CRISPR/Cas9 system is a promising approach for gene editing in gene therapy. Effective gene editing requires safe and efficient delivery of CRISPR/Cas9 system in target cells. Several new multifunctional pH-sensitive amino lipids were designed and synthesized with modification of the amino head groups for intracellular delivery of CRISPR/Cas9 system. These multifunctional pH-sensitive amino lipids exhibited structurally dependent formulation of stable nanoparticles with the DNA plasmids of CRISPR/Cas9 system with the sizes ranging from 100 to 200 nm. The amino lipid plasmid DNA nanoparticles showed pH-sensitive hemolysis with minimal hemolytic activity at pH 7.4 and increased hemolysis at acidic pH (pH = 5.5, 6.5). The nanoparticles exhibited low cytotoxicity at an N/P ratio of 10. Expression of both Cas9 and sgRNA of the CRISPR/Cas9 system was in the range from 4.4% to 33%, dependent on the lipid structure in NIH3T3-GFP cells. The amino lipids that formed stable nanoparticles with high expression of both Cas9 and sgRNA mediated high gene editing efficiency. ECO and iECO mediated more efficient gene editing than other tested lipids. ECO mediated up to 50% GFP suppression based on observations with confocal microscopy and nearly 80% reduction of GFP mRNA based on RT-PCR measurement in NIH3T3-GFP cells. The multifunctional pH-sensitive amino lipids have the potential for efficient intracellular delivery of CRISPR/Cas9 for effective gene editing.
CRISPR/Cas9 system is a promising approach for gene editing in gene therapy. Effective gene editing requires safe and efficient delivery of CRISPR/Cas9 system in target cells. Several new multifunctional pH-sensitive amino lipids were designed and synthesized with modification of the amino head groupn>s for intracellular delivery of CRISPR/Cas9 system. These multifunctional pH-sensitive n>an class="Chemical">amino lipids exhibited structurally dependent formulation of stable nanoparticles with the DNA plasmids of CRISPR/Cas9 system with the sizes ranging from 100 to 200 nm. The amino lipid plasmid DNA nanoparticles showed pH-sensitive hemolysis with minimal hemolytic activity at pH 7.4 and increased hemolysis at acidic pH (pH = 5.5, 6.5). The nanoparticles exhibited low cytotoxicity at an N/P ratio of 10. Expression of both Cas9 and sgRNA of the CRISPR/Cas9 system was in the range from 4.4% to 33%, dependent on the lipid structure in NIH3T3-GFP cells. The amino lipids that formed stable nanoparticles with high expression of both Cas9 and sgRNA mediated high gene editing efficiency. ECO and iECO mediated more efficient gene editing than other tested lipids. ECO mediated up to 50% GFP suppression based on observations with confocal microscopy and nearly 80% reduction of GFP mRNA based on RT-PCR measurement in NIH3T3-GFP cells. The multifunctional pH-sensitive amino lipids have the potential for efficient intracellular delivery of CRISPR/Cas9 for effective gene editing.
CRISPR (clustered regulatory interspaced
short palindromic repeats)/Cas9
(CRISPR associated protein 9) system has the potential to become a
revolutionary and powerful gene editing method, and presents a promising
approach for gene therapy.[1−5] CRISPR/Cas9 system acts as an adaptive immune system in bacteria
and archaea. It relies on integration of foreign DNA fragments into
CRISPR loci and subsequent transcription and processing of these RNA
transcripts into short CRISPR RNAs (crRNAs), which in turn anneal
to a trans-activating crRNA (tracrRNA) and direct sequence-specific
silencing of foreign nucleic acids by Cas proteins.[6] Recent studies have shown that a synthetic single guide
RNA (sgRNA) consisting of a fusion of crRNA and tracrRNA can direct
Cas9 endonuclease-mediated cleavage of target DNA, which enables sequence-specific
DNA editing. Cas9 nuclease is guided by programmable sgRNA, recognizes
the genomic sequence with a 3′ protospacer adjacent motif (PAM)
sequence, and cleaves the recognized DNA. Following DNA cleavage,
double-strand break repair mechanisms allow mutagenesis or insertion/deletion
(INDEL) mutations.[7,8]CRISPR/Cas9 has the potential
to treat autosomal dominant diseases,
such as Huntington's disease and retinitis pigmentosa, which
are caused
by mutations in one of a pair of autosomal chromosomes. CRISPR/Cas9
can facilitate allele specific genome editing by selectively targeting
and permanently inactivating the mutant allele while leaving the normal
allele functionally intact.[9,10] The effectiveness of
CRISPR/Cas9 for allele specific editing and disease phenotype alleviation
has been demonstrated in animal models.[3,9−11] For therapeutic applications, both Cas9 nuclease and sgRNA can be
incorporated in DNA plasmids and expressed in the same cell for gene
editing after intracellular delivery. Therefore, codelivery of Cas9
and sgRNA is a critical step for therapeutic applications of CRISPR/Cas9
systems in treating autosomal dominant diseases.Various delivery
strategies of nucleic acid based therapeutics,
including both viral and nonviral approaches, have been tested for
the delivery of CRISPR/Cas9 system.[2,12−14] Although successful gene editing has been induced by both viral
and nonviral delivery systems, the available delivery systems suffer
from various limitations, e.g., immunogenicity and random genome integration
for viral systems[15] and low transcription
efficiency for nonviral systems.[16−18] We have previously reported
a class of multifunctional pH-sensitive amino lipids, including (1-aminoethyl)iminobis[N-(oleoylcysteinyl-1-aminoethyl)propn>ionamide] (ECO), as
simpn>le and smart carriers for cytosolic delivery of plasmid DNA and
siRNA for gene repn>lacement therapn>ies and gene regulation.[19−22] The multifunctional n>an class="Chemical">amino lipids have a protonatable amino headgroup,
two cysteinyl residues, and two distant lipid tails. They can form
stable self-assembly nanoparticles with nucleic acids by electrostatic
complexation with the headgroup, hydrophobic condensation of the lipid
tails and disulfide bond cross-linking of the cysteinyl residues without
any helper lipids. The multifunctional lipids mediate highly efficient
cytosolic delivery of therapeutic DNA and siRNA through pH-sensitive
amphiphilic endosomal escape and reductive cytosolic release (PERC).[23]
In this work, a series of new multifunctional
pH-sensitive amino
lipids were designed and synthesized based on the PERC apn>proach for
intracellular delivery of CRISPR/Cas9 system. In these n>an class="Chemical">lipid structures,
a new headgroup 2,2′,2″-triaminotriethylamine was used
to replace the moiety of 3,3′-[(2-aminoethyl)imino]bis[N-(2-aminoethyl)propanamide] in the previous design. Lysine
and histidine were also introduced to assess the effects of the side
chains with amino groups of different pKas. These new isotypic ECO lipids were synthesized and characterized
for cytosolic delivery of CRISPR/Cas9 and gene editing. The intracellular
transfection efficiency and gene knockdown efficacy of the lipids
were assessed with a CRISPR/Cas9 system targeting GFP sequence.
Results
Synthesis
of Multifunctional pH-Sensitive Amino Lipids
The structures
and abbreviated names of the newly designed multifunctional
pH-sensitive lipids are shown in Figure A. 2,2′,2″-Triaminotriethylamine
was used to design the protonatable ethylene diamine headgroupn> with
Y-shapn>ed branches for conjugating cysteinyl residues with different
combination of histidinyl or lysinyl functional residues, and two
oleoyl tails. The designed n>an class="Chemical">amino lipids were synthesized following
liquid phase protocols, which are shown in Figure B. The final products were purified by flash
chromatography and characterized by MALDI-TOF mass spectrometry and 1H NMR spectroscopy.
Figure 1
Design and synthesis of isotypic ECO derivatives
with modifications
of the headgroup and new amino acid functional linkers. (A) Chemical
structures of ECO isotypic derivatives. (B) Synthetic scheme of ECO
isotypic derivatives.
Design and synthesis of isotypic ECO derivatives
with modifications
of the headgroup and new amino acid functional linkers. (A) Chemical
structures of ECO isotypic derivatives. (B) Synthetic scheme of ECO
isotypic derivatives.
Formulation of Lipid CRISPR/Cas9 Plasmid Nanoparticles
The
amino lipids were used to formulate nanopn>articles with a plasmid
DNA expn>ressing sgRNAs (psgRNA) (9.4 kb) and a plasmid DNA expn>ressing
Cas9 (pCas9) (13.6 kb), respn>ectively, through self-assembly for gene
editing (Figure ).
The nanopn>articles were formulated by simpn>ly mixing the stock solutions
of the n>an class="Chemical">lipids and plasmid DNA stock solutions at N/P ratios of 6,
8, and 10. The nanoparticles were characterized by dynamic light scattering
(DLS) (Figure ). All
amino lipids, including ECO, formed nanoparticles with both plasmids,
which had a narrow size distribution between 100 and 150 nm at the
tested N/P ratios, except for iEKCO, iECKO, iEHCO, and iECHO at the
N/P of 6. The lipids iEKCO, iECKO, iEHCO, and iECHO appeared unable
to form stable nanoparticles with both psgRNA and pCas9 at the N/P
ratio of 6. Large nanoparticles or aggregations were detected for
the lipids at the low N/P ratio. iEHCO and iECHO could form stable
nanoparticles at N/P = 8 and 10 with good particle counts. Among these
lipids, ECO and iECO were able to formulate stable nanoparticles with
size distributions in the range of 100–200 nm and high nanoparticle
counts within the range of 200–350 kilocounts at all N/P ratios.
Figure 2
Plasmid
maps of CRISPR/Cas9 system that targets GFP gene. The system
includes a plasmid expressing two sgRNAs targeting GFP sequence and
mCherry reporter, and a plasmid expressing Cas9 nuclease and BFP reporter.
Figure 3
DLS measurements of the nanoparticles formed
by the multifunctional
pH-sensitive lipids with psgRNA and pCas9. The size distribution of
nanoparticles formulated between (A) ECO, (D) iECO, (G) iEKCO, (J)
iECKO, (M) iEHCO, (P) iECHO, and psgRNA or pCas9. The average sizes
and particle counts of nanoparticles formulated with (B,C) ECO, (E,F)
iECO, (H,I) iEKCO, (K,L) iECKO, (H,O) iEHCO, (Q,R) iECHO, and the
plasmids. N/A = no reliable readouts due to formation of unstable
and varied nanoparticles.
Plasmid
maps of CRISPR/Cas9 system that targets GFP gene. The system
includes a plasmid expressing two sgRNAs targeting GFP sequence and
mCherry reporter, and a plasmid expressing Cas9 nuclease and BFP reporter.DLS measurements of the nanoparticles formed
by the multifunctional
pH-sensitive pan class="Chemical">lipids with psgRNA and pCas9. The size distribution of
nanopn>articles formulated between (A) ECO, (D) iECO, (G) iEKCO, (J)
iECKO, (M) iEHCO, (P) iECHO, and psgRNA or pCas9. The average sizes
and particle counts of nanopn>articles formulated with (B,C) ECO, (E,F)
iECO, (H,I) iEKCO, (K,L) iECKO, (H,O) iEHCO, (Q,R) iECHO, and the
plasmids. N/A = no reliable readouts due to formation of unstable
and varied nanopn>articles.
The zeta potential of the nanoparticles varied with the N/P
ratios,
as shown in Figure . In general, an increase in zeta potential was observed with the
increase of N/P ratios for all carriers. At N/P ratio of 6, the nanoparticles
formed with both pCas9 and psgRNA have either negative zeta potentials
or slightly positive zeta potentials except for iECO, which was able
to form nanoparticles with psgRNA that had a zeta potential larger
than +30 mV (45.9 ± 1.5 mV) at this N/P ratio. At N/P ratio of
8, ECO and iECO formed nanoparticles with both pCas9 and psgRNA with
zeta potentials higher than +30 mV. Other nanoparticles formed by
iEKCO, iECKO, iEHCO, and iECHO had zeta potentials in the range of
0–15 mV except for iECHO/sgRNA nanoparticles. At N/P ratio
of 10, ECO, iECO, iECKO, and iEHCO were able to form nanoparticles
with both plasmids demonstrating zeta potentials over +30 mV. However,
iEKCO still formed nanoparticles with slightly positive zeta potentials
(<+10 mV) for both plasmids. iECHO/psgRNA nanoparticles had a zeta
potential of 39.7 ± 1.7 mV, while iECHO/pCas9 nanoparticles had
a zeta potential of 14.7 ± 0.8 mV.
Figure 4
DLS zeta potential measurements
of the nanoparticles formed by
the multifunctional pH-sensitive lipids with psgRNA and pCas9 at N/P
ratios of 6, 8, and 10.
DLS zeta potential measurements
of the nanoparticles formed by
the multifunctional pH-sensitive pan class="Chemical">lipids with psgRNA and pCas9 at N/P
ratios of 6, 8, and 10.
The encapsulation and stability of the nanoparticles were
further
evaluated with agarose gel electrophoresis (Figure ). At N/P ratio of 6, good encapsulation
and stability were observed for ECO, iECO, and iEHCO with both DNA
plasmids. For iEKCO, iECKO and iECHO, low encapsulation and stability
were shown by faint and unclear bands. At N/P ratio of 8 and 10, ECO,
iECO, and iEHCO, and iECHO were able to encapsulate plasmids of CRISPR/Cas9
system and the nanoparticles showed good stability, indicated by the
bright bands at the top. iECKO and iEKCO did not show efficient encapsulation
at all tested N/P ratios, where faint bands were also observed.
Figure 5
Agarose gel
electrophoresis showing the encapsulation and stability
of the nanoparticles formed by the multifunctional pH-sensitive lipids
with psgRNA and pCas9 at N/P ratios of 6, 8, and 10.
Agarose gel
electrophoresis showing the encapsulation and stability
of the nanoparticles formed by the multifunctional pH-sensitive pan class="Chemical">lipids
with psgRNA and pCas9 at N/P ratios of 6, 8, and 10.
pH-Dependent Hemolytic Activities
Membrane disruptive
capabilities of the nanoparticles formulated by pan class="Chemical">amino lipids and plasmid
DNA were evaluated using n>an class="Disease">hemolysis assay. Figure shows that nanoparticles of all new carriers
exhibited pH-sensitive hemolytic activity at N/P ratio of 10. At pH
= 7.4, all of the amino lipid carriers have the same minimal hemolytic
activities that were less than 10%. At pH = 6.5, increase in hemolytic
activity was observed for all the carriers, and even more so at pH
= 5.5, the late endosomal pH. However, ECO and iECO exhibited a greater
increase in hemolytic activity than the other carriers at this pH.
Figure 6
pH-dependent
hemolytic activities of all carriers at N/P ratio
of 10. Rat blood cells were diluted 1:50 in PBS and incubated with
each formulation at pH = 7.4, 6.5, and 5.4 for 2 h at 37 °C.
Triton X-100 (1% v/v) was implemented as a positive control. Blank
was rat blood cells incubated with PBS solutions. Data were subtracted
by the average of blank readouts and normalized to positive control.
pH-dependent
hemolytic activities of all carriers at N/P ratio
of 10. Rat blood cells were diluted 1:50 in PBS and incubated with
each formulation at pH = 7.4, 6.5, and 5.4 for 2 h at 37 °C.
Triton X-100 (1% v/v) was implemented as a positive control. Blank
was rat blood cells incubated with PBS solutions. Data were subtracted
by the average of blank readouts and normalized to positive control.
Gene Editing Efficiency
with CRISPR/Cas9 Mediated by ECO
The gene editing efficiency
of ECO was first evaluated with the GFP
targeting CRISPR/Cas9 system, since ECO was well characterized in
plasmid DNA delivery in our previous work.[21,22] NIH3T3-GFP cells were transfected with ECO/psgRNA and ECO/pCas9
nanoparticles at a particle ratio of 1:1, with doses of 1, 1.5, 2.0,
and 2.5 μg/well for each plasmid for 8 h. As the dose increased,
higher expression levels of Cas9 (Blue) and sgRNA (Red) were observed
under confocal microscope 72 h after transfection (Figure A). Consequently, substantial
reduction of green fluorescence intensity was observed in the confocal
images of the treated cells. The silencing efficiency of the ECO/CRISPR/Cas9
system was quantitatively determined using flow cytometry. The silencing
efficiency increased with the dose of the system and plateaued at
the dose over 2 μg-DNA/well. Approximately 50% reduction of
GFP fluorescence intensity were observed with the doses of 2.0 and
2.5 μg/well (Figure B), while Lipofectamine 2000 resulted in a 28.6% reduction
of GFP fluorescence intensity at 2 μg/well. The GFP knockdown
effect was also confirmed by qRT-PCR tests (Figure C). At the dose of 2 μg/well, about
78% reduction in GFP mRNA expression was observed at 24 and 48 h after
CRISPR/Cas9 treatments. The expression of sgRNA determined based on
mCherry reporter gene increased from 39% to 53% with dose increase
from 1 to 2.0 μg/well (Figure D), while much lower sgRNA expression was observed
for Lipofectamine 2000. The expression of Cas9 was also verified with
Western blot at 2 μg/well (Figure E). A clear Cas9 band was observed from the
blot compared with nontreated control and nonspecific control at 72
h. The results suggested that ECO can effectively deliver both Cas9
and sgRNA and mediate efficient GFP knockdown with the CRISPR/Cas9
system.
Figure 7
ECO mediated GFP silence with the CRISPR/Cas9 system. (A) In vitro transfection of ECO/psgRNA and ECO/pCas9 (particle
ratio 1:1) in NIH3T3-GFP cells, with the dose of each plasmid at 1,
1.5, 2, and 2.5 μg/well in the transfection media. Cas9 expression
(blue), gRNA expression (red), and GFP knockdown (green) were imaged
by confocal microscopy. (B) Quantitative flow cytometry measurements
of GFP knockdown efficiency represented the percentage of GFP fluorescent
intensity normalized to nontreated control. (C) GFP knockdown efficiency
in mRNA levels measured by qRT-PCR. Cells were treated with ECO/CRISPR/Cas9
nanoparticles at a dose of 2 μg/well and mRNA levels were evaluated
at 24 and 48 h. (D) Quantitative flow cytometry measurements of sgRNA
expression represented by percentage of cells with mCherry expression.
(E) Western blot showing Cas9 protein expression 72 h after CRISPR/Cas9
treatments by ECO at a dose of 2 μg/well. (NS = nonspecific
control, β-actin expression as inner control). (Error bars =
± std. * p < 0.05 relative to untreated control).
Scale bars = 200 μm.
ECO mediated GFP silence with the CRISPR/Cas9 system. (A) In vitro transfection of ECO/psgRNA and ECO/pCas9 (particle
ratio 1:1) in NIH3T3-GFP cells, with the dose of each plasmid at 1,
1.5, 2, and 2.5 μg/well in the transfection media. Cas9 expression
(blue), gRNA expression (red), and GFP knockdown (green) were imaged
by confocal microscopy. (B) Quantitative flow cytometry measurements
of GFP knockdown efficiency represented the percentage of GFP fluorescent
intensity normalized to nontreated control. (C) GFP knockdown efficiency
in mRNA levels measured by qRT-PCR. Cells were treated with ECO/CRISPR/Cas9
nanoparticles at a dose of 2 μg/well and mRNA levels were evaluated
at 24 and 48 h. (D) Quantitative flow cytometry measurements of sgRNA
expression represented by percentage of cells with mCherry expression.
(E) Western blot showing Cas9 protein expression 72 h after CRISPR/Cas9
treatments by ECO at a dose of 2 μg/well. (NS = nonspecific
control, β-actin expression as inner control). (Error bars =
± std. * p < 0.05 relative to untreated control).
Scale bars = 200 μm.
Gene Editing Efficiency Mediated by the New Amino Lipids
Gene editing efficiency mediated by the multifunctional amino lipids
was evaluated in NIH3T3-GFP cells at N/P ratio of 10 and a dose of
1 μg/well for each plasmid in the transfection media. Flow cytometry
was used to assess the cell popn>ulation change after CRISPR/Cas9 treatment
mediated by the n>an class="Chemical">amino lipids. Cell population was selected in SSC
(side-scattered light) and FSC (forward-scattered light) plot. Results
of one treatment from each lipid are represented in Figure A. After treatments, increases
of cell population with reduced GFP expression were observed for all
the amino lipids, which were summarized in Figure B. Averaged GFP knockdown levels ranging
from 3.5% to 20% were observed for the amino lipids. Cell populations
with expression of both Cas9 and sgRNA were also shown in the flow
cytometry results and summarized in Figure C. iECO demonstrated up to 51% CRISPR/Cas9
expression and the highest average GFP knockdown efficiency of 20%.
ECO demonstrated an average CRISPR/Cas9 expression level of 11.3%
and a GFP knockdown efficiency of 19%. iEKCO and iECKO had averaged
CRISPR/Cas9 expression levels of approximately 18% and 20%, with averaged
GFP knockdown efficiency of 15% and 7.2%, respectively. iEHCO and
iECHO demonstrated average CRISPR/Cas9 expression levels of 9.4% and
4.4%, with average GFP knockdown efficiency of 3.5% and 9.5%, respectively.
These results were verified by confocal images shown in Figure D. Clear reduction in GFP fluorescence
intensity was observed for ECO and iECO, with high Cas9 (Blue) and
sgRNA (Red) expression. Reductions in GFP fluorescence and CRISPR/Cas9
expressions were also observed for other amino lipids, which were
not as high as ECO and iECO. Interestingly, although iEKCO, iECKO,
iEHCO, and iECHO demonstrated comparable average CRISPR/Cas9 expression
level as to ECO, GFP knockdown efficiency was not as high as ECO.
The higher editing efficiency of ECO was attributed to higher expression
levels of both Cas9 and sgRNA in each cell of the CRISPR/Cas9 expressing
cell population mediated by ECO than iEKCO, iECKO, iEHCO, and iECHO
(Figure A).
Figure 8
In
vitro CRISPR/Cas9 transfection and gene editing
using the multifunctional amino lipids in NIH3T3-GFP cells. (A) Flow
cytometry of NIH3T3 cells from one treatment group transfected with
CRISPR/Cas9 (SSC for Side-scattered light, FSC for Forward-scattered
light, B525 for GFP, UV440 for BFP and YG610 for RFP). Cell population
was gated in SSC and FSC plot and was used for the following fluorescence
analysis. Low GFP expression was gated in the control group by selecting
47.7% cells with low GFP fluorescence intensity. The low GFP expression
cell population was then analyzed RFP (sgRNA) and BFP (Cas9) expression.
(B) Quantitative flow cytometry measurements of Cas9 and sgRNA expression
in low GFP expression cell population. (C) Quantitative flow cytometry
measurements of GFP knockdown represented by increased percentage
of low GFP expression cell population. (D) Confocal images of GFP
knockdown in NIH3T3 cells after CRISPR/Cas9 treatments. For each carrier,
the lipid/psgRNA and lipid/pCas9 nanoparticle ratio was 1:1, with
the dose of each plasmid at 1 μg, in the transfection media.
Cas9 expression (blue), gRNA expression (red), and GFP knockdown (green)
were imaged 72 h after transfection. (Error bars = ± std. * p < 0.05 relative to untreated control). Scale bars =
200 μm.
In
vitro CRISPR/Cas9 transfection and gene editing
using the multifunctional amino lipids in NIH3T3-GFP cells. (A) Flow
cytometry of NIH3T3 cells from one treatment groupn> transfected with
CRISPR/Cas9 (SSC for Side-scattered light, FSC for Forward-scattered
light, B525 for GFP, UV440 for BFP and YG610 for RFP). Cell popn>ulation
was gated in SSC and FSC plot and was used for the following fluorescence
analysis. Low GFP expn>ression was gated in the control groupn> by selecting
47.7% cells with low GFP fluorescence intensity. The low GFP expn>ression
cell popn>ulation was then analyzed RFP (sgRNA) and BFP (Cas9) expn>ression.
(B) Quantitative flow cytometry measurements of Cas9 and sgRNA expn>ression
in low GFP expn>ression cell popn>ulation. (C) Quantitative flow cytometry
measurements of GFP knockdown repn>resented by increased percentage
of low GFP expn>ression cell popn>ulation. (D) Confocal images of GFP
knockdown in NIH3T3 cells after CRISPR/Cas9 treatments. For each carrier,
the n>an class="Chemical">lipid/psgRNA and lipid/pCas9 nanoparticle ratio was 1:1, with
the dose of each plasmid at 1 μg, in the transfection media.
Cas9 expression (blue), gRNA expression (red), and GFP knockdown (green)
were imaged 72 h after transfection. (Error bars = ± std. * p < 0.05 relative to untreated control). Scale bars =
200 μm.
The cell viability after in vitro transfection
of the nanoparticles of CRISPR/Cas9 system with the pan class="Chemical">amino lipids was
evaluated using MTT assay, results are shown in Figure . The nanopn>articles demonstrated excellent
cell viability, which was more than 75% across all N/P ratios. Espn>ecially
for ECO and iECO plasmid DNA nanopn>articles, over 90% viability was observed for all tested N/P ratios.
It apn>pears that the n>an class="Chemical">lipids that the nanoparticles with poor stability
and DNA encapsulation, especially at the N/P = 6, exhibited a moderate
cytotoxicity.
Figure 9
Cell viability of in vitro transfection
of CRISPR/Cas9
system using amino lipids in NIH3T3-GFP cells by an MTT assay of cytotoxicity
72 h after transfection. Nanoparticles had plasmid concentrations
of 1 μg/well for each plasmid. For each carrier, the lipid/psgRNA
and lipid/pCas9 nanoparticle ratio was 1:1. (Error bars = ± std.
*, # p < 0.05 relative to untreated control).
Cell viability of in vitro transfection
of CRISPR/Cas9
system using pan class="Chemical">amino lipids in NIH3T3-GFP cells by an MTT assay of n>an class="Disease">cytotoxicity
72 h after transfection. Nanoparticles had plasmid concentrations
of 1 μg/well for each plasmid. For each carrier, the lipid/psgRNA
and lipid/pCas9 nanoparticle ratio was 1:1. (Error bars = ± std.
*, # p < 0.05 relative to untreated control).
Discussion
In
this work, we synthesized and tested several new multifunctional
pH-sensitive amino lipids for CRISRPR/Cas9 delivery. Multifunctional
pH-sensitive n>an class="Chemical">amino lipids were designed to form stable nanoparticles
with nucleic acids of different sizes and to facilitate efficient
cytosolic delivery using the PERC mechanism. Cytosolic release of
the gene cargo is facilitated by pH-sensitive amphiphilic endosomal
membrane destabilization in the acidic endosomal compartment (pH =
5–6) and dissociation of the nanoparticles by reduction of
the disulfide bonds from cysteine functional linkers in the cytoplasm.[23] In this study, the headgroup for new amino lipids
was simplified to 2,2′,2″-triaminotriethylamine, which
has three aminoethyl branches, one as protonatable ethylene diamine
headgroup and two for conjugation of lipid groups. Amino acids with
side chains containing amino groups (lysine and histidine) were also
introduced in the structure. When iECO with new headgroup was compared
to ECO, no significant difference was observed between the amino lipid
head groups in nanoparticle formation with the plasmids. Nanoparticles
formulated by ECO and iECO with CRISPR/Cas9 plasmids demonstrated
similar sizes and zeta potentials at N/P ratios of 8 and 10. The DNA
nanoparticles of both ECO and iECO showed similar pH-sensitive hemolysis
at N/P = 10. The results indicate the change of the headgroup does
not affect the formation of nanoparticles with plasmid DNA and the
new amino lipids.
Histidinyl and lysyl residues were also introduced
in the new amino
lipids to evaluate the effects of additional amino groupn>s of different
pKas on nanopn>article formation with plasmid DNA and their gene editing
efficiency. The extra protonatable amino groupn>s after introduction
of these amino acids residues could enhance the formulation of stable
nanopn>articles with nucleic acids and their endosomal escapn>e with a
reduced amount of n>an class="Chemical">amino lipids. Imidazole group in histidine is known
to act as endogenous buffers, which are commonly used as modifying
groups to improve the endosomal escape of several nonviral gene carriers.[24−26] With a pKa around 6, the imidazole group
is a weak base that can acquire a cationic charge when the pH of the
environment drops below 6 in the endosomal compartments after cellular
uptake. Protonation of the imidazole groups could induce fusogenic
activity of gene carriers.[27] Lysine has
a primary amine of a pKa value of 10.7,
which remains protonated at physiological and endosomal pH. Introduction
of lysinyl residues could potentially increase the electrostatic interactions
with nucleic acids to form stable nanoparticles with reduced amount
of the lipids.[28−31] The amino lipids with histidinyl or lysyl residues formed stable
nanoparticles at a high N/P ratio of 10 and were not able to consistently
to form stable nanoparticles at the N/P ratios of 6 and 8, as compared
to ECO and iECO. Their pH-sensitive hemolytic activities, an indicator
for pH-sensitive cell membrane disruption and endosome escape, were
not as efficient as ECO and iECO. The relatively low effectiveness
of the lysine and histidine modified amino lipids as compared to ECO
and iECO at the same N/P ratio could be attributed to the low concentration
of the modified lipids, 50% of that of ECO and iECO, used in the nanoparticle
formation at the same N/P ratio. The observation suggests that the
concentration of the amino lipids is also critical to form stable
nanoparticles with plasmid DNA.
Efficient gene editing requires
the delivery and expression of
both Cas9 and sgRNA in the same cells. The previously reported ECO
mediated efficient delivery and expression of both Cas9 and sgRNA
and significant gene editing efficiency. Dose dependent knockdown
was also shown with ECO with the GFP-targeting CRISPR/Cas9 system.
ECO mediated higher gene editing efficiency than Lipofectamine 2000,
a commercially available pan class="Chemical">lipid delivery system for nucleic acids.
However, the efficacy of CRISPR/Cas9 system plateaued at a high concentration,
possible due to a saturation effect. More CRISPR/Cas9 expn>ression might
not translate to more gene editing.
The tested amino lipids
demonstrated structurally depn>endent nanopn>article
formation with plasmid DNA expn>ressing CRISPR/Cas9, pH-sensitive n>an class="Disease">hemolysis,
gene expression, and gene editing efficiency. ECO and iECO exhibited
higher efficiency to form stable nanoparticles of relatively high
zeta potential with the DNA plasmids and more effective pH-sensitive
hemolysis, and resulted in higher gene transfection and gene editing
than other lipids. Although iECO induced more CRISPR/Cas9 expression
in cells than ECO, both ECO and iECO mediated similar gene editing
efficiency at N/P = 10. The amino lipids containing histidinyl or
lysinyl residues did not show improved intracellular expression of
the CRISPR/Cas9 system and GFP knockdown efficiency as compared ECO
and iECO at the same N/P ratio, possibly due to low overall lipid
concentration in the nanoparticle formation. Further detailed studies
are needed to explore the optimal conditions, e.g., the concentration
of the amino lipids in correlation with N/P ratio, for highly efficient
transfection of CRISPR/Cas9 system and gene editing with minimal toxic
side effects from the delivery system. Nevertheless, the multifunctional
pH-sensitive amino lipids, especially ECO and iECO, are promising
carriers for CRISPR/Cas9 system mediated gene editing. The lipids
have the potential to be used in gene therapy with CRISPR/Cas9 system,
especially for treating autosomal dominant diseases.
Conclusion
The multifunctional pH-sensitive amino lipids were modified and
evaluated for intracellular delivery of CRISPR/Cas9 system and gene
editing. The modified n>an class="Chemical">amino lipids exhibited structurally dependent
nanoparticle formation, pH-sensitive hemolysis, and gene editing with
the DNA plasmids expressing CRISPR/Cas9 system. ECO and iECO formed
stable nanoparticles with the DNA plasmids, and exhibited effective
pH-sensitive hemolysis, high expression of the CRISPR/Cas9 system,
and high gene editing efficiency. A saturation effect for gene editing
with the CRISPR/Cas9 system was observed for ECO when the dose of
DNA plasmids increased. The nanoparticles of the amino lipids and
CRISPR/Cas9 plasmids exhibited low cytotoxicity. The multifunctional
pH-sensitive amino lipids have the promise for intracellular delivery
of CRISPR/Cas9 to mediate effective gene editing for gene therapy.
Materials
and Methods
All reagents purchased from the vendors were
used without further
purification unless otherwise stated. Anhydrous N,N-diisopropylethylamine (DIPEA) was purchased from Alfa Aesar (Ward
Hill, MA). Trifluoroacetic acid (TFA) was purchased from Oakwood Products,
Inc. (West Columbia, SC). All the amino acids used in the chemical
synthesis were purchased from Novabiochem (Darmstadt, Germany). Ethylenediamine
(EDA), piperidine, 1,2-ethanedithiol (EDT), triisobutylsilane (TIBS),
oleoyl chloride, and N-(3-(dimethylamino)propyl)-N′-ethylcarbodiimide hydrochloride (EDC) were purchased
from Sigma-Aldrich Corporation (St. Louis, MO). Hydroxybenzotriazole
(HOBt) was purchased from Peptides International Inc. (Louisville,
KY). Fmoc-His(Trt)-OH and Fmoc-Cys (Trt)-OH were purchased from EMD
Biosciences (San Diego, CA). Sodium carbonate, potassium carbonate,
methylene chloride (DCM), N,N-dimethylformamide (DMF),
chloroform, methanol, and tetrahydrofuran (THF) were purchased from
Fisher Scientific (Hampton, NH). Reagents for cell culturing, including
fetal bovine serum, streptomycin, and penicillin were from Invitrogen
(Carlsbad, CA).
Synthesis of the Multifunctional Amino Lipids
Carrier
ECO was prepared and purified according to our previous report.[32] The synthetic route of ECO isotypic derivatives
were shown in Figure B, and is described here with the synthesis of iEHCO as an example. tert-Butyl 2-(bis(2-aminoethyl)amino)ethylcarbamate (BocTren)
was prepared with a good yield (72%) as reported previously.[33] Then, BocTren reacted with Fmoc-His(Trt)-OH
to provide ipEH (2,2′,2″-triaminotriethylamine conjugated
with two protected histidinyl residues) in the presence of EDC·HCl,
HOBt, and DIPEA.[34−36] To a DMF (40 mL) solution of BocTren (246 mg, 1.0
mmol) and Fmoc-His(Trt)-OH (1859 mg, 3.0 mmol), 1-hydroxybenzotriazol
hydrate (HOBt·H2O, 306.2 mg, 2.0 mmol), 1-(3-(dimethylamino)propyl)-3-ethylcarbodiimide
hydrochloride (EDC·HCl, 383.4 mg, 2.0 mmol), and diisopropylethylamine
(DIPEA, 348 μL, 2.0 mmol) were successively added. The mixture
was stirred for 9 h at room temperature under N2 atmosphere,
and the solvent was evaporated to dryness. The residue was dissolved
in methylene chloride and washed twice with 5% aqueous sodium carbonate.
The organic extract was dried over anhydrous Na2SO4 and filtered off. Solvent was evaporated to dryness, and
the residue was purified by recrystallization from methylene chloride/diethyl
ether twice. The raw product ipEH was directly used to next step reaction.A solution of ipEH (363 mg, 0.25 mmol) in DMF (10 mL) containing
20% piperidine was stirred under N2 atmosphere at room
temperature for 2 h to remove Fmoc protection and the reaction was
monitored by mass spectrometry. Once ipEH was consumed, the solution
was evaporated to dryness, washed with 5% aqueous sodium carbonate,
and extracted with methylene chloride. The organic extract was dried
over anhydrous Na2SO4, filtered off, and evaporated
to dryness. The residue was purified on silica gel using a gradient
eluent (chloroform to chloroform/methanol (v/v, 30/1)). The product
(ipEH-NH2) was obtained in a yield of 78%. 1H NMR (500 MHz, CDCl3, δ ppm): 7.93, 7.33, 7.12,
6.66, 6.00, 4.67, 3.64, 3.24, 3.12, 3.07, 2.71, 2.56, 1.38. 13C NMR (126 MHz, CDCl3, δ ppm): 142.42, 138.48, 129.74,
128.05, 119.43, 55.82, 53.68, 36.85, 28.46. Electrospray ionization
mass spectrometry (Thermo Finnigan LCQ Deca XP LCMSMS System) (Thermo
Fisher Scientific, Waltham, MA): m/z = 1027 (M+Na+, m/z),
1005 (M+H+) measured; 1005.28 calculated.Intermediate
ipEH-NH2 (2,2′,2″-triaminotriethylamine
conjugated with two histidinyl residues) reacted with Fmoc-Cys(Trt)-OH
to provide ipEHC in the presence of EDC·HCl, HOBt and DIPEA.
To a DMF (40 mL) solution of ipEH-NH2 (503 mg, 0.5 mmol)
and Fmoc-Cys(Trt)-OH (879 mg, 1.5 mmol), 1-hydroxybenzotriazol hydrate
(HOBt·H2O, 153 mg, 1.0 mmol), 1-(3-(dimethylamino)propyl)-3-ethylcarbodiimide
hydrochloride (EDC·HCl, 192 mg, 1.0 mmol), and diisopropylethylamine
(DIPEA, 192 μL, 1.0 mmol) were successively added. The mixture
was stirred for 9 h at room temperature under N2 atmosphere,
and the solvent was evaporated to dryness. The residue was dissolved
in methylene chloride and washed twice with 5% aqueous sodium carbonate.
The organic extract was dried over anhydrous Na2SO4 and filtered off. Solvent was evaporated to dryness, and
the residue was purified by recrystallization from methylene chloride/diethyl
ether twice. The raw product ipEHC was directly used to next step
reaction.A solution of ipEHC (535 mg, 0.25 mmol) in DMF (10
mL) containing
20% piperidine was stirred under N2 atmosphere at room
temperature for 2 h to remove the Fmoc protection and the reaction
was monitored by MS. Once no ipEHC was comsumed, the solution was
evaporated to dryness, washed with 5% aqueous sodium carbonate, and
extracted with methylene chloride. The organic extract was dried over
anhydrous Na2SO4, filtered off, and evaporated
to dryness. The product ipEHC-NH2 was purified from recrystallization
of methylene chloride/hexane twice and direct used into next step
reaction.To a THF (20 mL) solution of ipEHC-NH2 (ipEH
conjugated
with two cysteinyl residues) (170 mg, 0.1 mmol), 4-(dimethylamino)pyridine
(12.2 mg, 0.1 mmol), sodium sulfate (340 mg), and potassium carbonate
(340 mg) was successively added. After cooling to 0 °C, a THF
(10 mL) solution of oleoyl chloride (90.3 mg, 0.3 mmol) was added
dropwise. The reaction was monitored by MS and once no iEHC remained,
the salts were filtered off and evaporated to dryness. The residue
was washed with water and centrifuged to separate the supernatant
and precipitate. The precipitate was lyophilized to provide ipEHCO.To a methylene chloride (3 mL) solution of ipEHCO (100 mg, 0.045
mmol), a freshly prepared cocktail solution of trifluoroacetic acid/water/1,2-ethanedithiol/triisobutylsilane
(1.5 mL/75 μL/75 μL/150 μL) was added to remove
the protecting groups in ice/water bath. The solution was stirred
for 1 h monitored by MS. Once no ipEHCO remained, the reaction solution
was evaporated to dryness and purified via Biotage flash chromatography
(Biotage, Charlotte, NC) (eluents: water and methanol) to provide
pure EHCO in a yield of 20%. 1H NMR (500 MHz, DMSO-d6, δ ppm): 8.93 (s, 2H), 8.25 (m, 4H),
8.17 (b, 2H), 8.07 (b, 2H), 7.31 (m, 2H), 5.26 (m, 4H), 4.54 (m, 4H),
3.13 (m, 8H), 2.93 (m, 4H), 2.80 (m, 8H), 2.11 (m, 4H), 1.91 (m, 10H),
1.41 (b, 6H), 1.17 (b, 38H), 0.79 (t, 6H). MALDI-TOF MS (M + H+, m/z): 1155.84, measured;
1155.79, calculated.Other pan class="Chemical">amino lipid carriers were synthesized
similarly with characteristic
structural information listed as the following. Intermediate ipn>EC-NH2 for iECO, iECHO, and iECKO: yield: 72%; 1H NMR
(500 MHz, CDCl3, δ ppm): 7.42 (b, 2H), 7.34 (m, 12H),
7.19 (m, 12H), 7.12 (m, 12H), 5.46 (t, 1H), 3.08 (m, 8H), 2.61 (m,
2H), 2.41 (m, 8H), 1.33 (s, 9H); 13C NMR (126 MHz, CDCl3, δ ppm): 175.77, 172.67, 155.94, 144.60, 129.60, 128.00,
126.82, 66.95, 54.06, 53.56, 53.14, 38.66, 37.37, 36.96, 28.53; ESI-MS
(m/z, M+H+): 936.44,
calculated; 937.24, measured.
iECO: yield: 40%: 1H NMR (500 MHz, DMSO-d6, δ ppm):
8.22 (m, 4H), 5.33 (m, 4H), 3.20 (m,
4H), 2.83 (m, 4H), 2.18 (b, 6H), 1.98 (b, 8H), 1.49 (b, 8H), 1.25
(b, 46H), 0.87 (t, J = 5.5 Hz, 6H); MALDI-TOF MS
(m/z, M+H+): 881.67,
calculated; 881.82, measured.iECHO: yield: 32%; 1H NMR (500 MHz, DMSO-d6, δ ppm):
8.94 (s, 2H), 8.80 (b, 2H), 8.18 (b,
4H), 7.73 (b, 2H), 7.31 (b, 2H), 5.32 (m, 4H), 4.56 (m, 4H), 3.18
(m, 10H), 2.74 (m, 10h), 2.07 (M, 12H), 1.41 (m, 8H), 1.23 (b, 38H),
0.85 (t, J = 6.0 Hz, 6H); MALDI-TOF MS (m/z, M + H)+: 1155.79, calculated; 1155.60,
measured.Intermediate ipEK-NH2: yield: 81%; 1H NMR
(500 MHz, CDCl3, δ ppm): 7.73 (b 2H), 5.54 (b, 1H),
4.75 (b, 2H), 3.39 (b, 2H), 3.31 (m, 4H), 3.12 (m, 6H), 2.61 (m, 6),
1.84 (m, 2H), 1.76 (b, 4H), 1.53 (m, 6H), 1.45 (s, 27H); 13C NMR (126 MHz, CDCl3, δ, ppm): 175.20, 156.08,
55.31, 54.01, 53.56, 40.21, 38.72, 37.16, 34.74, 29.94, 28.38, 23.02;
MALDI-TOF MS (m/z, M + Na+): 725.49, calculated; 725.56, measured. (m/z, M+H+): 703.51 calculated; 703.54, measured.iEKCO: yield: 35%. 1H NMR (500 MHz, DMSO-d6, δ ppm): 8.08 (m, 4H), 7.79 (m, 2H), 5.34 (m,
4H), 4.31 (m, 4H), 3.13 (m, 10H), 2.77 (m, 6H), 2.14 (m, 6H), 1.99
(m, 6H), 1.25 (m, 62H), 0.87 (t, J = 5.5 Hz, 6H);
MALDI-TOF MS (m/z, M+H+): 1137.86, calculated; 1138.13, measured.iECKO: yield: 39%: 1H NMR (500 MHz, DMSO-d6, δ
ppm): 7.83 (m, 4H), 7.67 (m, 2H), 5.37 (m,
4H), 4.23 (m, 4H), 3.20 (m, 8H), 2.76 (m, 6H), 2.11 (m, 6H), 1.95
(m, 6H), 1.51 (m, 18H), 1.20 (b, 46H), 0.86 (t, J = 7.0 Hz, 6H); MALDI-TOF MS (m/z, M+H+): 1137.86, calculated; 1137.83, measured.
Cell Culture
NIH3T3 cell line with stable GFP expression
was prepared as previously described.[37] The NIH3T3-GFP cells were cultured in DMEM and supplemented with
10% fetal bovine serum, 100 μg/mL streptomycin, and 100 units/mL
penicillin (all reagents were from Invitrogen). Cells were maintained
in a humidified incubator at 37 °C and 5% CO2.
Nanoparticle
Formulation and Characterization
CRISPR/Cas9
plasmids were purchased from the Addgene repository. (Addgene plasmids
#78535 and 78547).[38] Two sgRNAs were selected
to target eGFP sequence (sgRNA1: GAGCTGGACGGCGACGTAAACGG;
sgRNA2: CAGAACACCCCCATCGGCGACGG). The
amino lipid carriers were dissolved in ethanol at a stock concentration
of 2.5 mM, while the plasmids of CRISPR/Cas9 system were reconstituted
in nuclease-free water at 0.5 μg/μL. Nanopn>articles are
formulated by mixing the n>an class="Chemical">amino lipids with plasmid DNA for 30 min
in nuclease-free water at prespecified N/P ratios. The size and zeta
potential of the nanoparticles were analyzed using an Anton Paar Litesizer
500 instrument (Anton Paar USA Inc., Ashhland, VA) in nuclease free
water.
The encapsulation of CRISPR/cas9 plasmids in the nanoparticles
was assessed by gel electrophoresis. pan class="Chemical">Lipid/plasmid DNA nanopn>articles
(4 μL) and 4 μL of loading dye (Promega, Madison, WI)
and 16 μL nuclease free water were mixed. The mixture (20 μL)
was loaded onto a 0.7% agarose gel containing ethidium bromide. The
gel was submerged in 0.5× Tris/Borate/EDTA (TBE) buffer and run
at 100 V for 25 min. Plasmid DNA bands were visualized using GelDoc
XRS (Bio-Rad, Hercules, CA).
Evaluation of pH-Sensitive Membrane Disruption
Red
blood cells (RBCs) (Innovative Research Inc., Novi, MI) were diluted
1:50 in PBS solutions of pH = 5.4, 6.5, or 7.4. The solution of nanoparticles
(100 μL, pH = 5.4, 6.5, or 7.4) at N/P ratio of 10 was incubated
with 100 μL of diluted RBCs at 37 °C for 2 h and tested
in triplicates. Nanoparticles were formulated so that the final amine
concentration for all the samples was 150 μM after mixing with
the RBCs. The absorbance of the supernatant of each sample was measured
on a SpectraMax spectrophotometer (Molecular Devices, San Jose, CA)
at a wavelength of 540 nm to determine the amount of hemoglobin released
from the RBCs, due to membrane destabilization. PBS and 1% (v/v) Triton-X100
were used as negative and positive controls, respectively. The background
absorption of the RBCs treated with PBS treatment was subtracted from
the solutions treated with the samples. The percentage of pan class="Disease">hemolysis
of each sampn>le was calculated from the average of the released hemoglobin
relative to the hemoglobin release from the positive control with
1% (v/v) Triton-X100 surfactant during the 2-h incubation period.
In Vitro Transfection
NIH3T3-GFP cells
were seeded either onto 12-well plates at a density of 5 × 104 cells per well or confocal dish at a density of 1 ×
105 cells and allowed to grow for 24 h at 37 °C. Transfections
were conducted in 10% serum media with the ECO/pCas9 and ECO/psgRNA
nanoparticles at plasmid concentrations of 1, 1.5, 2, and 2.5 μg/well
for each plasmid. The nanoparticles were incubated with NIH3T3 cells
for 8 h at 37 °C. Then, the transfection media was replaced with
fresh serum-containing media (10% serum) and cells were allowed to
grow until 24, 48, or 72 h. Lipofectamine 2000 particles were formulated
with pCas9 and psgRNA at a concentration of 2 μg/well for each
plasmid according to the protocol from the vendor. The expression
of Cas9 (BFP), sgRNA (mCherry), and GFP knockdown efficiency were
evaluated with an Olympus FV1000 confocal microscope (Olympus, Center
Valley, PA). The quantitative analysis was performed with flow cytometry.
The cells were harvested by treatment with 0.25% trypsin containing
0.26 mmol EDTA (Invitrogen, Carlsbad, CA), collected by centrifugation
at 1500 rpm for 5 min, resuspended in 500 μL of PBS containing
4% paraformaldehyde, and finally passed through a 35 μm cell
strainer (BD Biosciences, Franklin Lakes, NJ). Cas9 expression, gRNA
expression, and GFP knockdown were quantified by the fluorescence
intensity measurement for a total of 10,000 cells per sample using
a BD FACSCalibur flow cytometer (BD Biosciences, Franklin Lakes, NJ).
The other pan class="Chemical">lipids were similarly tested the plasmid concentration of
1 μg/well for each plasmid. Each sampn>le was conducted in tripn>licate.
Cytotoxicity
pan class="Disease">Cytotoxicity of the nanopn>articles of the
n>an class="Chemical">amino lipids was investigated using MTT colorimetric assay (Invitrogen,
Carlsbad, CA). NIH3T3-GFP cells were seeded onto 12-well plates at
a density of 5 × 104 cells per well. For each carrier,
the lipid/psgRNA and lipid/pCas9 nanoparticle ratio was 1:1 and nanoparticles
had concentrations of 1 μg/well for each plasmid, which were
incubated with NIH3T3 cells for 8 h at 37 °C. Then, the transfection
media was replaced with fresh serum-containing media (10% serum) and
cells were allowed to grow until 72 h. NIH3T3-GFP cells were incubated
with 100 μL MTT reagent for 4 h, followed by an additional 4
h incubation with 1 mL SDS-HCl solution to dissolve formazan crystals
formed by the reduction of MTT by NAD(P)H-dependent enzymes in the
cells. The absorbance of each sample was measured at 570 nm using
a SpectraMax microplate reader (Molecular Devices, San Jose, CA).
Cellular viability was calculated by averaging the signal intensities
over three replicates and then normalizing the results relative to
the negative control data.
qRT-PCR
NIH3T3-GFP cells were treated
with the pan class="Chemical">lipid
CRISPR/Cas9 nanopn>articles for 8 h and the transfection media was repn>laced
with fresh media containing 10% serum. Cells were allowed to grow
until 24 or 48 h. Total RNA was extracted from cells using the RNeasy
Plus Mini Kit (Qiagen, Germantown, MD), according to manufacturer’s
instructions. Reverse transcripn>tion was performed using the miScripn>t
II RT Kit (Qiagen) and qPCR was performed using the SyBr Green PCR
Master Mix (Apn>plied Biosystems, Foster City, CA). Gene expn>ression
was analyzed by the 2–ΔΔCt method with
18S expn>ression as the control. The following primer sequences were
used: mCherry, Fwd 5′-GAACGGCCACGAGTTCGAGA-3′
and Rev 5′-CTTGGAGCCGTACATGAACTGAGG-3′;
eGFP, Fwd 5′-ACGTAAACGGCCACAAGTTC-3′
and Rev 5′-AAGTCGTGCTGCTTCATGTG-3′;
18S (rRNA), Fwd 5′-TCAAGAACGAAAGTCGGAGG-3′
and Rev 5′-GGACATCTAAGGGCATCACA-3′.
Western Blot
Similarly, NIH3T3-GFP cells were treated
with CRISPR/Cas9 nanoparticles for 8 h and the transfection media
was replaced with fresh media containing 10% serum. Then, cells were
allowed to grow for 72 h. Total cellular protein was extracted as
a reported method.[39] Protein extracts (40
μg) were separated by SDS-PAGE, transferred onto nitrocellulose
membrane and immunoblotted with primary antibodies overnight. Anti-Cas9
and anti-β-actin (loading control) from Cell Signaling Technology
(Danvers, MA) were used to stain the proteins. The membrane was visualized
using an AlphaImager imaging system (Bio-Rad, Hercules, CA). Protein
expression were determined by analyzing the bands on the membranes.
Authors: Hao Yin; Rosemary L Kanasty; Ahmed A Eltoukhy; Arturo J Vegas; J Robert Dorkin; Daniel G Anderson Journal: Nat Rev Genet Date: 2014-07-15 Impact factor: 53.242
Authors: Amita M Vaidya; Zhanhu Sun; Nadia Ayat; Andrew Schilb; Xujie Liu; Hongfa Jiang; Da Sun; Josef Scheidt; Victoria Qian; Siyuan He; Hannah Gilmore; William P Schiemann; Zheng-Rong Lu Journal: Bioconjug Chem Date: 2019-02-21 Impact factor: 4.774
Authors: Da Sun; Rebecca M Schur; Avery E Sears; Song-Qi Gao; Wenyu Sun; Amirreza Naderi; Timothy Kern; Krzysztof Palczewski; Zheng-Rong Lu Journal: ACS Appl Bio Mater Date: 2020-04-03
Authors: Da Sun; Wenyu Sun; Song-Qi Gao; Jonathan Lehrer; Amirreza Naderi; Cheng Wei; Sangjoon Lee; Andrew L Schilb; Josef Scheidt; Ryan C Hall; Elias I Traboulsi; Krzysztof Palczewski; Zheng-Rong Lu Journal: Mol Ther Nucleic Acids Date: 2022-08-24 Impact factor: 10.183