (www.targetscan.org) was used to predict miRNA binding to the GNA13 3′-UTR, and the results were validated using miRANDA (http://www.microrna.org/microrna/home.do/), PicTar (http://pictar.mdc-berlin.de/) and miRwalk (http://www.mirwalk.umm.uni-heidelberg.de). To compare the data between tumor-adjacent tissues and tumor tissues, a paired Student's t-test was used, and to compare inter-group differences for lymph node metastasis and clinical stages, an unpaired Student's t-test was conducted. Measurement data from multiple groups was analyzed using one-way analysis of variance followed by a Tukey's multiple comparison post-hoc test. P<0.05 was considered to indicate a statistically significant difference.

Results

Lower expression of miR-30d is detected in colon cancer tissues

To determine the expression of miR-30d in clinical tissues, an RT-qPCR assay was performed. A marked downregulation of miR-30d expression was observed in 41 out of 45 tumor samples compared with the adjacent normal mucosal tissues (Fig. 2). The association between miR-30d and clincopathological features was analyzed (Tables I and IV). The results presented in Table I demonstrated that there were no significant differences in age, sex and TNM staging between patients. Furthermore, 62.2% of patients with tumors sizes <15 cm2 exhibited a poor prognosis. It is well known that tumor markers, CEA and CA199, are positively correlated with the occurrence and development of colorectal cancer (55,56). The results in Table IV indicate a negative correlation between miR-30d, CEA and CA-199, which suggests that miR-30d serves an inhibitory role in cancer progression. However, the regulatory mechanisms among miRNAs, CEA and CA199 requires further study. These results indicate that miR-30d is considerably decreased in colon cancer, and it may be correlated with human colon cancer progression.

Figure 2.

Lower expression of miR-30d in colorectal cancer tissues. miR-30d expression was determined by reverse transcription-quantitative polymerase chain reaction in 45 pairs of human colon cancer tissues. Among the 45 tumor samples, decreased expression of miR-30d was detected in 41 samples, as compared with the non-cancerous adjacent mucosal tissues. In each sample, miR-30d expression was normalized to that of U6. miR, microRNA.

Table IV.

Correlation between miR-30d and CEA and CA19-9.

Antigen	R	P-value
CEA	−0.20	0.24
CA19-9	−0.76	0.30

Correlation was determined by Spearman's correlation coefficient.

miR-30d inhibits cell growth ability in vitro

The relative expression level of miR-30d in different colon cancer cell lines was detected by RT-qPCR and HCT116 was used as the control group. Among the five lines used, SW480 exhibited a relatively low miR-30d expression level, as indicated in Fig. 3A. Hence, miR-30d expression was validated by RT-qPCR following transient transfection of miR-30d mimics and miR-30d inhibitor into SW480 and HCT116 cells, respectively (Fig. 3B). These cells were subsequently subjected to MTT assays. As expected, it was identified that miR-30d inhibitor promoted proliferation, while miR-30d mimic suppressed the proliferation of cells (Fig. 3C and D). Furthermore, a colony formation assay was performed. Colony formation of colon cancer cells was suppressed by miR-30d overexpression and increased by miR-30d inhibition, as indicated in Fig. 3E and F.

Figure 3.

miR-30d inhibits cell growth ability in vitro. (A) RT-qPCR was performed to determine the relative expression levels of miR-30d in five colon cancer cell lines. (B) miR-30d mimic or NC mimic and inhibitor or NC inhibitor were used to transiently transfect SW480 and HCT116 cells, respectively. RT-qPCR was performed to determine the expression of miR-30d after 24 h. (C and D) An MTT assay was performed to examine the effects of miR-30d on proliferation. (C) *P<0.05 vs. mimic; (D) *P<0.05 vs. inhibitor. (E) A colony formation assay was performed to determine the effects of miR-30d on proliferation. (F) The number of clones was analyzed quantitatively. *P<0.05, **P<0.01. Data are presented as the mean ± standard error of the mean. RT-qPCR, reverse transcription-quantitative polymerase chain reaction; miR, microRNA; NC, negative control.

Increased expression of miR-30d inhibits cell migration and invasion abilities of colon cancer cells

SW480 and HCT116 cell lines were used to investigate the biological functions of miR-30d in CRC with gain-of-function and loss-of-function studies. Transwell migration and invasion and wound healing assays were performed to understand the effects of miR-30d on cell migration and invasion. Transwell invasion assays revealed that miR-30d overexpression could significantly suppress the migratory and invasive abilities of CRC cell lines (Fig. 4A-D). Inhibition of miR-30d promoted the migratory and invasive abilities of colon cancer cells (Fig. 4A-D). Furthermore, a wound-healing assay was performed to study the effect of miR-30d on the migratory abilities of SW480 cells (Fig. 4E and F). The results indicated that miR-30d overexpression could inhibit migration of colon cancer cells, while inhibition of miR-30d could promote migration. In summary, these data indicated an important role for miR-30d in cell migration and invasion.

Figure 4.

Increased expression of miR-30d inhibited cell migration and invasion abilities of colon cancer cells. (A and B) Transwell migration assay to determine the effects of miR-30d on migration. (A) Representative images (magnification, ×200); (B) quantitative analysis. (C and D) Transwell invasion assay to determine the effects of miR-30d on invasion. (C) Representative images (magnification, ×200); (D) quantitative analysis. (E and F) A wound-healing assay evaluated the effects of miR-30d on migration. A scratch was made through the central axis was when cells reached ~80% confluence. Images were obtained at 0 and 24 h. (E) Representative images; (F) quantitative analysis. *P<0.05; **P<0.01. miR, microRNA; NC, negative control.

miR-30d directly targets GNA13 3′-UTR

The potential targets of miR-30d were searched for using bioinformatics strategies. To further evaluate the possible molecular mechanism of miR-30d-mediated growth and metastasis inhibition, four bioinformatics databases, miRBase, TargetScan, PicTar and miRanda, were used and then miR Ontology Database was applied. Consequently, GNA13 was indicated as a target of miR-30d and a cancer-associated gene. GNA13-3′-UTR possessed a perfect complementary matching region at 4248–4254 nt for miR-30d. The length of the human GNA13 ENST00000439174.2 3′UTR was 4968 nt according to TargetScan. Furthermore, computational prediction by TargetScan revealed that the sites of miR-30d are evolutionarily conserved in a variety of vertebral species (Fig. 5A and B). Furthermore, following transfection with miR-30d mimic, RT-qPCR and western blotting demonstrated that GNA13 was consistently downregulated in SW480 cells (Fig. 5C and D). In addition, RT-qPCR determined the expression levels of miR-30d and GNA13 in several colon cancer cell lines and an inverse correlation between the expression level of miR-30d and that of GNA13 was established (Fig. 5E). These results strongly indicated that GNA13 was targeted by miR-30d both transcriptionally and post-transcriptionally. A luciferase reporter assay was performed to gain insight into the direct targeting of GNA13 by miR-30d. Transient co-transfection of SW480 cells with miR-30d mimics and the pmiRGLOwild type (wt) 3′-UTR vector (containing the miR-30d target site) led to a marked reduction in reporter activity compared with the control (Fig. 5F).

Figure 5.

miR-30d directly targets GNA13 3′-UTR. (A and B) Predicted targeting sites of miR-30d within 3′-UTR regions of GNA13. miR-30d targeting sequences are evolutionarily conserved in the 3′-UTR regions of GNA13 in 16 species. The targeting sites are highlighted in red. (C and D) Following the transfection of miR-30d mimic or NC mimic in SW480 cells, mRNA and protein expression of GNA13 was determined by (C) western blot analysis and (D) RT-qPCR *P<0.05 vs. the NC mimic (E) Five colon cancer cell lines were used to determine the expression levels of GNA13 mRNA and miR-30d using RT-qPCR. The trend of opposite expression was identified between expression levels of GNA13 mRNA and miR-30d in colon cancer tissues. β-actin and U6 were used as the endogenous controls, respectively. *P<0.05 vs. HCT116. (F) WT or MUT reporters and the miR-30d mimic or NC mimic were used to co-transfect 293T cells. Luciferase/Renilla activity was measured after 48 h. *P<0.05 vs. the WT NC mimic. miR, microRNA; NC, negative control; UTR, untranslated region; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; WT, wild-type; MUT, mutant.

Tumor-suppressive effects of miR-30d via GNA13 expression inhibition

The aforementioned findings suggested that GNA13 attributed to the anti-cancerous effects of miR-30d, namely inhibition of proliferation, migration and invasion of colon cancer cells. To investigate this further, a vector lacking 3′-UTR of GNA13 was engineered, followed by transient co-transfection of the vector and miR-30d mimic/NC mimic into SW480 cells. The expression of miR-30d and GNA13 were examined by RT-qPCR and western blotting, respectively (Fig. 6A and B). Restoration of GNA13 markedly reduced miR-30d-induced inhibition of proliferation, migration and invasion in colon cancer cells, as demonstrated by Transwell migration and invasion assays (Fig. 6C-E). Transwell assays also demonstrated that knocking down of GNA13 by siRNA could suppress migration, invasion and proliferation of colon cancer cells, which was similar to the effect of miR-30d overexpression (Fig. 6F-H). Therefore, miR-30d and GNA13 may be involved in the regulation of EMT. In summary, these findings suggest that miR-30d functionally targets GNA13 in order to partially inhibit the tumorous effects of GNA13.

Figure 6.

Tumor suppressive effects of miR-30d via GNA13 expression inhibition. (A and B) Expression of (A) miR-30d expression and (B) GNA13 was evaluated by RT-qPCR and western blot analysis, respectively, in SW480 cells co-transfected with miR-30d mimic (or NC mimic) and GNA13 [or pcDNA3.1(+)]. *P<0.05 GNA13 vs. pcDNA3. (C-E) Transwell migration and invasion assays. (C) Representative images (magnification, ×200) of Transwell assays; (D and E) quantitative analysis of migration and invasion. *P<0.05, **P<0.01. (F) SW480 cells were transfected with siGNA13 or siNC. GNA13 expression was determined by western blotting after 48 h. (G and H) Following transfection with siRNA or siNC, Transwell migration and invasion assays were performed. (G) Representative images (magnification, ×200) of Transwell assays; (H) quantitative analysis of migration and invasion. *P<0.05, **P<0.01 vs. siNC. miR, microRNA; NC, negative control; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; siRNA or si, small interfering RNA.

Anti-tumorous and anti-metastatic roles of miR-30d in vivo

Following observation of the anti-tumorous effect of miR-30d in in vitro experiments, a nude mouse xenograft model was used to analyze the role of miR-30d in the human colon cancer cells in vivo. Since the SW480 line exhibited the lowest miR-30d expression, it was used for the construction of stably overexpressing miR-30d cells, and the #4 clone was selected for this experiment (Fig. 7A). The cells were injected subcutaneously into the flank of nude mice, and tumor sizes were monitored every 5 days. Mice were sacrificed and subcutaneous tumors were harvested and weighed after 4 weeks. As expected, the results revealed that miR-30d caused a marked reduction in tumor diameter and weight (Fig. 7B-D) and a decreased expression of miR-30d was determined in tumors (Fig. 7D), as compared with the mock group, demonstrating that miR-30d decreased the growth rate of tumors in vivo (Fig. 7E). This provided supporting evidence for the anti-tumor effect of miR-30d in vivo.

Figure 7.

Anti-tumorous and anti-metastatic roles of miR-30d in vivo. (A) RT-qPCR identified stable overexpression of miR-30d in HCT116 cell clones. Subsequently, 5×106 HCT116 cells that were stably transfected with miR-30d or empty vector (mock) were injected subcutaneously into nude mice (n=4). After 30 days of injection, mice were sacrificed, tumors were harvested, and weight and diameters of tumors were measured. (B) Representative tumors. (C) Tumor weight was measured. (D) Expression of miR-30d in tumors. (E) The tumor volume was continuously measured and characterized. *P<0.05 vs. mock.

Discussion

miRNAs regulate a wide range of biological processes and have been identified as important mediators of translational control (57). However, the detailed mechanisms of their involvement in cancers remain largely unknown. miR-30d has been identified to be downregulated in multiple cancer types, including ovarian cancer (24) and hepatocellular carcinoma (19). By contrast, miR-30d was demonstrated to be an oncomir in melanoma (18), and to promote angiogenesis and tumor growth in prostate cancer (25), renal carcinoma (15), medulloblastoma and malignant peripheral nerve sheath tumors (23,26). A recent study demonstrated that sorting nexin 10 is a potential liver cancer marker that exhibits the characteristics of a putative suppressor protein, and is likely to be regulated by miRNA-30d in rats (27). In cervical squamous cell carcinoma, amplification and upregulation of miR-30d has been associated with disease progression (28). Furthermore, lower expression of miR-30d has been implicated in esophageal carcinogenesis and progression (29). miR-30d has also been associated with clinicopathological features of breast cancer patients with type 2 diabetes mellitus (30). In addition, in patients with prostate cancer (PCa), miR-30d is inversely correlated with androgen receptor activity, and has been identified as a novel prognostic maker and a sensitive biochemical marker to predict the recurrence of PCa (31,32). In non-small cell lung cancer, miRNA-30d-5p inhibits tumor cell proliferation and motility by directly targeting CCNE2 (33). Thus, miR-30d is involved in tumor progression, chemotherapeutic efficacy and predicted prognosis. Notably, there have been contradictory findings regarding the function of miR-30d. This indicates a complex role of miR-30d in tumorigenesis and progression, which requires further elucidation.

In the current study, it was identified that miR-30d is involved in suppressing cell proliferation, migration and invasion. Hence, it may inversely regulate colon cancer progression. Furthermore, decreased levels of miR-30d were observed in both clinical samples and cell lines, with increased levels of GNA13. Four different bioinformatics programs were used to identify the potential targets of miR-30d. As it was closely associated with the tumorous process, GNA13 was identified as a target of miR-30d at the primary screening. Following simultaneous enforced expression, a non-synergetic effect was detected among all members of miR-30 family sharing the same seed sequence, and no additional effects were generated (data not shown). Based on previous studies, it was indicated that miR-30d functioned as an oncogene (18,19,22,58) and therefore the current study focused on miR-30d in CRC.

Luciferase assays and in vitro experiments were performed to identify GNA13 as a direct functional target of miR-30d. There was a marked inhibition effect of miR-30d on GNA13, as indicated by RT-qPCR and luciferase assays. It was identified that miR-30d is commonly downregulated in CRC and could promote CRC cell migration, invasion and metastasis both in vitro and in vivo. Furthermore, it was identified GNA13 is a direct and functional target of miR-30d. In addition, it was identified that miR-30d induced a 20% reduction of GNA13 expression; however, the migration and invasion rate increased by >20%. This indicated that other gene targets may be involved in changes induced by miR-30d.

In conclusion, the current study has demonstrated for the first time that increased levels of GNA13 could promote the invasiveness of colon cancer cells, and overexpression of miR-30d could inhibit cancer cell proliferation, migration and invasion by directly targeting GNA13. The newly identified miR-30d/GNA13 axis sheds new light on the miRNA-based regulatory mechanism, suggesting that miR-30d is a potential tumor suppressor miRNA. This indicated that miR-30d may serve as a chemical biomarker, and manipulation of miR-30d may represent a novel therapeutic strategy for treating CRC.