Belém Sampaio-Marques1,2, Hélder Pereira1,2, Ana R Santos1,2, Alexandra Teixeira1,2, Paula Ludovico1,2. 1. Life and Health Sciences Research Institute (ICVS), School of Medicine, University of Minho, Braga, Portugal. 2. ICVS/3B's - PT Government Associate Laboratory, Braga/Guimarães, University of Minho, Braga, Portugal.
Abstract
α-Synuclein (SNCA) is a presynaptic protein that is associated with the pathophysiology of synucleinopathies, including Parkinson's disease. SNCA is a naturally aggregation-prone protein, which may be degraded by the ubiquitin-proteasome system (UPS) and by lysosomal degradation pathways. Besides being a target of the proteolytic systems, SNCA can also alter the function of these pathways further, contributing to the progression of neurodegeneration. Deterioration of UPS and autophagy activities with aging further aggravates this toxic cycle. Caloric restriction (CR) is still the most effective non-genetic intervention promoting lifespan extension. It is known that CR-mediated lifespan extension is linked to the regulation of proteolytic systems, but the mechanisms underlying CR rescue of SNCA toxicity remain poorly understood. This study shows that CR balances UPS and autophagy activities during aging. CR enhances UPS activity, reversing the decline of the UPS activity promoted by SNCA, and keeps autophagy at homeostatic levels. Maintenance of autophagy at homeostatic levels appears to be relevant for UPS activity and for the mechanism underlying rescue of cells from SNCA-mediated toxicity by CR.
α-Synuclein (SNCA) is a presynaptic protein that is associated with the pathophysiology of synucleinopathies, including Parkinson's disease. SNCA is a naturally aggregation-prone protein, which may be degraded by the ubiquitin-proteasome system (UPS) and by lysosomal degradation pathways. Besides being a target of the proteolytic systems, SNCA can also alter the function of these pathways further, contributing to the progression of neurodegeneration. Deterioration of UPS and autophagy activities with aging further aggravates this toxic cycle. Caloric restriction (CR) is still the most effective non-genetic intervention promoting lifespan extension. It is known that CR-mediated lifespan extension is linked to the regulation of proteolytic systems, but the mechanisms underlying CR rescue of SNCA toxicity remain poorly understood. This study shows that CR balances UPS and autophagy activities during aging. CR enhances UPS activity, reversing the decline of the UPS activity promoted by SNCA, and keeps autophagy at homeostatic levels. Maintenance of autophagy at homeostatic levels appears to be relevant for UPS activity and for the mechanism underlying rescue of cells from SNCA-mediated toxicity by CR.
Entities:
Keywords:
aging; alpha-synuclein; autophagy; caloric restriction; ubiquitin-proteasome system
α-Synuclein (SNCA) is a presynaptic protein and the major component of Lewy bodies, the hallmark proteinaceous inclusions implicated in synucleinopathies, including Parkinson’s disease. While it is evident that SNCA is a key player in synucleinopathies pathogenesis, its exact role, although broadly investigated, is not yet fully understood, either in health or in disease [1].Proteostasis (protein homeostasis) is maintained by a fine balance between folding, refolding and/or degradation of proteins, orchestrated by molecular chaperones and the proteolytic systems: the ubiquitin-proteasome system (UPS) and lysosome-mediated degradation pathways (reviewed in [2]). SNCA, an aggregation-prone protein, is a target for degradation by proteolytic systems including UPS and macroautophagy (hereafter called autophagy) (reviewed in [3-6]). However, the pathways of SNCA degradation remain controversial and the mechanism(s) that govern whether SNCA will be degraded by the UPS or autophagy remain(s) unclear [4]. In yeast cells expressing SNCA, the pharmacological and genetic inhibition of proteasome resulted in contradictory observations [7-11]. Nonetheless, both degradation pathways, UPS and autophagy, become overloaded in pathological conditions associated with synucleinopathies, such as those caused by SNCA overexpression or the presence of point mutations [7,12-14]. Failure of SNCA clearance due to impairment of protein quality control systems, particularly autophagy, has become a recognized central and common pathogenic event of synucleinopathies [4,12,15-17]. This event of proteostasis collapse is aggravated by aging, a major risk factor for neurodegenerative disorders [18]. Thus, interventions that delay aging could have promising therapeutic effects in PD and other synucleinopathies.Caloric restriction (CR) is still one of the most effective non-genetic interventions known to promote lifespan extension in several model organisms [19]. CR was shown to alleviate SNCA toxicity in different PD models, ranging from the unicellular yeast to Caenorhabditis elegans, mice and primates [20-25]. CR has been shown to ameliorate the age-related decline of proteostasis by the activation of the protein degradation machinery or through alterations in the balance between protein synthesis and degradation (reviewed in [26]). With regard to protein degradation, CR is known as an enhancer of both UPS [27-29] and autophagy, the later through the modulation of different regulatory pathways/molecules, such as TORC1 or AMPK (yeast homologue of Snf1). However, how CR impacts on the crosstalk between UPS and autophagy and its contribution for SNCA toxicity, a critical stress scenario in aging conditions, remains mostly unexplored. Herein, using a simple and powerful model organism, the yeastSaccharomyces cerevisiae heterologously expressing the humanSNCA, we aimed to understand the contribution of proteolytic systems and their crosstalk to the beneficial effects promoted by CR intervention during aging.Our data shows that CR promotes the upregulation of UPS accompanied by the maintenance of autophagy at homeostatic levels in aged SNCA-expressing cells. The study of the crosstalk between UPS and autophagy indicated that UPS is increased upon autophagy inhibition, but autophagy is not enhanced by UPS inhibition under CR conditions. These results suggest an important role of autophagy on regulation of proteasome homeostasis under CR conditions. Maintenance and regulation of autophagy at homeostatic levels appears to be the central mechanism underlying the cell’s rescue from SNCA-mediated toxicity by CR.
RESULTS
Caloric restriction enhances ubiquitin-proteasome activity of aged SNCA-expressing cells
Our previous results showed that caloric restriction (CR) promotes chronological lifespan (CLS) extension of yeast cells heterologously expressing the human α-synuclein (SNCA) (Fig. 1A) associated with the maintenance of autophagy at homeostatic levels [21]. CR promoting-longevity effects are highly dependent on the main proteolytic systems, ubiquitin-proteasome system (UPS) and autophagy, both affected by aging and SNCA expression. Thus, the contribution of these two cellular processes to CR-extended longevity in SNCA-expressing cells was evaluated. UPS activity, namely the chymotrypsin- and trypsin-like activities, was assessed during CLS. The results showed that SNCA affects UPS functioning by leading to a dramatic reduction of chymotrypsin-like activity in aged cells (Fig. 1B). Trypsin-like activity was affected only after 7 days of CLS (Fig. 1B). Decreased UPS activity in SNCA-expressing cells was also confirmed by the increased accumulation of the short-lived protein UBG76V-GFP (Fig. 1C and 1D), which reflects a reduction of the ubiquitin/proteasome-dependent proteolysis. These findings were further corroborated by the increase in protein ubiquitination profile (Fig. 1E and 1F) and by the increased RPN4 relative mRNA expression levels (Fig. 1G). The increase in the RPN4 mRNA levels in SNCA-expressing cells are accompanied by a decrease in the mRNA levels of RPN5, a subunit of the 26S proteasome complex, indicating that the proteasome stress regulon is operating under this proteotoxic conditions (Fig. 1H). Deletion of RPN4 abolishes the Rpn4-dependent upregulation of RPN5 transcription (data not shown) as previously described for other stress conditions [30]. These results agree with a previous report showing that SNCA alters proteasome composition and impairs proteasome-mediated protein degradation affecting the survival of stationary phase cells [31].
Figure 1
Caloric restriction abrogates α-synuclein (SNCA)-induced toxicity by upregulating ubiquitin-proteasome system activity. (A) Chronological lifespan (CLS) and SNCA levels of stationary wild type cells harbouring the vector control or expressing the human SNCA grown under regular (2% glucose) or CR (0.5% glucose) conditions. (B) Chymotrypsin- and trypsin like activities. The assay was normalized to the total protein amount. (C) UPS activity measured by monitoring the ubiquitin/proteasome-dependent proteolysis of the short-lived protein UBG76V-GFP. GFP was detected by Western blotting using a GFP-specific antibody. (D) Graphical representation of GFP/Pgk1 obtained by densitometric analysis. (E) Ubiquitination profile determined by Western blotting using an anti-mono and polyubiquitination antibody. (F) Graphical representation of the intensity of total UB/Pgk1 obtained by densitometric analysis. (G) RPN4 and (H) RPN5 mRNA relative expression levels. Three reference genes (ACT1-actin, PDA1-alpha subunit of pyruvate dehydrogenase and TDH2-isoform 2 of glyceraldehyde-3-phosphate dehydrogenase) were used as internal standards and for the normalization of mRNA expression levels. Significance was determined by two-way ANOVA (*p≤0.05, **p≤0.01, ***p≤0.001, ****p≤0.0001) between cells grown under regular or CR conditions expressing vector control or SNCA. Data represents mean ± SEM of at least three biological independent replicas. The error bars represent the standard error of the mean (SEM).
Caloric restriction abrogates α-synuclein (SNCA)-induced toxicity by upregulating ubiquitin-proteasome system activity. (A) Chronological lifespan (CLS) and SNCA levels of stationary wild type cells harbouring the vector control or expressing the humanSNCA grown under regular (2% glucose) or CR (0.5% glucose) conditions. (B) Chymotrypsin- and trypsin like activities. The assay was normalized to the total protein amount. (C) UPS activity measured by monitoring the ubiquitin/proteasome-dependent proteolysis of the short-lived protein UBG76V-GFP. GFP was detected by Western blotting using a GFP-specific antibody. (D) Graphical representation of GFP/Pgk1 obtained by densitometric analysis. (E) Ubiquitination profile determined by Western blotting using an anti-mono and polyubiquitination antibody. (F) Graphical representation of the intensity of total UB/Pgk1 obtained by densitometric analysis. (G) RPN4 and (H) RPN5 mRNA relative expression levels. Three reference genes (ACT1-actin, PDA1-alpha subunit of pyruvate dehydrogenase and TDH2-isoform 2 of glyceraldehyde-3-phosphate dehydrogenase) were used as internal standards and for the normalization of mRNA expression levels. Significance was determined by two-way ANOVA (*p≤0.05, **p≤0.01, ***p≤0.001, ****p≤0.0001) between cells grown under regular or CR conditions expressing vector control or SNCA. Data represents mean ± SEM of at least three biological independent replicas. The error bars represent the standard error of the mean (SEM).Importantly, CR intervention promoted an increase of UPS activity (Fig. 1B, 1C and 1D), increase of RPN5 mRNA levels and reduction of RPN4 levels, and protein ubiquitination profile (Fig. 1) in SNCA-expressing cells submitted to CR. Comparing the RPN4 and RPN5 mRNA levels with UPS activities of caloric restricted SNCA-expressing cells, it is possible to conclude that UPS activity is increased since day 0 while RPN4 and RPN5 mRNA levels are only decreased and increased, respectively, at day 3 of CLS (Fig. 1). This is most probably the result of the negative feedback regulation of proteasome homeostasis. Overall the data presented suggests that CR intervention is able to increase UPS functioning during aging of SNCA-expressing cells.
Autophagy inhibition in SNCA-expressing cells submitted to caloric restriction is associated with increased ubiquitin-proteasome activity
The crosstalk between UPS and autophagy is known to be critical for the surveillance and prevention of protein misfolding toxicity [26,32,33]. Our data showed that CR is able to modulate both UPS (Fig.1) and autophagy [21,34] in aged SNCA-expressing cells, suggesting a coordination between both in this scenario. To explore this hypothesis, autophagy was inhibited in CR conditions and the response of SNCA-expressing cells evaluated during aging. Inhibition of autophagy with chloroquine (CQ) in caloric restricted cells expressing SNCA resulted in a shorter CLS, as compared with cells expressing vector control in the same conditions (Fig. 2A and 2B). These results were further supported by the comparison of the mean (50% of survival) and maximum (10% of survival) lifespans of SNCA-expressing cells with vector control expressing cells, under CR in the presence or absence of CQ (Fig. 2B). These data suggest a relevant role of autophagy in CR-mediated lifespan extension of SNCA-expressing cells. Although autophagy inhibition resulted in a decreased CLS of caloric restricted SNCA-expressing cells (Fig 2A), the CLS of these cells is still increased when compared to SNCA-expressing cells under normal growth conditions (2% glucose) (mean lifespan of 23.1 ± 0.2 days versus 7.7 ± 0.6 days) (Fig. 1A). Next, we wondered about the contribution of UPS activity for the CR effects on the CLS of SNCA-expressing cells when autophagy is inhibited. Pharmacological inhibition of autophagy resulted in increased UPS activity along chronological aging as reflected by chymotrypsin- and trypsin-like activities (Fig. 2D) and by the decreased levels of UBG76V-GFP (Fig. 2E and 2F) in caloric restricted SNCA-expressing cells. The increase of UPS activity elicited by autophagy inhibition is further confirmed by a decrease of the protein ubiquitination profile (Fig. 2G and 2H) and of RPN4 mRNA levels in SNCA-expressing cells under CR conditions (Fig. 2C). Altogether, the data revealed that UPS and autophagy crosstalk under CR with increased UPS activity as a response to autophagy inhibition.
Figure 2
Autophagy inhibition leads to upregulation of the ubiquitin-proteasome system activity in α-synuclein (SNCA)-expressing cells under caloric restriction. (A) Chronological lifespan (CLS) and SNCA levels of SNCA-expressing stationary wild type cells, under caloric restriction (CR, 0.5% glucose) conditions, in the presence or absence of chloroquine (CQ), an inhibitor of autophagy. (B) Mean (50% survival) and maximum (10% survival) lifespans determined from curve fitting of the survival data from CLS. Significance was determined by two-way ANOVA (*p≤0.05, ****p≤0.0001) between cells grown under CR conditions expressing vector control or SNCA in the presence or absence of CQ. (C) RPN4 mRNA relative expression levels as described in the legend of Figure 1. (D) Chymotrypsin- and trypsin like activities. The assay was normalized to the total protein amount. (E) UPS activity measured by monitoring the ubiquitin/proteasome-dependent proteolysis of the short-lived protein UBG76V-GFP. GFP was detected by Western blotting using a GFP-specific antibody. (F) Graphical representation of GFP/Pgk1 obtained by densitometric analysis. (G) Ubiquitination profile determined by Western blotting using an anti-mono and polyubiquitination antibody. (H) Graphical representation of the intensity of total UB/Pgk1 obtained by densitometric analysis. Statistical significance represented in (C), (D), (F) and (H) was determined by Student's t-test (*p≤0.05, ***p≤0.001, ****p≤0.0001) comparing caloric restricted vector control or SNCA-expressing cells in the presence or absence of CQ. Data represents mean ± SEM of at least three biological independent replicas. The error bars represent the standard error of the mean (SEM).
Autophagy inhibition leads to upregulation of the ubiquitin-proteasome system activity in α-synuclein (SNCA)-expressing cells under caloric restriction. (A) Chronological lifespan (CLS) and SNCA levels of SNCA-expressing stationary wild type cells, under caloric restriction (CR, 0.5% glucose) conditions, in the presence or absence of chloroquine (CQ), an inhibitor of autophagy. (B) Mean (50% survival) and maximum (10% survival) lifespans determined from curve fitting of the survival data from CLS. Significance was determined by two-way ANOVA (*p≤0.05, ****p≤0.0001) between cells grown under CR conditions expressing vector control or SNCA in the presence or absence of CQ. (C) RPN4 mRNA relative expression levels as described in the legend of Figure 1. (D) Chymotrypsin- and trypsin like activities. The assay was normalized to the total protein amount. (E) UPS activity measured by monitoring the ubiquitin/proteasome-dependent proteolysis of the short-lived protein UBG76V-GFP. GFP was detected by Western blotting using a GFP-specific antibody. (F) Graphical representation of GFP/Pgk1 obtained by densitometric analysis. (G) Ubiquitination profile determined by Western blotting using an anti-mono and polyubiquitination antibody. (H) Graphical representation of the intensity of total UB/Pgk1 obtained by densitometric analysis. Statistical significance represented in (C), (D), (F) and (H) was determined by Student's t-test (*p≤0.05, ***p≤0.001, ****p≤0.0001) comparing caloric restricted vector control or SNCA-expressing cells in the presence or absence of CQ. Data represents mean ± SEM of at least three biological independent replicas. The error bars represent the standard error of the mean (SEM).
Ubiquitin-proteasome activity inhibition does not impact on autophagy of SNCA-expressing cells under caloric restriction
To further explore the crosstalk between autophagy and UPS in SNCA-expressing cells under CR conditions, UPS activity was pharmacological inhibited with two different proteasome inhibitors, bortezomib and MG132. The use of proteasome inhibitors in S. cerevisiae cells requires reduced drug efflux that is achieved by deletion of PDR5, a multidrug transporter involved in pleiotropic drug resistance [35]. Thus, pdr5Δ cells heterologous expressing SNCA were cultured under CR conditions and treated with proteasome inhibitors. The pharmacological inhibition of UPS activity was confirmed by the drastic reduction of chymotrypsin- and trypsin-like activities (Fig. 3A) and by the accumulation of UBG76V-GFP, promoted by bortezomib (Fig. 3C and 3D) and MG132 (data not shown), in SNCA-expressing cells under CR. The inhibition of UPS activity is also supported by the increased RPN4 mRNA levels (Fig. 3B).
Figure 3
Pharmacological inhibition of the ubiquitin-proteasome system activity decreases lifespan of α-synuclein (SNCA)-expressing cells grown under caloric restriction but has no major impact on autophagy. (A) Chymotrypsin- and trypsin like activities. The assay was normalized to the total protein amount. Significance was determined by two-way ANOVA (*p≤0.05, **p≤0.01, ***p≤0.001) between cells grown under CR (0.5% glucose) conditions expressing vector control or SNCA in the presence or absence of bortezomib (Bort). (B) RPN4 mRNA relative expression levels as described in the legend of Figure 1. (C) UPS activity measured by monitoring the ubiquitin/proteasome-dependent proteolysis of the short-lived protein UBG76V-GFP. GFP was detected by Western blotting using a GFP-specific antibody. (D) Graphical representation of GFP/Pgk1 obtained by densitometric analysis. Statistical significance represented in (B) and (D) was determined by Student's t-test (*p≤0.05, **p≤0.01, ***p≤0.001) comparing caloric restricted vector control or SNCA-expressing cells in the presence or absence of Bort. (E) Chronological lifespan (CLS) and SNCA levels of pdr5Δ cells expressing SNCA grown under CR conditions, in the presence or absence of Bort. (F) Mean (50% survival) and maximum (10% survival) lifespans determined from curve fitting of the survival data from CLS. Significance was determined by two-way ANOVA (***p≤0.001) between cells grown under CR conditions expressing vector control or SNCA in the presence or absence of Bort. Autophagy flux assessed by the GFP-Atg8 processing assay (immunoblotting analysis with antibody against GFP) of caloric restricted cells expressing vector control (G) or SNCA (H) in the absence or presence of Bort. Blots represented in (G) are from the same gel, as in (H). (I) Densitometric analysis of the ratio between the free GFP versus the total GFP. Bands were quantified by Quantity One software. Significance of the data was determined by two-way ANOVA (**p≤0.01, ***p≤0.001, ****p≤0.0001) between cells grown under CR conditions expressing vector control or SNCA in the presence or absence of Bort. Data represents mean ± SEM of at least three biological independent replicas. The error bars represent the standard error of the mean (SEM).
Pharmacological inhibition of the ubiquitin-proteasome system activity decreases lifespan of α-synuclein (SNCA)-expressing cells grown under caloric restriction but has no major impact on autophagy. (A) Chymotrypsin- and trypsin like activities. The assay was normalized to the total protein amount. Significance was determined by two-way ANOVA (*p≤0.05, **p≤0.01, ***p≤0.001) between cells grown under CR (0.5% glucose) conditions expressing vector control or SNCA in the presence or absence of bortezomib (Bort). (B) RPN4 mRNA relative expression levels as described in the legend of Figure 1. (C) UPS activity measured by monitoring the ubiquitin/proteasome-dependent proteolysis of the short-lived protein UBG76V-GFP. GFP was detected by Western blotting using a GFP-specific antibody. (D) Graphical representation of GFP/Pgk1 obtained by densitometric analysis. Statistical significance represented in (B) and (D) was determined by Student's t-test (*p≤0.05, **p≤0.01, ***p≤0.001) comparing caloric restricted vector control or SNCA-expressing cells in the presence or absence of Bort. (E) Chronological lifespan (CLS) and SNCA levels of pdr5Δ cells expressing SNCA grown under CR conditions, in the presence or absence of Bort. (F) Mean (50% survival) and maximum (10% survival) lifespans determined from curve fitting of the survival data from CLS. Significance was determined by two-way ANOVA (***p≤0.001) between cells grown under CR conditions expressing vector control or SNCA in the presence or absence of Bort. Autophagy flux assessed by the GFP-Atg8 processing assay (immunoblotting analysis with antibody against GFP) of caloric restricted cells expressing vector control (G) or SNCA (H) in the absence or presence of Bort. Blots represented in (G) are from the same gel, as in (H). (I) Densitometric analysis of the ratio between the free GFP versus the total GFP. Bands were quantified by Quantity One software. Significance of the data was determined by two-way ANOVA (**p≤0.01, ***p≤0.001, ****p≤0.0001) between cells grown under CR conditions expressing vector control or SNCA in the presence or absence of Bort. Data represents mean ± SEM of at least three biological independent replicas. The error bars represent the standard error of the mean (SEM).Inhibition of UPS activity either with bortezomib (Fig. 3) or MG132 (data not shown) resulted in a shorter CLS, corresponding to decreased mean and maximum lifespans, of SNCA-expressing cells under CR conditions when compared to vector control expressing cells (Fig. 3E and 3F). These results indicate that UPS is also an important component of CR-mediated longevity. Autophagy was also evaluated in caloric restricted SNCA-expressing cells in the presence of proteasome inhibitors. Notably, the results obtained for autophagy, showed that proteasome inhibition has no major impact on autophagy flux in SNCA-expressing cells under CR conditions (Fig. 3G, 3H and 3I).UPS activity was also genetically inhibited by deletion of UMP1 or RPN4. UMP1 deletion causes incorrect assembly of the 20S proteasome and reduced ubiquitin-mediated proteolysis [36], while RPN4 is a transcriptional regulator of the 26S proteasome [37]. Both mutants were confirmed to have impaired UPS activity (data not shown). The comparison of the mean and maximum lifespans of RPN4 and UMP1 cells expressing vector control or SNCA with the correspondent wild type cells revealed that genetic abrogation of UPS activity reduces CR-mediated extension of CLS (Fig. 4A and 4B). These results are in agreement with the observations made with pharmacological inhibition of UPS (Figure 3), pointing, once again, UPS as a relevant factor of CR-mediated longevity. Regarding autophagy, the results showed that genetic inhibition of UPS activity, by abrogation of RPN4 or UMP1, does not have a major impact on autophagy flux of caloric restricted cells expressing SNCA (Fig. 4C, 4D and 4E), as the pharmacological inhibition of UPS activity (Fig. 3).
Figure 4
Genetic inhibition of the ubiquitin-proteasome system activity decreases lifespan of α-synuclein (SNCA)-expressing cells grown under caloric restriction conditions but has no major impact on autophagy. Mean (50% survival) and maximum (10% survival) lifespans determined from curve fitting of the survival data from CLS of caloric restricted vector control and SNCA expressing wild type cells compared with RPN4 (A) and UMP1 (B) deleted cells. (C) Autophagy flux assessed by the GFP-Atg8 processing assay (immunoblotting analysis with antibody against GFP) of wild type, rpn4Δ and ump1Δ caloric restricted cells expressing vector control or SNCA. Blots from same strain were run in the same gel. Densitometric analysis of the ratio between the free GFP versus the total GFP of rpn4Δ (D) and ump1Δ (E) cells. Data from wild type cells is repeated in (D) and (E) for easier interpretation. Bands were quantified by Quantity One software. (F) Mean and maximum lifespans determined from curve fitting of the survival data from CLS of wild type and cue5Δ cells expressing the vector control or SNCA in normal (2% glucose) or CR (0.5% glucose) growth conditions. (G) Mean and maximum lifespans determined from curve fitting of the survival data from CLS of wild type cells expressing the vector control or SNCA in the absence or presence of chloroquine (CQ). Significance was determined by Student's t-test (*p≤0.05, **p≤0.01, ***p≤0.001, ****p≤0.0001) comparing wild type with each mutant strain in the same conditions. For (G) the comparison was done between vector control or SNCA-expressing cells in the presence or absence of CQ. Data represents mean ± SEM of at least three biological independent replicas. The error bars represent the standard error of the mean (SEM).
Genetic inhibition of the ubiquitin-proteasome system activity decreases lifespan of α-synuclein (SNCA)-expressing cells grown under caloric restriction conditions but has no major impact on autophagy. Mean (50% survival) and maximum (10% survival) lifespans determined from curve fitting of the survival data from CLS of caloric restricted vector control and SNCA expressing wild type cells compared with RPN4 (A) and UMP1 (B) deleted cells. (C) Autophagy flux assessed by the GFP-Atg8 processing assay (immunoblotting analysis with antibody against GFP) of wild type, rpn4Δ and ump1Δ caloric restricted cells expressing vector control or SNCA. Blots from same strain were run in the same gel. Densitometric analysis of the ratio between the free GFP versus the total GFP of rpn4Δ (D) and ump1Δ (E) cells. Data from wild type cells is repeated in (D) and (E) for easier interpretation. Bands were quantified by Quantity One software. (F) Mean and maximum lifespans determined from curve fitting of the survival data from CLS of wild type and cue5Δ cells expressing the vector control or SNCA in normal (2% glucose) or CR (0.5% glucose) growth conditions. (G) Mean and maximum lifespans determined from curve fitting of the survival data from CLS of wild type cells expressing the vector control or SNCA in the absence or presence of chloroquine (CQ). Significance was determined by Student's t-test (*p≤0.05, **p≤0.01, ***p≤0.001, ****p≤0.0001) comparing wild type with each mutant strain in the same conditions. For (G) the comparison was done between vector control or SNCA-expressing cells in the presence or absence of CQ. Data represents mean ± SEM of at least three biological independent replicas. The error bars represent the standard error of the mean (SEM).Autophagy has an important role on the regulation of proteasome homeostasis by proteophagy, a mechanism dependent on the ubiquitin receptor Cue5, which recognizes inactivated ubiquitylated proteasomes [38]. To elucidate the role of proteophagy on the crosstalk between UPS and autophagy in caloric restricted SNCA-expressing cells, we have used CUE5 deleted cells. The CLS analysis of wild type and cue5Δ cells expressing SNCA revealed a significant increase of mean and maximum lifespans of cue5Δ cells (Fig. 4F). However, under CR conditions this effect was abrogate and no differences were observed between the mean and maximum lifespans of wild type and cue5Δ cells expressing SNCA (Fig. 4F). As previously described [38], cue5Δ cells display decreased autophagy flux (data not shown). The results obtained with cue5Δ and wild type cells treated with CQ and/or under CR conditions (Fig. 2, 4F and 4G), suggest that the maintenance of autophagy at homeostatic levels, both in normal growth or CR conditions, is beneficial for UPS activity and reduces SNCA toxicity.
DISCUSSION
Maintenance of proteostasis and “cleansing” of misfolded proteins is mainly promoted by two proteolytic systems: the ubiquitin-proteasome system (UPS) and lysosomal degradation pathways, particularly autophagy. During aging, both systems are target of extensive alterations culminating in loss of proteostasis that is further potentiated by the accumulation of proteins prone to aggregation such as SNCA [18].Caloric restriction (CR) is a powerful non-genetic manipulation known to extend lifespan in a number of aging models and is also known to delay or rescue toxicity in synucleinopathies models [19-25]. In spite of the recognized role of the UPS and autophagy proteolytic systems in the beneficial effects of CR, the crosstalk between them remains poorly understood. The data presented herein investigated this crosstalk by individually inhibiting both proteolytic systems in an aging cellular model for synucleinopathies. The results obtained indicate that CR-promoted beneficial effects on aged SNCA-expressing cells are dependent on both UPS and autophagy, in agreement with previous observations in other aging models [27-29,39,40]. The dependency of CR-mediated longevity on proteolytic systems is confirmed by data showing a shorter chronological lifespan when each of these proteolytic systems, UPS and autophagy, is inhibited. Importantly, crosstalk and coordinated regulation of UPS and autophagy are observed when autophagy is pharmacologically inhibited resulting in an increase of UPS functioning. Autophagy inhibition and CR-mediated enhancement of UPS in SNCA-expressing cells are associated with an increase of both chymotrypsin- and trypsin-like activities, while in the literature, a central role in the protein degradation by proteasome is assigned mainly to chymotrypsin-like activity [41,42].The coordinated regulation of UPS and autophagy seems to be required for protein homeostasis and consequently longevity extension [33,43,44]. The results presented show that pharmacological or genetic inhibition of proteosome in SNCA-expressing cells under CR was not compensated with enhancement of autophagy. This observation seems to contradict the literature showing that autophagy is stimulated to compensate for UPS inhibition [33,43,44]. In stationary phase yeast cells, proteasomes, mainly localized in the nucleus, are translocated to cytosol forming protective proteasome storage granules (PSGs) [45-49]. In yeast PSGs protect proteasomes from autophagic degradation upon carbon starvation [50]. During chronological aging, yeast cells expressing SNCA experience carbon starvation and also an impairment of UPS activity (Fig. 1). Thus, although dysfunctional proteasomes could be degraded by proteophagy [38], degradation is affected because chronological aged cells lack carbon source and thus form PSGs. Our results herein presented show that deletion of the proteophagy selective receptor CUE5 protects SNCA-expressing cells increasing CLS (Fig. 4F). In addition, CR does not have any effect on the CLS of cue5Δ cells expressing SNCA (Fig. 4F). Adding to these findings our previous observations on the impairment of UPS and the drastic increase of autophagy in aged SNCA-expressing cells [34], it is tempting to speculate that the protective effects of CR on SNCA-expressing cells are partially dependent on the inhibition of proteophagy and early protective formation of PSGs. This hypothesis needs further investigations.Overall, our data suggest that in proteotoxic stress conditions, the CR-mediated beneficial effects are associated with increased UPS activity accompanied by the maintenance of autophagy at homeostatic levels. Furthermore, although under CR conditions inhibition of each proteolytic activity leads to reduced longevity, the maintenance of autophagy at homeostatic levels appears to be the central pathway underlying rescue from SNCA-mediated toxicity.
MATERIALS AND METHODS
Strains and media
The yeast strains and plasmids used in this study are listed in Table 1. Cell stocks were maintained in YEPD agar medium containing 0.5% yeast extract, 1% peptone, 2% agar, and 2% glucose. All experiments were performed in synthetic complete (SC) medium containing glucose as a carbon source and 0.67% yeastnitrogen base without amino acids (Difco Laboratories) supplemented with excess amino acids and bases for which the strains were auxotrophic (50 μg/mL histidine, 50 μg/mL lysine, 100 μg/mL methionine, 300 μg/mL leucine and 100 μg/mL uracil).
Table 1
Strains and plasmids used in this study.
Yeast Strain
Genotype
Chronological lifespan assays
To perform the chronological lifespan (CLS) assays cells were grown on synthetic liquid media with 2% and 0.5% glucose for regular media and caloric restriction conditions, respectively. Overnight cultures were grown in SC medium containing the two different concentrations of glucose and then inoculated into flasks containing medium with the same concentration of glucose at a volume ratio of 1:3. These cultures were then incubated at 26 °C with shaking at 150 rpm. Cultures reached stationary phase 2-3 days later, and this was considered day 0 of CLS. Survival was assessed by counting colony-forming units (CFUs) after 2 days of incubation of culture aliquots at 26 °C on YEPD agar plates beginning at day 0 of CLS (when viability was considered to be 100%) and then again, every 2-3 days until less than 0.01% of the cells in the culture were viable.Mean (50% survival) and maximum (10% survival) lifespans were determined from curve fitting of the survival data (from pair-matched, pooled experiments) with the statistical software Prism (GraphPad Software).To block autophagy, 50 µg/µl chloroquine (CQ), or to inhibit UPS activity, 30 µM bortezomib or 50 µM MG132, were added to the culture medium at day 0 of CLS.
Total protein extraction and western blotting
For detection of protein levels by western blot, total cellular extracts were collected at specific time points and extracted as previously described [51]. Briefly, cells were pre-treated with 2 M lithium acetate for 5 min at room temperature. After lithium acetate removal, 0.4 M NaOH were added for 5 min on ice. Next, the cells were resuspended in SDS-PAGE sample buffer and boiled for 5 min. Total protein quantification was performed with the RC DC protein assay (Bio-Rad) and processed according to the manufacturer’s instructions. Of total protein, 20 μg were resolved on a 12% SDS gel and transferred to a nitrocellulose membrane during 7 min at 25V in Trans-Blot Turbo transfer system. Membranes were blocked with tris buffered saline (TBS) with 0.1% Tween 20 (TBST) containing 5% skim milk, followed by incubation with primary antibodies against: anti-SNCA (1:1000, Sigma); anti-GFP (1:5000; Abcam), anti-mono and polyubiquitination conjugated (1:1000; Enzo) and anti-PGK (1:5000; Invitrogen) in TBST containing 1% BSA and primary antibody. After washing with TBS, the membranes were incubated with the respective secondary antibody, HRP-conjugated anti-rabbit IgG, anti-mouse IgG or anti-goat IgG at a dilution of 1:5000 in 1% skim milk. Protein levels were detected after incubation with SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Scientific) or Clarity Western ECL Substrate (Bio-Rad). Digital images of the western blotting were obtained in a ChemiDoc XRS System (Bio-Rad) with Quantity One (Bio-Rad) software.
mRNA expression analysis by qRT-PCR
The quantitative mRNA expression analysis was performed according to the MIQE guidelines (Minimum information for publication of quantitative real-time PCR Experiments [52]). Briefly, quantitative real-time PCR (qPCR) was used to measure the mRNA transcripts of the RPN4 gene (FW: AAGGAAACCAGCAAAATCATC; RV: TTTCTAATGTGCCGTTTTCAT) and RPN5 gene (FW: TGGCATTTGGTGGAGAAGCT; RV: ATGTTTCCGTCTGGCTCTCC as described in [38]). Three reference genes (ACT1-actin (FW: GATCATTGCTCCTCCAGAA; RV: ACTTGTGGTGAACGATAGAT), PDA1-alpha subunit of pyruvate dehydrogenase (FW: TGACGAACAAGTTGAATTAGC; RV: TCTTAGGGTTGGAGTTTCTG) and TDH2-isoform 2 of glyceraldehyde-3-phosphate dehydrogenase (FW: CCGCTGAAGGTAAGTTGA; RV: CGAAGATGGAAGAGTTAGAGT)) were selected due to their stable expression and were tested in same experimental conditions allowing expression normalization.Yeast samples for qPCR quantification were centrifuged (4,500 rpm, 4°C, 5 min) and the pellets were immediately stored at -80°C until RNA extraction. The RNA extraction was carried out as previously described [52]. The RNA quality was assessed by agarose gel electrophoresis. Total RNA (300 ng) was reverse-transcribed into cDNA in a 20 μL reaction mixture using the iScript cDNA synthesis kit. Then, 22.5 ng of cDNA of each sample was tested in duplicate in a 96-well plate (Bio-Rad), in a 20 μL reaction mixture using the SsoFast Evagreen Supermix kit (Bio-Rad) and processed according to the manufacturer’s instructions in a CFX96™ Real Time System (Bio-Rad). A blank (no template control) was also incorporated in each assay. The thermocycling program consisted of one hold at 95°C for 1 min, followed by 39 cycles of 15 min at 95°C, 20 s at 57°C and 20 s at 72°C. After completion of these cycles, melting-curve data were collected to verify PCR specificity, contamination and the absence of primer dimers. The PCR efficiency of each primer pair was evaluated by the dilution series method using a mix of sample cDNAs as the template and was determined from calibration curves using the formula 10(-1/slope). Relative expression levels were determined with efficiency correction, which considers differences in the efficiencies between target and reference genes, using the gene expression module of the CFX manager Software (Bio-Rad).
Proteasome catalytic activity
“Proteasome-Glo TM Cell-Based Assays” (Promega) was used to measure the proteolytic activity of the UPS. This luminescent assay measures the chymotrypsin- and trypsin-like activities associated with the proteasome. Proteasome-Glo Cell-Based Reagents were both prepared and equilibrated at 22°C for 30 min before use. The luminescence was measured in a luminometer “Fluoroskan Ascent FL” by ThermoScientific. About 1x106 cells were plated in a 96-well opaque plate at a volume of 100 µl together with “Proteasom-Glo TM Cell-Based Assays” (100 µl). The assay plates were equilibrated at 22 °C, and after incubation during 5 to 30 min, a luminescent signal was obtained. Protein concentration was used to normalize proteasome activity.
Monitoring autophagy by GFP-Atg8 processing assay
To perform this assay, cells were transformed with the plasmid pRS416-GFPAtg8 with fusion gene under the control of the ATG8 endogenous promoter [53,54]. GFP N-terminally tagged to Atg8 is delivered to the vacuole and as GFP is more resistant to degradation than Atg8, bulk autophagy results in the accumulation of free GFP in the vacuole. The ratio between free GFP and total GFP is used as a readout for the autophagic flux. GFP-Atg8 and free GFP are detectable by Western blotting using a GFP-specific antibody (see section Total protein extraction and western blotting). The ratio between free GFP and total GFP is used as a readout for the autophagic flux. Immunoblot bands were quantified by densitometric analysis using the Quantity One software.
Statistical treatment of data
The results shown are mean values and standard error of the mean of at least three independent assays. Statistical analyses were determined using two-way ANOVA or Student's t-test as indicated in the figure legends. A p-value of less than 0.05 was considered as a significant difference.
Authors: Stephen A Bustin; Vladimir Benes; Jeremy A Garson; Jan Hellemans; Jim Huggett; Mikael Kubista; Reinhold Mueller; Tania Nolan; Michael W Pfaffl; Gregory L Shipley; Jo Vandesompele; Carl T Wittwer Journal: Clin Chem Date: 2009-02-26 Impact factor: 8.327
Authors: Daniel J Klionsky; Amal Kamal Abdel-Aziz; Sara Abdelfatah; Mahmoud Abdellatif; Asghar Abdoli; Steffen Abel; Hagai Abeliovich; Marie H Abildgaard; Yakubu Princely Abudu; Abraham Acevedo-Arozena; Iannis E Adamopoulos; Khosrow Adeli; Timon E Adolph; Annagrazia Adornetto; Elma Aflaki; Galila Agam; Anupam Agarwal; Bharat B Aggarwal; Maria Agnello; Patrizia Agostinis; Javed N Agrewala; Alexander Agrotis; Patricia V Aguilar; S Tariq Ahmad; Zubair M Ahmed; Ulises Ahumada-Castro; Sonja Aits; Shu Aizawa; Yunus Akkoc; Tonia Akoumianaki; Hafize Aysin Akpinar; Ahmed M Al-Abd; Lina Al-Akra; Abeer Al-Gharaibeh; Moulay A Alaoui-Jamali; Simon Alberti; Elísabet Alcocer-Gómez; Cristiano Alessandri; Muhammad Ali; M Abdul Alim Al-Bari; Saeb Aliwaini; Javad Alizadeh; Eugènia Almacellas; Alexandru Almasan; Alicia Alonso; Guillermo D Alonso; Nihal Altan-Bonnet; Dario C Altieri; Élida M C Álvarez; Sara Alves; Cristine Alves da Costa; Mazen M Alzaharna; Marialaura Amadio; Consuelo Amantini; Cristina Amaral; Susanna Ambrosio; Amal O Amer; Veena Ammanathan; Zhenyi An; Stig U Andersen; Shaida A Andrabi; Magaiver Andrade-Silva; Allen M Andres; Sabrina Angelini; David Ann; Uche C Anozie; Mohammad Y Ansari; Pedro Antas; Adam Antebi; Zuriñe Antón; Tahira Anwar; Lionel Apetoh; Nadezda Apostolova; Toshiyuki Araki; Yasuhiro Araki; Kohei Arasaki; Wagner L Araújo; Jun Araya; Catherine Arden; Maria-Angeles Arévalo; Sandro Arguelles; Esperanza Arias; Jyothi Arikkath; Hirokazu Arimoto; Aileen R Ariosa; Darius Armstrong-James; Laetitia Arnauné-Pelloquin; Angeles Aroca; Daniela S Arroyo; Ivica Arsov; Rubén Artero; Dalia Maria Lucia Asaro; Michael Aschner; Milad Ashrafizadeh; Osnat Ashur-Fabian; Atanas G Atanasov; Alicia K Au; Patrick Auberger; Holger W Auner; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Yenniffer Ávalos; Sanja Aveic; Célia Alexandra Aveleira; Tamar Avin-Wittenberg; Yucel Aydin; Scott Ayton; Srinivas Ayyadevara; Maria Azzopardi; Misuzu Baba; Jonathan M Backer; Steven K Backues; Dong-Hun Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Ahruem Baek; Seung-Hoon Baek; Sung Hee Baek; Giacinto Bagetta; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xiyuan Bai; Yidong Bai; Nandadulal Bairagi; Shounak Baksi; Teresa Balbi; Cosima T Baldari; Walter Balduini; Andrea Ballabio; Maria Ballester; Salma Balazadeh; Rena Balzan; Rina Bandopadhyay; Sreeparna Banerjee; Sulagna Banerjee; Ágnes Bánréti; Yan Bao; Mauricio S Baptista; Alessandra Baracca; Cristiana Barbati; Ariadna Bargiela; Daniela Barilà; Peter G Barlow; Sami J Barmada; Esther Barreiro; George E Barreto; Jiri Bartek; Bonnie Bartel; Alberto Bartolome; Gaurav R Barve; Suresh H Basagoudanavar; Diane C Bassham; Robert C Bast; Alakananda Basu; Henri Batoko; Isabella Batten; Etienne E Baulieu; Bradley L Baumgarner; Jagadeesh Bayry; Rupert Beale; Isabelle Beau; Florian Beaumatin; Luiz R G Bechara; George R Beck; Michael F Beers; Jakob Begun; Christian Behrends; Georg M N Behrens; Roberto Bei; Eloy Bejarano; Shai Bel; Christian Behl; Amine Belaid; Naïma Belgareh-Touzé; Cristina Bellarosa; Francesca Belleudi; Melissa Belló Pérez; Raquel Bello-Morales; Jackeline Soares de Oliveira Beltran; Sebastián Beltran; Doris Mangiaracina Benbrook; Mykolas Bendorius; Bruno A Benitez; Irene Benito-Cuesta; Julien Bensalem; Martin W Berchtold; Sabina Berezowska; Daniele Bergamaschi; Matteo Bergami; Andreas Bergmann; Laura Berliocchi; Clarisse Berlioz-Torrent; Amélie Bernard; Lionel Berthoux; Cagri G Besirli; Sebastien Besteiro; Virginie M Betin; Rudi Beyaert; Jelena S Bezbradica; Kiran Bhaskar; Ingrid Bhatia-Kissova; Resham Bhattacharya; Sujoy Bhattacharya; Shalmoli Bhattacharyya; Md Shenuarin Bhuiyan; Sujit Kumar Bhutia; Lanrong Bi; Xiaolin Bi; Trevor J Biden; Krikor Bijian; Viktor A Billes; Nadine Binart; Claudia Bincoletto; Asa B Birgisdottir; Geir Bjorkoy; Gonzalo Blanco; Ana Blas-Garcia; Janusz Blasiak; Robert Blomgran; Klas Blomgren; Janice S Blum; Emilio Boada-Romero; Mirta Boban; Kathleen Boesze-Battaglia; Philippe Boeuf; Barry Boland; Pascale Bomont; Paolo Bonaldo; Srinivasa Reddy Bonam; Laura Bonfili; Juan S Bonifacino; Brian A Boone; Martin D Bootman; Matteo Bordi; Christoph Borner; Beat C Bornhauser; Gautam Borthakur; Jürgen Bosch; Santanu Bose; Luis M Botana; Juan Botas; Chantal M Boulanger; Michael E Boulton; Mathieu Bourdenx; Benjamin Bourgeois; Nollaig M Bourke; Guilhem Bousquet; Patricia Boya; Peter V Bozhkov; Luiz H M Bozi; Tolga O Bozkurt; Doug E Brackney; Christian H Brandts; Ralf J Braun; Gerhard H Braus; Roberto Bravo-Sagua; José M Bravo-San Pedro; Patrick Brest; Marie-Agnès Bringer; Alfredo Briones-Herrera; V Courtney Broaddus; Peter Brodersen; Jeffrey L Brodsky; Steven L Brody; Paola G Bronson; Jeff M Bronstein; Carolyn N Brown; Rhoderick E Brown; Patricia C Brum; John H Brumell; Nicola Brunetti-Pierri; Daniele Bruno; Robert J Bryson-Richardson; Cecilia Bucci; Carmen Buchrieser; Marta Bueno; Laura Elisa Buitrago-Molina; Simone Buraschi; Shilpa Buch; J Ross Buchan; Erin M Buckingham; Hikmet Budak; Mauricio Budini; Geert Bultynck; Florin Burada; Joseph R Burgoyne; M Isabel Burón; Victor Bustos; Sabrina Büttner; Elena Butturini; Aaron Byrd; Isabel Cabas; Sandra Cabrera-Benitez; Ken Cadwell; Jingjing Cai; Lu Cai; Qian Cai; Montserrat Cairó; Jose A Calbet; Guy A Caldwell; Kim A Caldwell; Jarrod A Call; Riccardo Calvani; Ana C Calvo; Miguel Calvo-Rubio Barrera; Niels Os Camara; Jacques H Camonis; Nadine Camougrand; Michelangelo Campanella; Edward M Campbell; François-Xavier Campbell-Valois; Silvia Campello; Ilaria Campesi; Juliane C Campos; Olivier Camuzard; Jorge Cancino; Danilo Candido de Almeida; Laura Canesi; Isabella Caniggia; Barbara Canonico; Carles Cantí; Bin Cao; Michele Caraglia; Beatriz Caramés; Evie H Carchman; Elena Cardenal-Muñoz; Cesar Cardenas; Luis Cardenas; Sandra M Cardoso; Jennifer S Carew; Georges F Carle; Gillian Carleton; Silvia Carloni; Didac Carmona-Gutierrez; Leticia A Carneiro; Oliana Carnevali; Julian M Carosi; Serena Carra; Alice Carrier; Lucie Carrier; Bernadette Carroll; A Brent Carter; Andreia Neves Carvalho; Magali Casanova; Caty Casas; Josefina Casas; Chiara Cassioli; Eliseo F Castillo; Karen Castillo; Sonia Castillo-Lluva; Francesca Castoldi; Marco Castori; Ariel F Castro; Margarida Castro-Caldas; Javier Castro-Hernandez; Susana Castro-Obregon; Sergio D Catz; Claudia Cavadas; Federica Cavaliere; Gabriella Cavallini; Maria Cavinato; Maria L Cayuela; Paula Cebollada Rica; Valentina Cecarini; Francesco Cecconi; Marzanna Cechowska-Pasko; Simone Cenci; Victòria Ceperuelo-Mallafré; João J Cerqueira; Janete M Cerutti; Davide Cervia; Vildan Bozok Cetintas; Silvia Cetrullo; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Oishee Chakrabarti; Tapas Chakraborty; Trinad Chakraborty; Mounia Chami; Georgios Chamilos; David W Chan; Edmond Y W Chan; Edward D Chan; H Y Edwin Chan; Helen H Chan; Hung Chan; Matthew T V Chan; Yau Sang Chan; Partha K Chandra; Chih-Peng Chang; Chunmei Chang; Hao-Chun Chang; Kai Chang; Jie Chao; Tracey Chapman; Nicolas Charlet-Berguerand; Samrat Chatterjee; Shail K Chaube; Anu Chaudhary; Santosh Chauhan; Edward Chaum; Frédéric Checler; Michael E Cheetham; Chang-Shi Chen; Guang-Chao Chen; Jian-Fu Chen; Liam L Chen; Leilei Chen; Lin Chen; Mingliang Chen; Mu-Kuan Chen; Ning Chen; Quan Chen; Ruey-Hwa Chen; Shi Chen; Wei Chen; Weiqiang Chen; Xin-Ming Chen; Xiong-Wen Chen; Xu Chen; Yan Chen; Ye-Guang Chen; Yingyu Chen; Yongqiang Chen; Yu-Jen Chen; Yue-Qin Chen; Zhefan Stephen Chen; Zhi Chen; Zhi-Hua Chen; Zhijian J Chen; Zhixiang Chen; Hanhua Cheng; Jun Cheng; Shi-Yuan Cheng; Wei Cheng; Xiaodong Cheng; Xiu-Tang Cheng; Yiyun Cheng; Zhiyong Cheng; Zhong Chen; Heesun Cheong; Jit Kong Cheong; Boris V Chernyak; Sara Cherry; Chi Fai Randy Cheung; Chun Hei Antonio Cheung; King-Ho Cheung; Eric Chevet; Richard J Chi; Alan Kwok Shing Chiang; Ferdinando Chiaradonna; Roberto Chiarelli; Mario Chiariello; Nathalia Chica; Susanna Chiocca; Mario Chiong; Shih-Hwa Chiou; Abhilash I Chiramel; Valerio Chiurchiù; Dong-Hyung Cho; Seong-Kyu Choe; Augustine M K Choi; Mary E Choi; Kamalika Roy Choudhury; Norman S Chow; Charleen T Chu; Jason P Chua; John Jia En Chua; Hyewon Chung; Kin Pan Chung; Seockhoon Chung; So-Hyang Chung; Yuen-Li Chung; Valentina Cianfanelli; Iwona A Ciechomska; Mariana Cifuentes; Laura Cinque; Sebahattin Cirak; Mara Cirone; Michael J Clague; Robert Clarke; Emilio Clementi; Eliana M Coccia; Patrice Codogno; Ehud Cohen; Mickael M Cohen; Tania Colasanti; Fiorella Colasuonno; Robert A Colbert; Anna Colell; Miodrag Čolić; Nuria S Coll; Mark O Collins; María I Colombo; Daniel A Colón-Ramos; Lydie Combaret; Sergio Comincini; Márcia R Cominetti; Antonella Consiglio; Andrea Conte; Fabrizio Conti; Viorica Raluca Contu; Mark R Cookson; Kevin M Coombs; Isabelle Coppens; Maria Tiziana Corasaniti; Dale P Corkery; Nils Cordes; Katia Cortese; Maria do Carmo Costa; Sarah Costantino; Paola Costelli; Ana Coto-Montes; Peter J Crack; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Riccardo Cristofani; Tamas Csizmadia; Antonio Cuadrado; Bing Cui; Jun Cui; Yixian Cui; Yong Cui; Emmanuel Culetto; Andrea C Cumino; Andrey V Cybulsky; Mark J Czaja; Stanislaw J Czuczwar; Stefania D'Adamo; Marcello D'Amelio; Daniela D'Arcangelo; Andrew C D'Lugos; Gabriella D'Orazi; James A da Silva; Hormos Salimi Dafsari; Ruben K Dagda; Yasin Dagdas; Maria Daglia; Xiaoxia Dai; Yun Dai; Yuyuan Dai; Jessica Dal Col; Paul Dalhaimer; Luisa Dalla Valle; Tobias Dallenga; Guillaume Dalmasso; Markus Damme; Ilaria Dando; Nico P Dantuma; April L Darling; Hiranmoy Das; Srinivasan Dasarathy; Santosh K Dasari; Srikanta Dash; Oliver Daumke; Adrian N Dauphinee; Jeffrey S Davies; Valeria A Dávila; Roger J Davis; Tanja Davis; Sharadha Dayalan Naidu; Francesca De Amicis; Karolien De Bosscher; Francesca De Felice; Lucia De Franceschi; Chiara De Leonibus; Mayara G de Mattos Barbosa; Guido R Y De Meyer; Angelo De Milito; Cosimo De Nunzio; Clara De Palma; Mauro De Santi; Claudio De Virgilio; Daniela De Zio; Jayanta Debnath; Brian J DeBosch; Jean-Paul Decuypere; Mark A Deehan; Gianluca Deflorian; James DeGregori; Benjamin Dehay; Gabriel Del Rio; Joe R Delaney; Lea M D Delbridge; Elizabeth Delorme-Axford; M Victoria Delpino; Francesca Demarchi; Vilma Dembitz; Nicholas D Demers; Hongbin Deng; Zhiqiang Deng; Joern Dengjel; Paul Dent; Donna Denton; Melvin L DePamphilis; Channing J Der; Vojo Deretic; Albert Descoteaux; Laura Devis; Sushil Devkota; Olivier Devuyst; Grant Dewson; Mahendiran Dharmasivam; Rohan Dhiman; Diego di Bernardo; Manlio Di Cristina; Fabio Di Domenico; Pietro Di Fazio; Alessio Di Fonzo; Giovanni Di Guardo; Gianni M Di Guglielmo; Luca Di Leo; Chiara Di Malta; Alessia Di Nardo; Martina Di Rienzo; Federica Di Sano; George Diallinas; Jiajie Diao; Guillermo Diaz-Araya; Inés Díaz-Laviada; Jared M Dickinson; Marc Diederich; Mélanie Dieudé; Ivan Dikic; Shiping Ding; Wen-Xing Ding; Luciana Dini; Jelena Dinić; Miroslav Dinic; Albena T Dinkova-Kostova; Marc S Dionne; Jörg H W Distler; Abhinav Diwan; Ian M C Dixon; Mojgan Djavaheri-Mergny; Ina Dobrinski; Oxana Dobrovinskaya; Radek Dobrowolski; Renwick C J Dobson; Jelena Đokić; Serap Dokmeci Emre; Massimo Donadelli; Bo Dong; Xiaonan Dong; Zhiwu Dong; Gerald W Dorn Ii; Volker Dotsch; Huan Dou; Juan Dou; Moataz Dowaidar; Sami Dridi; Liat Drucker; Ailian Du; Caigan Du; Guangwei Du; Hai-Ning Du; Li-Lin Du; André du Toit; Shao-Bin Duan; Xiaoqiong Duan; Sónia P Duarte; Anna Dubrovska; Elaine A Dunlop; Nicolas Dupont; Raúl V Durán; Bilikere S Dwarakanath; Sergey A Dyshlovoy; Darius Ebrahimi-Fakhari; Leopold Eckhart; Charles L Edelstein; Thomas Efferth; Eftekhar Eftekharpour; Ludwig Eichinger; Nabil Eid; Tobias Eisenberg; N Tony Eissa; Sanaa Eissa; Miriam Ejarque; Abdeljabar El Andaloussi; Nazira El-Hage; Shahenda El-Naggar; Anna Maria Eleuteri; Eman S El-Shafey; Mohamed Elgendy; Aristides G Eliopoulos; María M Elizalde; Philip M Elks; Hans-Peter Elsasser; Eslam S Elsherbiny; Brooke M Emerling; N C Tolga Emre; Christina H Eng; Nikolai Engedal; Anna-Mart Engelbrecht; Agnete S T Engelsen; Jorrit M Enserink; Ricardo Escalante; Audrey Esclatine; Mafalda Escobar-Henriques; Eeva-Liisa Eskelinen; Lucile Espert; Makandjou-Ola Eusebio; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Francesco Facchiano; Bengt Fadeel; Claudio Fader; Alex C Faesen; W Douglas Fairlie; Alberto Falcó; Bjorn H Falkenburger; Daping Fan; Jie Fan; Yanbo Fan; Evandro F Fang; Yanshan Fang; Yognqi Fang; Manolis Fanto; Tamar Farfel-Becker; Mathias Faure; Gholamreza Fazeli; Anthony O Fedele; Arthur M Feldman; Du Feng; Jiachun Feng; Lifeng Feng; Yibin Feng; Yuchen Feng; Wei Feng; Thais Fenz Araujo; Thomas A Ferguson; Álvaro F Fernández; Jose C Fernandez-Checa; Sonia Fernández-Veledo; Alisdair R Fernie; Anthony W Ferrante; Alessandra Ferraresi; Merari F Ferrari; Julio C B Ferreira; Susan Ferro-Novick; Antonio Figueras; Riccardo Filadi; Nicoletta Filigheddu; Eduardo Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; Vittorio Fineschi; Francesca Finetti; Steven Finkbeiner; Edward A Fisher; Paul B Fisher; Flavio Flamigni; Steven J Fliesler; Trude H Flo; Ida Florance; Oliver Florey; Tullio Florio; Erika Fodor; Carlo Follo; Edward A Fon; Antonella Forlino; Francesco Fornai; Paola Fortini; Anna Fracassi; Alessandro Fraldi; Brunella Franco; Rodrigo Franco; Flavia Franconi; Lisa B Frankel; Scott L Friedman; Leopold F Fröhlich; Gema Frühbeck; Jose M Fuentes; Yukio Fujiki; Naonobu Fujita; Yuuki Fujiwara; Mitsunori Fukuda; Simone Fulda; Luc Furic; Norihiko Furuya; Carmela Fusco; Michaela U Gack; Lidia Gaffke; Sehamuddin Galadari; Alessia Galasso; Maria F Galindo; Sachith Gallolu Kankanamalage; Lorenzo Galluzzi; Vincent Galy; Noor Gammoh; Boyi Gan; Ian G Ganley; Feng Gao; Hui Gao; Minghui Gao; Ping Gao; Shou-Jiang Gao; Wentao Gao; Xiaobo Gao; Ana Garcera; Maria Noé Garcia; Verónica E Garcia; Francisco García-Del Portillo; Vega Garcia-Escudero; Aracely Garcia-Garcia; Marina Garcia-Macia; Diana García-Moreno; Carmen Garcia-Ruiz; Patricia García-Sanz; Abhishek D Garg; Ricardo Gargini; Tina Garofalo; Robert F Garry; Nils C Gassen; Damian Gatica; Liang Ge; Wanzhong Ge; Ruth Geiss-Friedlander; Cecilia Gelfi; Pascal Genschik; Ian E Gentle; Valeria Gerbino; Christoph Gerhardt; Kyla Germain; Marc Germain; David A Gewirtz; Elham Ghasemipour Afshar; Saeid Ghavami; Alessandra Ghigo; Manosij Ghosh; Georgios Giamas; Claudia Giampietri; Alexandra Giatromanolaki; Gary E Gibson; Spencer B Gibson; Vanessa Ginet; Edward Giniger; Carlotta Giorgi; Henrique Girao; Stephen E Girardin; Mridhula Giridharan; Sandy Giuliano; Cecilia Giulivi; Sylvie Giuriato; Julien Giustiniani; Alexander Gluschko; Veit Goder; Alexander Goginashvili; Jakub Golab; David C Goldstone; Anna Golebiewska; Luciana R Gomes; Rodrigo Gomez; Rubén Gómez-Sánchez; Maria Catalina Gomez-Puerto; Raquel Gomez-Sintes; Qingqiu Gong; Felix M Goni; Javier González-Gallego; Tomas Gonzalez-Hernandez; Rosa A Gonzalez-Polo; Jose A Gonzalez-Reyes; Patricia González-Rodríguez; Ing Swie Goping; Marina S Gorbatyuk; Nikolai V Gorbunov; Kıvanç Görgülü; Roxana M Gorojod; Sharon M Gorski; Sandro Goruppi; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Martin Graef; Markus H Gräler; Veronica Granatiero; Daniel Grasso; Joshua P Gray; Douglas R Green; Alexander Greenhough; Stephen L Gregory; Edward F Griffin; Mark W Grinstaff; Frederic Gros; Charles Grose; Angelina S Gross; Florian Gruber; Paolo Grumati; Tilman Grune; Xueyan Gu; Jun-Lin Guan; Carlos M Guardia; Kishore Guda; Flora Guerra; Consuelo Guerri; Prasun Guha; Carlos Guillén; Shashi Gujar; Anna Gukovskaya; Ilya Gukovsky; Jan Gunst; Andreas Günther; Anyonya R Guntur; Chuanyong Guo; Chun Guo; Hongqing Guo; Lian-Wang Guo; Ming Guo; Pawan Gupta; Shashi Kumar Gupta; Swapnil Gupta; Veer Bala Gupta; Vivek Gupta; Asa B Gustafsson; David D Gutterman; Ranjitha H B; Annakaisa Haapasalo; James E Haber; Aleksandra Hać; Shinji Hadano; Anders J Hafrén; Mansour Haidar; Belinda S Hall; Gunnel Halldén; Anne Hamacher-Brady; Andrea Hamann; Maho Hamasaki; Weidong Han; Malene Hansen; Phyllis I Hanson; Zijian Hao; Masaru Harada; Ljubica Harhaji-Trajkovic; Nirmala Hariharan; Nigil Haroon; James Harris; Takafumi Hasegawa; Noor Hasima Nagoor; Jeffrey A Haspel; Volker Haucke; Wayne D Hawkins; Bruce A Hay; Cole M Haynes; Soren B Hayrabedyan; Thomas S Hays; Congcong He; Qin He; Rong-Rong He; You-Wen He; Yu-Ying He; Yasser Heakal; Alexander M Heberle; J Fielding Hejtmancik; Gudmundur Vignir Helgason; Vanessa Henkel; Marc Herb; Alexander Hergovich; Anna Herman-Antosiewicz; Agustín Hernández; Carlos Hernandez; Sergio Hernandez-Diaz; Virginia Hernandez-Gea; Amaury Herpin; Judit Herreros; Javier H Hervás; Daniel Hesselson; Claudio Hetz; Volker T Heussler; Yujiro Higuchi; Sabine Hilfiker; Joseph A Hill; William S Hlavacek; Emmanuel A Ho; Idy H T Ho; Philip Wing-Lok Ho; Shu-Leong Ho; Wan Yun Ho; G Aaron Hobbs; Mark Hochstrasser; Peter H M Hoet; Daniel Hofius; Paul Hofman; Annika Höhn; Carina I Holmberg; Jose R Hombrebueno; Chang-Won Hong Yi-Ren Hong; Lora V Hooper; Thorsten Hoppe; Rastislav Horos; Yujin Hoshida; I-Lun Hsin; Hsin-Yun Hsu; Bing Hu; Dong Hu; Li-Fang Hu; Ming Chang Hu; Ronggui Hu; Wei Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Jinlian Hua; Yingqi Hua; Chongmin Huan; Canhua Huang; Chuanshu Huang; Chuanxin Huang; Chunling Huang; Haishan Huang; Kun Huang; Michael L H Huang; Rui Huang; Shan Huang; Tianzhi Huang; Xing Huang; Yuxiang Jack Huang; Tobias B Huber; Virginie Hubert; Christian A Hubner; Stephanie M Hughes; William E Hughes; Magali Humbert; Gerhard Hummer; James H Hurley; Sabah Hussain; Salik Hussain; Patrick J Hussey; Martina Hutabarat; Hui-Yun Hwang; Seungmin Hwang; Antonio Ieni; Fumiyo Ikeda; Yusuke Imagawa; Yuzuru Imai; Carol Imbriano; Masaya Imoto; Denise M Inman; Ken Inoki; Juan Iovanna; Renato V Iozzo; Giuseppe Ippolito; Javier E Irazoqui; Pablo Iribarren; Mohd Ishaq; Makoto Ishikawa; Nestor Ishimwe; Ciro Isidoro; Nahed Ismail; Shohreh Issazadeh-Navikas; Eisuke Itakura; Daisuke Ito; Davor Ivankovic; Saška Ivanova; Anand Krishnan V Iyer; José M Izquierdo; Masanori Izumi; Marja Jäättelä; Majid Sakhi Jabir; William T Jackson; Nadia Jacobo-Herrera; Anne-Claire Jacomin; Elise Jacquin; Pooja Jadiya; Hartmut Jaeschke; Chinnaswamy Jagannath; Arjen J Jakobi; Johan Jakobsson; Bassam Janji; Pidder Jansen-Dürr; Patric J Jansson; Jonathan Jantsch; Sławomir Januszewski; Alagie Jassey; Steve Jean; Hélène Jeltsch-David; Pavla Jendelova; Andreas Jenny; Thomas E Jensen; Niels Jessen; Jenna L Jewell; Jing Ji; Lijun Jia; Rui Jia; Liwen Jiang; Qing Jiang; Richeng Jiang; Teng Jiang; Xuejun Jiang; Yu Jiang; Maria Jimenez-Sanchez; Eun-Jung Jin; Fengyan Jin; Hongchuan Jin; Li Jin; Luqi Jin; Meiyan Jin; Si Jin; Eun-Kyeong Jo; Carine Joffre; Terje Johansen; Gail V W Johnson; Simon A Johnston; Eija Jokitalo; Mohit Kumar Jolly; Leo A B Joosten; Joaquin Jordan; Bertrand Joseph; Dianwen Ju; Jeong-Sun Ju; Jingfang Ju; Esmeralda Juárez; Delphine Judith; Gábor Juhász; Youngsoo Jun; Chang Hwa Jung; Sung-Chul Jung; Yong Keun Jung; Heinz Jungbluth; Johannes Jungverdorben; Steffen Just; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Daniel Kaganovich; Alon Kahana; Renate Kain; Shinjo Kajimura; Maria Kalamvoki; Manjula Kalia; Danuta S Kalinowski; Nina Kaludercic; Ioanna Kalvari; Joanna Kaminska; Vitaliy O Kaminskyy; Hiromitsu Kanamori; Keizo Kanasaki; Chanhee Kang; Rui Kang; Sang Sun Kang; Senthilvelrajan Kaniyappan; Tomotake Kanki; Thirumala-Devi Kanneganti; Anumantha G Kanthasamy; Arthi Kanthasamy; Marc Kantorow; Orsolya Kapuy; Michalis V Karamouzis; Md Razaul Karim; Parimal Karmakar; Rajesh G Katare; Masaru Kato; Stefan H E Kaufmann; Anu Kauppinen; Gur P Kaushal; Susmita Kaushik; Kiyoshi Kawasaki; Kemal Kazan; Po-Yuan Ke; Damien J Keating; Ursula Keber; John H Kehrl; Kate E Keller; Christian W Keller; Jongsook Kim Kemper; Candia M Kenific; Oliver Kepp; Stephanie Kermorgant; Andreas Kern; Robin Ketteler; Tom G Keulers; Boris Khalfin; Hany Khalil; Bilon Khambu; Shahid Y Khan; Vinoth Kumar Megraj Khandelwal; Rekha Khandia; Widuri Kho; Noopur V Khobrekar; Sataree Khuansuwan; Mukhran Khundadze; Samuel A Killackey; Dasol Kim; Deok Ryong Kim; Do-Hyung Kim; Dong-Eun Kim; Eun Young Kim; Eun-Kyoung Kim; Hak-Rim Kim; Hee-Sik Kim; Jeong Hun Kim; Jin Kyung Kim; Jin-Hoi Kim; Joungmok Kim; Ju Hwan Kim; Keun Il Kim; Peter K Kim; Seong-Jun Kim; Scot R Kimball; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Matthew A King; Kerri J Kinghorn; Conan G Kinsey; Vladimir Kirkin; Lorrie A Kirshenbaum; Sergey L Kiselev; Shuji Kishi; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Richard N Kitsis; Josef T Kittler; Ole Kjaerulff; Peter S Klein; Thomas Klopstock; Jochen Klucken; Helene Knævelsrud; Roland L Knorr; Ben C B Ko; Fred Ko; Jiunn-Liang Ko; Hotaka Kobayashi; Satoru Kobayashi; Ina Koch; Jan C Koch; Ulrich Koenig; Donat Kögel; Young Ho Koh; Masato Koike; Sepp D Kohlwein; Nur M Kocaturk; Masaaki Komatsu; Jeannette König; Toru Kono; Benjamin T Kopp; Tamas Korcsmaros; Gözde Korkmaz; Viktor I Korolchuk; Mónica Suárez Korsnes; Ali Koskela; Janaiah Kota; Yaichiro Kotake; Monica L Kotler; Yanjun Kou; Michael I Koukourakis; Evangelos Koustas; Attila L Kovacs; Tibor Kovács; Daisuke Koya; Tomohiro Kozako; Claudine Kraft; Dimitri Krainc; Helmut Krämer; Anna D Krasnodembskaya; Carole Kretz-Remy; Guido Kroemer; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Sabine Kuenen; Lars Kuerschner; Thomas Kukar; Ajay Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Sharad Kumar; Shinji Kume; Caroline Kumsta; Chanakya N Kundu; Mondira Kundu; Ajaikumar B Kunnumakkara; Lukasz Kurgan; Tatiana G Kutateladze; Ozlem Kutlu; SeongAe Kwak; Ho Jeong Kwon; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert La Spada; Patrick Labonté; Sylvain Ladoire; Ilaria Laface; Frank Lafont; Diane C Lagace; Vikramjit Lahiri; Zhibing Lai; Angela S Laird; Aparna Lakkaraju; Trond Lamark; Sheng-Hui Lan; Ane Landajuela; Darius J R Lane; Jon D Lane; Charles H Lang; Carsten Lange; Ülo Langel; Rupert Langer; Pierre Lapaquette; Jocelyn Laporte; Nicholas F LaRusso; Isabel Lastres-Becker; Wilson Chun Yu Lau; Gordon W Laurie; Sergio Lavandero; Betty Yuen Kwan Law; Helen Ka-Wai Law; Rob Layfield; Weidong Le; Herve Le Stunff; Alexandre Y Leary; Jean-Jacques Lebrun; Lionel Y W Leck; Jean-Philippe Leduc-Gaudet; Changwook Lee; Chung-Pei Lee; Da-Hye Lee; Edward B Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Heung Kyu Lee; Jae Man Lee; Jason S Lee; Jin-A Lee; Joo-Yong Lee; Jun Hee Lee; Michael Lee; Min Goo Lee; Min Jae Lee; Myung-Shik Lee; Sang Yoon Lee; Seung-Jae Lee; Stella Y Lee; Sung Bae Lee; Won Hee Lee; Ying-Ray Lee; Yong-Ho Lee; Youngil Lee; Christophe Lefebvre; Renaud Legouis; Yu L Lei; Yuchen Lei; Sergey Leikin; Gerd Leitinger; Leticia Lemus; Shuilong Leng; Olivia Lenoir; Guido Lenz; Heinz Josef Lenz; Paola Lenzi; Yolanda León; Andréia M Leopoldino; Christoph Leschczyk; Stina Leskelä; Elisabeth Letellier; Chi-Ting Leung; Po Sing Leung; Jeremy S Leventhal; Beth Levine; Patrick A Lewis; Klaus Ley; Bin Li; Da-Qiang Li; Jianming Li; Jing Li; Jiong Li; Ke Li; Liwu Li; Mei Li; Min Li; Min Li; Ming Li; Mingchuan Li; Pin-Lan Li; Ming-Qing Li; Qing Li; Sheng Li; Tiangang Li; Wei Li; Wenming Li; Xue Li; Yi-Ping Li; Yuan Li; Zhiqiang Li; Zhiyong Li; Zhiyuan Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Weicheng Liang; Yongheng Liang; YongTian Liang; Guanghong Liao; Lujian Liao; Mingzhi Liao; Yung-Feng Liao; Mariangela Librizzi; Pearl P Y Lie; Mary A Lilly; Hyunjung J Lim; Thania R R Lima; Federica Limana; Chao Lin; Chih-Wen Lin; Dar-Shong Lin; Fu-Cheng Lin; Jiandie D Lin; Kurt M Lin; Kwang-Huei Lin; Liang-Tzung Lin; Pei-Hui Lin; Qiong Lin; Shaofeng Lin; Su-Ju Lin; Wenyu Lin; Xueying Lin; Yao-Xin Lin; Yee-Shin Lin; Rafael Linden; Paula Lindner; Shuo-Chien Ling; Paul Lingor; Amelia K Linnemann; Yih-Cherng Liou; Marta M Lipinski; Saška Lipovšek; Vitor A Lira; Natalia Lisiak; Paloma B Liton; Chao Liu; Ching-Hsuan Liu; Chun-Feng Liu; Cui Hua Liu; Fang Liu; Hao Liu; Hsiao-Sheng Liu; Hua-Feng Liu; Huifang Liu; Jia Liu; Jing Liu; Julia Liu; Leyuan Liu; Longhua Liu; Meilian Liu; Qin Liu; Wei Liu; Wende Liu; Xiao-Hong Liu; Xiaodong Liu; Xingguo Liu; Xu Liu; Xuedong Liu; Yanfen Liu; Yang Liu; Yang Liu; Yueyang Liu; Yule Liu; J Andrew Livingston; Gerard Lizard; Jose M Lizcano; Senka Ljubojevic-Holzer; Matilde E LLeonart; David Llobet-Navàs; Alicia Llorente; Chih Hung Lo; Damián Lobato-Márquez; Qi Long; Yun Chau Long; Ben Loos; Julia A Loos; Manuela G López; Guillermo López-Doménech; José Antonio López-Guerrero; Ana T López-Jiménez; Óscar López-Pérez; Israel López-Valero; Magdalena J Lorenowicz; Mar Lorente; Peter Lorincz; Laura Lossi; Sophie Lotersztajn; Penny E Lovat; Jonathan F Lovell; Alenka Lovy; Péter Lőw; Guang Lu; Haocheng Lu; Jia-Hong Lu; Jin-Jian Lu; Mengji Lu; Shuyan Lu; Alessandro Luciani; John M Lucocq; Paula Ludovico; Micah A Luftig; Morten Luhr; Diego Luis-Ravelo; Julian J Lum; Liany Luna-Dulcey; Anders H Lund; Viktor K Lund; Jan D Lünemann; Patrick Lüningschrör; Honglin Luo; Rongcan Luo; Shouqing Luo; Zhi Luo; Claudio Luparello; Bernhard Lüscher; Luan Luu; Alex Lyakhovich; Konstantin G Lyamzaev; Alf Håkon Lystad; Lyubomyr Lytvynchuk; Alvin C Ma; Changle Ma; Mengxiao Ma; Ning-Fang Ma; Quan-Hong Ma; Xinliang Ma; Yueyun Ma; Zhenyi Ma; Ormond A MacDougald; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; Sandra Maday; Frank Madeo; Muniswamy Madesh; Tobias Madl; Julio Madrigal-Matute; Akiko Maeda; Yasuhiro Maejima; Marta Magarinos; Poornima Mahavadi; Emiliano Maiani; Kenneth Maiese; Panchanan Maiti; Maria Chiara Maiuri; Barbara Majello; Michael B Major; Elena Makareeva; Fayaz Malik; Karthik Mallilankaraman; Walter Malorni; Alina Maloyan; Najiba Mammadova; Gene Chi Wai Man; Federico Manai; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Masoud H Manjili; Ravi Manjithaya; Patricio Manque; Bella B Manshian; Raquel Manzano; Claudia Manzoni; Kai Mao; Cinzia Marchese; Sandrine Marchetti; Anna Maria Marconi; Fabrizio Marcucci; Stefania Mardente; Olga A Mareninova; Marta Margeta; Muriel Mari; Sara Marinelli; Oliviero Marinelli; Guillermo Mariño; Sofia Mariotto; Richard S Marshall; Mark R Marten; Sascha Martens; Alexandre P J Martin; Katie R Martin; Sara Martin; Shaun Martin; Adrián Martín-Segura; Miguel A Martín-Acebes; Inmaculada Martin-Burriel; Marcos Martin-Rincon; Paloma Martin-Sanz; José A Martina; Wim Martinet; Aitor Martinez; Ana Martinez; Jennifer Martinez; Moises Martinez Velazquez; Nuria Martinez-Lopez; Marta Martinez-Vicente; Daniel O Martins; Joilson O Martins; Waleska K Martins; Tania Martins-Marques; Emanuele Marzetti; Shashank Masaldan; Celine Masclaux-Daubresse; Douglas G Mashek; Valentina Massa; Lourdes Massieu; Glenn R Masson; Laura Masuelli; Anatoliy I Masyuk; Tetyana V Masyuk; Paola Matarrese; Ander Matheu; Satoaki Matoba; Sachiko Matsuzaki; Pamela Mattar; Alessandro Matte; Domenico Mattoscio; José L Mauriz; Mario Mauthe; Caroline Mauvezin; Emanual Maverakis; Paola Maycotte; Johanna Mayer; Gianluigi Mazzoccoli; Cristina Mazzoni; Joseph R Mazzulli; Nami McCarty; Christine McDonald; Mitchell R McGill; Sharon L McKenna; BethAnn McLaughlin; Fionn McLoughlin; Mark A McNiven; Thomas G McWilliams; Fatima Mechta-Grigoriou; Tania Catarina Medeiros; Diego L Medina; Lynn A Megeney; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Alfred J Meijer; Annemarie H Meijer; Jakob Mejlvang; Alicia Meléndez; Annette Melk; Gonen Memisoglu; Alexandrina F Mendes; Delong Meng; Fei Meng; Tian Meng; Rubem Menna-Barreto; Manoj B Menon; Carol Mercer; Anne E Mercier; Jean-Louis Mergny; Adalberto Merighi; Seth D Merkley; Giuseppe Merla; Volker Meske; Ana Cecilia Mestre; Shree Padma Metur; Christian Meyer; Hemmo Meyer; Wenyi Mi; Jeanne Mialet-Perez; Junying Miao; Lucia Micale; Yasuo Miki; Enrico Milan; Małgorzata Milczarek; Dana L Miller; Samuel I Miller; Silke Miller; Steven W Millward; Ira Milosevic; Elena A Minina; Hamed Mirzaei; Hamid Reza Mirzaei; Mehdi Mirzaei; Amit Mishra; Nandita Mishra; Paras Kumar Mishra; Maja Misirkic Marjanovic; Roberta Misasi; Amit Misra; Gabriella Misso; Claire Mitchell; Geraldine Mitou; Tetsuji Miura; Shigeki Miyamoto; Makoto Miyazaki; Mitsunori Miyazaki; Taiga Miyazaki; Keisuke Miyazawa; Noboru Mizushima; Trine H Mogensen; Baharia Mograbi; Reza Mohammadinejad; Yasir Mohamud; Abhishek Mohanty; Sipra Mohapatra; Torsten Möhlmann; Asif Mohmmed; Anna Moles; Kelle H Moley; Maurizio Molinari; Vincenzo Mollace; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Costanza Montagna; Mervyn J Monteiro; Andrea Montella; L Ruth Montes; Barbara Montico; Vinod K Mony; Giacomo Monzio Compagnoni; Michael N Moore; Mohammad A Moosavi; Ana L Mora; Marina Mora; David Morales-Alamo; Rosario Moratalla; Paula I Moreira; Elena Morelli; Sandra Moreno; Daniel Moreno-Blas; Viviana Moresi; Benjamin Morga; Alwena H Morgan; Fabrice Morin; Hideaki Morishita; Orson L Moritz; Mariko Moriyama; Yuji Moriyasu; Manuela Morleo; Eugenia Morselli; Jose F Moruno-Manchon; Jorge Moscat; Serge Mostowy; Elisa Motori; Andrea Felinto Moura; Naima Moustaid-Moussa; Maria Mrakovcic; Gabriel Muciño-Hernández; Anupam Mukherjee; Subhadip Mukhopadhyay; Jean M Mulcahy Levy; Victoriano Mulero; Sylviane Muller; Christian Münch; Ashok Munjal; Pura Munoz-Canoves; Teresa Muñoz-Galdeano; Christian Münz; Tomokazu Murakawa; Claudia Muratori; Brona M Murphy; J Patrick Murphy; Aditya Murthy; Timo T Myöhänen; Indira U Mysorekar; Jennifer Mytych; Seyed Mohammad Nabavi; Massimo Nabissi; Péter Nagy; Jihoon Nah; Aimable Nahimana; Ichiro Nakagawa; Ken Nakamura; Hitoshi Nakatogawa; Shyam S Nandi; Meera Nanjundan; Monica Nanni; Gennaro Napolitano; Roberta Nardacci; Masashi Narita; Melissa Nassif; Ilana Nathan; Manabu Natsumeda; Ryno J Naude; Christin Naumann; Olaia Naveiras; Fatemeh Navid; Steffan T Nawrocki; Taras Y Nazarko; Francesca Nazio; Florentina Negoita; Thomas Neill; Amanda L Neisch; Luca M Neri; Mihai G Netea; Patrick Neubert; Thomas P Neufeld; Dietbert Neumann; Albert Neutzner; Phillip T Newton; Paul A Ney; Ioannis P Nezis; Charlene C W Ng; Tzi Bun Ng; Hang T T Nguyen; Long T Nguyen; Hong-Min Ni; Clíona Ní Cheallaigh; Zhenhong Ni; M Celeste Nicolao; Francesco Nicoli; Manuel Nieto-Diaz; Per Nilsson; Shunbin Ning; Rituraj Niranjan; Hiroshi Nishimune; Mireia Niso-Santano; Ralph A Nixon; Annalisa Nobili; Clevio Nobrega; Takeshi Noda; Uxía Nogueira-Recalde; Trevor M Nolan; Ivan Nombela; Ivana Novak; Beatriz Novoa; Takashi Nozawa; Nobuyuki Nukina; Carmen Nussbaum-Krammer; Jesper Nylandsted; Tracey R O'Donovan; Seónadh M O'Leary; Eyleen J O'Rourke; Mary P O'Sullivan; Timothy E O'Sullivan; Salvatore Oddo; Ina Oehme; Michinaga Ogawa; Eric Ogier-Denis; Margret H Ogmundsdottir; Besim Ogretmen; Goo Taeg Oh; Seon-Hee Oh; Young J Oh; Takashi Ohama; Yohei Ohashi; Masaki Ohmuraya; Vasileios Oikonomou; Rani Ojha; Koji Okamoto; Hitoshi Okazawa; Masahide Oku; Sara Oliván; Jorge M A Oliveira; Michael Ollmann; James A Olzmann; Shakib Omari; M Bishr Omary; Gizem Önal; Martin Ondrej; Sang-Bing Ong; Sang-Ging Ong; Anna Onnis; Juan A Orellana; Sara Orellana-Muñoz; Maria Del Mar Ortega-Villaizan; Xilma R Ortiz-Gonzalez; Elena Ortona; Heinz D Osiewacz; Abdel-Hamid K Osman; Rosario Osta; Marisa S Otegui; Kinya Otsu; Christiane Ott; Luisa Ottobrini; Jing-Hsiung James Ou; Tiago F Outeiro; Inger Oynebraten; Melek Ozturk; Gilles Pagès; Susanta Pahari; Marta Pajares; Utpal B Pajvani; Rituraj Pal; Simona Paladino; Nicolas Pallet; Michela Palmieri; Giuseppe Palmisano; Camilla Palumbo; Francesco Pampaloni; Lifeng Pan; Qingjun Pan; Wenliang Pan; Xin Pan; Ganna Panasyuk; Rahul Pandey; Udai B Pandey; Vrajesh Pandya; Francesco Paneni; Shirley Y Pang; Elisa Panzarini; Daniela L Papademetrio; Elena Papaleo; Daniel Papinski; Diana Papp; Eun Chan Park; Hwan Tae Park; Ji-Man Park; Jong-In Park; Joon Tae Park; Junsoo Park; Sang Chul Park; Sang-Youel Park; Abraham H Parola; Jan B Parys; Adrien Pasquier; Benoit Pasquier; João F Passos; Nunzia Pastore; Hemal H Patel; Daniel Patschan; Sophie Pattingre; Gustavo Pedraza-Alva; Jose Pedraza-Chaverri; Zully Pedrozo; Gang Pei; Jianming Pei; Hadas Peled-Zehavi; Joaquín M Pellegrini; Joffrey Pelletier; Miguel A Peñalva; Di Peng; Ying Peng; Fabio Penna; Maria Pennuto; Francesca Pentimalli; Cláudia Mf Pereira; Gustavo J S Pereira; Lilian C Pereira; Luis Pereira de Almeida; Nirma D Perera; Ángel Pérez-Lara; Ana B Perez-Oliva; María Esther Pérez-Pérez; Palsamy Periyasamy; Andras Perl; Cristiana Perrotta; Ida Perrotta; Richard G Pestell; Morten Petersen; Irina Petrache; Goran Petrovski; Thorsten Pfirrmann; Astrid S Pfister; Jennifer A Philips; Huifeng Pi; Anna Picca; Alicia M Pickrell; Sandy Picot; Giovanna M Pierantoni; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Karolina Pierzynowska; Federico Pietrocola; Miroslawa Pietruczuk; Claudio Pignata; Felipe X Pimentel-Muiños; Mario Pinar; Roberta O Pinheiro; Ronit Pinkas-Kramarski; Paolo Pinton; Karolina Pircs; Sujan Piya; Paola Pizzo; Theo S Plantinga; Harald W Platta; Ainhoa Plaza-Zabala; Markus Plomann; Egor Y Plotnikov; Helene Plun-Favreau; Ryszard Pluta; Roger Pocock; Stefanie Pöggeler; Christian Pohl; Marc Poirot; Angelo Poletti; Marisa Ponpuak; Hana Popelka; Blagovesta Popova; Helena Porta; Soledad Porte Alcon; Eliana Portilla-Fernandez; Martin Post; Malia B Potts; Joanna Poulton; Ted Powers; Veena Prahlad; Tomasz K Prajsnar; Domenico Praticò; Rosaria Prencipe; Muriel Priault; Tassula Proikas-Cezanne; Vasilis J Promponas; Christopher G Proud; Rosa Puertollano; Luigi Puglielli; Thomas Pulinilkunnil; Deepika Puri; Rajat Puri; Julien Puyal; Xiaopeng Qi; Yongmei Qi; Wenbin Qian; Lei Qiang; Yu Qiu; Joe Quadrilatero; Jorge Quarleri; Nina Raben; Hannah Rabinowich; Debora Ragona; Michael J Ragusa; Nader Rahimi; Marveh Rahmati; Valeria Raia; Nuno Raimundo; Namakkal-Soorappan Rajasekaran; Sriganesh Ramachandra Rao; Abdelhaq Rami; Ignacio Ramírez-Pardo; David B Ramsden; Felix Randow; Pundi N Rangarajan; Danilo Ranieri; Hai Rao; Lang Rao; Rekha Rao; Sumit Rathore; J Arjuna Ratnayaka; Edward A Ratovitski; Palaniyandi Ravanan; Gloria Ravegnini; Swapan K Ray; Babak Razani; Vito Rebecca; Fulvio Reggiori; Anne Régnier-Vigouroux; Andreas S Reichert; David Reigada; Jan H Reiling; Theo Rein; Siegfried Reipert; Rokeya Sultana Rekha; Hongmei Ren; Jun Ren; Weichao Ren; Tristan Renault; Giorgia Renga; Karen Reue; Kim Rewitz; Bruna Ribeiro de Andrade Ramos; S Amer Riazuddin; Teresa M Ribeiro-Rodrigues; Jean-Ehrland Ricci; Romeo Ricci; Victoria Riccio; Des R Richardson; Yasuko Rikihisa; Makarand V Risbud; Ruth M Risueño; Konstantinos Ritis; Salvatore Rizza; Rosario Rizzuto; Helen C Roberts; Luke D Roberts; Katherine J Robinson; Maria Carmela Roccheri; Stephane Rocchi; George G Rodney; Tiago Rodrigues; Vagner Ramon Rodrigues Silva; Amaia Rodriguez; Ruth Rodriguez-Barrueco; Nieves Rodriguez-Henche; Humberto Rodriguez-Rocha; Jeroen Roelofs; Robert S Rogers; Vladimir V Rogov; Ana I Rojo; Krzysztof Rolka; Vanina Romanello; Luigina Romani; Alessandra Romano; Patricia S Romano; David Romeo-Guitart; Luis C Romero; Montserrat Romero; Joseph C Roney; Christopher Rongo; Sante Roperto; Mathias T Rosenfeldt; Philip Rosenstiel; Anne G Rosenwald; Kevin A Roth; Lynn Roth; Steven Roth; Kasper M A Rouschop; Benoit D Roussel; Sophie Roux; Patrizia Rovere-Querini; Ajit Roy; Aurore Rozieres; Diego Ruano; David C Rubinsztein; Maria P Rubtsova; Klaus Ruckdeschel; Christoph Ruckenstuhl; Emil Rudolf; Rüdiger Rudolf; Alessandra Ruggieri; Avnika Ashok Ruparelia; Paola Rusmini; Ryan R Russell; Gian Luigi Russo; Maria Russo; Rossella Russo; Oxana O Ryabaya; Kevin M Ryan; Kwon-Yul Ryu; Maria Sabater-Arcis; Ulka Sachdev; Michael Sacher; Carsten Sachse; Abhishek Sadhu; Junichi Sadoshima; Nathaniel Safren; Paul Saftig; Antonia P Sagona; Gaurav Sahay; Amirhossein Sahebkar; Mustafa Sahin; Ozgur Sahin; Sumit Sahni; Nayuta Saito; Shigeru Saito; Tsunenori Saito; Ryohei Sakai; Yasuyoshi Sakai; Jun-Ichi Sakamaki; Kalle Saksela; Gloria Salazar; Anna Salazar-Degracia; Ghasem H Salekdeh; Ashok K Saluja; Belém Sampaio-Marques; Maria Cecilia Sanchez; Jose A Sanchez-Alcazar; Victoria Sanchez-Vera; Vanessa Sancho-Shimizu; J Thomas Sanderson; Marco Sandri; Stefano Santaguida; Laura Santambrogio; Magda M Santana; Giorgio Santoni; Alberto Sanz; Pascual Sanz; Shweta Saran; Marco Sardiello; Timothy J Sargeant; Apurva Sarin; Chinmoy Sarkar; Sovan Sarkar; Maria-Rosa Sarrias; Surajit Sarkar; Dipanka Tanu Sarmah; Jaakko Sarparanta; Aishwarya Sathyanarayan; Ranganayaki Sathyanarayanan; K Matthew Scaglione; Francesca Scatozza; Liliana Schaefer; Zachary T Schafer; Ulrich E Schaible; Anthony H V Schapira; Michael Scharl; Hermann M Schatzl; Catherine H Schein; Wiep Scheper; David Scheuring; Maria Vittoria Schiaffino; Monica Schiappacassi; Rainer Schindl; Uwe Schlattner; Oliver Schmidt; Roland Schmitt; Stephen D Schmidt; Ingo Schmitz; Eran Schmukler; Anja Schneider; Bianca E Schneider; Romana Schober; Alejandra C Schoijet; Micah B Schott; Michael Schramm; Bernd Schröder; Kai Schuh; Christoph Schüller; Ryan J Schulze; Lea Schürmanns; Jens C Schwamborn; Melanie Schwarten; Filippo Scialo; Sebastiano Sciarretta; Melanie J Scott; Kathleen W Scotto; A Ivana Scovassi; Andrea Scrima; Aurora Scrivo; David Sebastian; Salwa Sebti; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Iban Seiliez; Ekihiro Seki; Scott B Selleck; Frank W Sellke; Joshua T Selsby; Michael Sendtner; Serif Senturk; Elena Seranova; Consolato Sergi; Ruth Serra-Moreno; Hiromi Sesaki; Carmine Settembre; Subba Rao Gangi Setty; Gianluca Sgarbi; Ou Sha; John J Shacka; Javeed A Shah; Dantong Shang; Changshun Shao; Feng Shao; Soroush Sharbati; Lisa M Sharkey; Dipali Sharma; Gaurav Sharma; Kulbhushan Sharma; Pawan Sharma; Surendra Sharma; Han-Ming Shen; Hongtao Shen; Jiangang Shen; Ming Shen; Weili Shen; Zheni Shen; Rui Sheng; Zhi Sheng; Zu-Hang Sheng; Jianjian Shi; Xiaobing Shi; Ying-Hong Shi; Kahori Shiba-Fukushima; Jeng-Jer Shieh; Yohta Shimada; Shigeomi Shimizu; Makoto Shimozawa; Takahiro Shintani; Christopher J Shoemaker; Shahla Shojaei; Ikuo Shoji; Bhupendra V Shravage; Viji Shridhar; Chih-Wen Shu; Hong-Bing Shu; Ke Shui; Arvind K Shukla; Timothy E Shutt; Valentina Sica; Aleem Siddiqui; Amanda Sierra; Virginia Sierra-Torre; Santiago Signorelli; Payel Sil; Bruno J de Andrade Silva; Johnatas D Silva; Eduardo Silva-Pavez; Sandrine Silvente-Poirot; Rachel E Simmonds; Anna Katharina Simon; Hans-Uwe Simon; Matias Simons; Anurag Singh; Lalit P Singh; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Sudha B Singh; Sunaina Singh; Surinder Pal Singh; Debasish Sinha; Rohit Anthony Sinha; Sangita Sinha; Agnieszka Sirko; Kapil Sirohi; Efthimios L Sivridis; Panagiotis Skendros; Aleksandra Skirycz; Iva Slaninová; Soraya S Smaili; Andrei Smertenko; Matthew D Smith; Stefaan J Soenen; Eun Jung Sohn; Sophia P M Sok; Giancarlo Solaini; Thierry Soldati; Scott A Soleimanpour; Rosa M Soler; Alexei Solovchenko; Jason A Somarelli; Avinash Sonawane; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Kunhua Song; Zhiyin Song; Leandro R Soria; Maurizio Sorice; Alexander A Soukas; Sandra-Fausia Soukup; Diana Sousa; Nadia Sousa; Paul A Spagnuolo; Stephen A Spector; M M Srinivas Bharath; Daret St Clair; Venturina Stagni; Leopoldo Staiano; Clint A Stalnecker; Metodi V Stankov; Peter B Stathopulos; Katja Stefan; Sven Marcel Stefan; Leonidas Stefanis; Joan S Steffan; Alexander Steinkasserer; Harald Stenmark; Jared Sterneckert; Craig Stevens; Veronika Stoka; Stephan Storch; Björn Stork; Flavie Strappazzon; Anne Marie Strohecker; Dwayne G Stupack; Huanxing Su; Ling-Yan Su; Longxiang Su; Ana M Suarez-Fontes; Carlos S Subauste; Selvakumar Subbian; Paula V Subirada; Ganapasam Sudhandiran; Carolyn M Sue; Xinbing Sui; Corey Summers; Guangchao Sun; Jun Sun; Kang Sun; Meng-Xiang Sun; Qiming Sun; Yi Sun; Zhongjie Sun; Karen K S Sunahara; Eva Sundberg; Katalin Susztak; Peter Sutovsky; Hidekazu Suzuki; Gary Sweeney; J David Symons; Stephen Cho Wing Sze; Nathaniel J Szewczyk; Anna Tabęcka-Łonczynska; Claudio Tabolacci; Frank Tacke; Heinrich Taegtmeyer; Marco Tafani; Mitsuo Tagaya; Haoran Tai; Stephen W G Tait; Yoshinori Takahashi; Szabolcs Takats; Priti Talwar; Chit Tam; Shing Yau Tam; Davide Tampellini; Atsushi Tamura; Chong Teik Tan; Eng-King Tan; Ya-Qin Tan; Masaki Tanaka; Motomasa Tanaka; Daolin Tang; Jingfeng Tang; Tie-Shan Tang; Isei Tanida; Zhipeng Tao; Mohammed Taouis; Lars Tatenhorst; Nektarios Tavernarakis; Allen Taylor; Gregory A Taylor; Joan M Taylor; Elena Tchetina; Andrew R Tee; Irmgard Tegeder; David Teis; Natercia Teixeira; Fatima Teixeira-Clerc; Kumsal A Tekirdag; Tewin Tencomnao; Sandra Tenreiro; Alexei V Tepikin; Pilar S Testillano; Gianluca Tettamanti; Pierre-Louis Tharaux; Kathrin Thedieck; Arvind A Thekkinghat; Stefano Thellung; Josephine W Thinwa; V P Thirumalaikumar; Sufi Mary Thomas; Paul G Thomes; Andrew Thorburn; Lipi Thukral; Thomas Thum; Michael Thumm; Ling Tian; Ales Tichy; Andreas Till; Vincent Timmerman; Vladimir I Titorenko; Sokol V Todi; Krassimira Todorova; Janne M Toivonen; Luana Tomaipitinca; Dhanendra Tomar; Cristina Tomas-Zapico; Sergej Tomić; Benjamin Chun-Kit Tong; Chao Tong; Xin Tong; Sharon A Tooze; Maria L Torgersen; Satoru Torii; Liliana Torres-López; Alicia Torriglia; Christina G Towers; Roberto Towns; Shinya Toyokuni; Vladimir Trajkovic; Donatella Tramontano; Quynh-Giao Tran; Leonardo H Travassos; Charles B Trelford; Shirley Tremel; Ioannis P Trougakos; Betty P Tsao; Mario P Tschan; Hung-Fat Tse; Tak Fu Tse; Hitoshi Tsugawa; Andrey S Tsvetkov; David A Tumbarello; Yasin Tumtas; María J Tuñón; Sandra Turcotte; Boris Turk; Vito Turk; Bradley J Turner; Richard I Tuxworth; Jessica K Tyler; Elena V Tyutereva; Yasuo Uchiyama; Aslihan Ugun-Klusek; Holm H Uhlig; Marzena Ułamek-Kozioł; Ilya V Ulasov; Midori Umekawa; Christian Ungermann; Rei Unno; Sylvie Urbe; Elisabet Uribe-Carretero; Suayib Üstün; Vladimir N Uversky; Thomas Vaccari; Maria I Vaccaro; Björn F Vahsen; Helin Vakifahmetoglu-Norberg; Rut Valdor; Maria J Valente; Ayelén Valko; Richard B Vallee; Angela M Valverde; Greet Van den Berghe; Stijn van der Veen; Luc Van Kaer; Jorg van Loosdregt; Sjoerd J L van Wijk; Wim Vandenberghe; Ilse Vanhorebeek; Marcos A Vannier-Santos; Nicola Vannini; M Cristina Vanrell; Chiara Vantaggiato; Gabriele Varano; Isabel Varela-Nieto; Máté Varga; M Helena Vasconcelos; Somya Vats; Demetrios G Vavvas; Ignacio Vega-Naredo; Silvia Vega-Rubin-de-Celis; Guillermo Velasco; Ariadna P Velázquez; Tibor Vellai; Edo Vellenga; Francesca Velotti; Mireille Verdier; Panayotis Verginis; Isabelle Vergne; Paul Verkade; Manish Verma; Patrik Verstreken; Tim Vervliet; Jörg Vervoorts; Alexandre T Vessoni; Victor M Victor; Michel Vidal; Chiara Vidoni; Otilia V Vieira; Richard D Vierstra; Sonia Viganó; Helena Vihinen; Vinoy Vijayan; Miquel Vila; Marçal Vilar; José M Villalba; Antonio Villalobo; Beatriz Villarejo-Zori; Francesc Villarroya; Joan Villarroya; Olivier Vincent; Cecile Vindis; Christophe Viret; Maria Teresa Viscomi; Dora Visnjic; Ilio Vitale; David J Vocadlo; Olga V Voitsekhovskaja; Cinzia Volonté; Mattia Volta; Marta Vomero; Clarissa Von Haefen; Marc A Vooijs; Wolfgang Voos; Ljubica Vucicevic; Richard Wade-Martins; Satoshi Waguri; Kenrick A Waite; Shuji Wakatsuki; David W Walker; Mark J Walker; Simon A Walker; Jochen Walter; Francisco G Wandosell; Bo Wang; Chao-Yung Wang; Chen Wang; Chenran Wang; Chenwei Wang; Cun-Yu Wang; Dong Wang; Fangyang Wang; Feng Wang; Fengming Wang; Guansong Wang; Han Wang; Hao Wang; Hexiang Wang; Hong-Gang Wang; Jianrong Wang; Jigang Wang; Jiou Wang; Jundong Wang; Kui Wang; Lianrong Wang; Liming Wang; Maggie Haitian Wang; Meiqing Wang; Nanbu Wang; Pengwei Wang; Peipei Wang; Ping Wang; Ping Wang; Qing Jun Wang; Qing Wang; Qing Kenneth Wang; Qiong A Wang; Wen-Tao Wang; Wuyang Wang; Xinnan Wang; Xuejun Wang; Yan Wang; Yanchang Wang; Yanzhuang Wang; Yen-Yun Wang; Yihua Wang; Yipeng Wang; Yu Wang; Yuqi Wang; Zhe Wang; Zhenyu Wang; Zhouguang Wang; Gary Warnes; Verena Warnsmann; Hirotaka Watada; Eizo Watanabe; Maxinne Watchon; Anna Wawrzyńska; Timothy E Weaver; Grzegorz Wegrzyn; Ann M Wehman; Huafeng Wei; Lei Wei; Taotao Wei; Yongjie Wei; Oliver H Weiergräber; Conrad C Weihl; Günther Weindl; Ralf Weiskirchen; Alan Wells; Runxia H Wen; Xin Wen; Antonia Werner; Beatrice Weykopf; Sally P Wheatley; J Lindsay Whitton; Alexander J Whitworth; Katarzyna Wiktorska; Manon E Wildenberg; Tom Wileman; Simon Wilkinson; Dieter Willbold; Brett Williams; Robin S B Williams; Roger L Williams; Peter R Williamson; Richard A Wilson; Beate Winner; Nathaniel J Winsor; Steven S Witkin; Harald Wodrich; Ute Woehlbier; Thomas Wollert; Esther Wong; Jack Ho Wong; Richard W Wong; Vincent Kam Wai Wong; W Wei-Lynn Wong; An-Guo Wu; Chengbiao Wu; Jian Wu; Junfang Wu; Kenneth K Wu; Min Wu; Shan-Ying Wu; Shengzhou Wu; Shu-Yan Wu; Shufang Wu; William K K Wu; Xiaohong Wu; Xiaoqing Wu; Yao-Wen Wu; Yihua Wu; Ramnik J Xavier; Hongguang Xia; Lixin Xia; Zhengyuan Xia; Ge Xiang; Jin Xiang; Mingliang Xiang; Wei Xiang; Bin Xiao; Guozhi Xiao; Hengyi Xiao; Hong-Tao Xiao; Jian Xiao; Lan Xiao; Shi Xiao; Yin Xiao; Baoming Xie; Chuan-Ming Xie; Min Xie; Yuxiang Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Congfeng Xu; En Xu; Haoxing Xu; Jing Xu; JinRong Xu; Liang Xu; Wen Wen Xu; Xiulong Xu; Yu Xue; Sokhna M S Yakhine-Diop; Masamitsu Yamaguchi; Osamu Yamaguchi; Ai Yamamoto; Shunhei Yamashina; Shengmin Yan; Shian-Jang Yan; Zhen Yan; Yasuo Yanagi; Chuanbin Yang; Dun-Sheng Yang; Huan Yang; Huang-Tian Yang; Hui Yang; Jin-Ming Yang; Jing Yang; Jingyu Yang; Ling Yang; Liu Yang; Ming Yang; Pei-Ming Yang; Qian Yang; Seungwon Yang; Shu Yang; Shun-Fa Yang; Wannian Yang; Wei Yuan Yang; Xiaoyong Yang; Xuesong Yang; Yi Yang; Ying Yang; Honghong Yao; Shenggen Yao; Xiaoqiang Yao; Yong-Gang Yao; Yong-Ming Yao; Takahiro Yasui; Meysam Yazdankhah; Paul M Yen; Cong Yi; Xiao-Ming Yin; Yanhai Yin; Zhangyuan Yin; Ziyi Yin; Meidan Ying; Zheng Ying; Calvin K Yip; Stephanie Pei Tung Yiu; Young H Yoo; Kiyotsugu Yoshida; Saori R Yoshii; Tamotsu Yoshimori; Bahman Yousefi; Boxuan Yu; Haiyang Yu; Jun Yu; Jun Yu; Li Yu; Ming-Lung Yu; Seong-Woon Yu; Victor C Yu; W Haung Yu; Zhengping Yu; Zhou Yu; Junying Yuan; Ling-Qing Yuan; Shilin Yuan; Shyng-Shiou F Yuan; Yanggang Yuan; Zengqiang Yuan; Jianbo Yue; Zhenyu Yue; Jeanho Yun; Raymond L Yung; David N Zacks; Gabriele Zaffagnini; Vanessa O Zambelli; Isabella Zanella; Qun S Zang; Sara Zanivan; Silvia Zappavigna; Pilar Zaragoza; Konstantinos S Zarbalis; Amir Zarebkohan; Amira Zarrouk; Scott O Zeitlin; Jialiu Zeng; Ju-Deng Zeng; Eva Žerovnik; Lixuan Zhan; Bin Zhang; Donna D Zhang; Hanlin Zhang; Hong Zhang; Hong Zhang; Honghe Zhang; Huafeng Zhang; Huaye Zhang; Hui Zhang; Hui-Ling Zhang; Jianbin Zhang; Jianhua Zhang; Jing-Pu Zhang; Kalin Y B Zhang; Leshuai W Zhang; Lin Zhang; Lisheng Zhang; Lu Zhang; Luoying Zhang; Menghuan Zhang; Peng Zhang; Sheng Zhang; Wei Zhang; Xiangnan Zhang; Xiao-Wei Zhang; Xiaolei Zhang; Xiaoyan Zhang; Xin Zhang; Xinxin Zhang; Xu Dong Zhang; Yang Zhang; Yanjin Zhang; Yi Zhang; Ying-Dong Zhang; Yingmei Zhang; Yuan-Yuan Zhang; Yuchen Zhang; Zhe Zhang; Zhengguang Zhang; Zhibing Zhang; Zhihai Zhang; Zhiyong Zhang; Zili Zhang; Haobin Zhao; Lei Zhao; Shuang Zhao; Tongbiao Zhao; Xiao-Fan Zhao; Ying Zhao; Yongchao Zhao; Yongliang Zhao; Yuting Zhao; Guoping Zheng; Kai Zheng; Ling Zheng; Shizhong Zheng; Xi-Long Zheng; Yi Zheng; Zu-Guo Zheng; Boris Zhivotovsky; Qing Zhong; Ao Zhou; Ben Zhou; Cefan Zhou; Gang Zhou; Hao Zhou; Hong Zhou; Hongbo Zhou; Jie Zhou; Jing Zhou; Jing Zhou; Jiyong Zhou; Kailiang Zhou; Rongjia Zhou; Xu-Jie Zhou; Yanshuang Zhou; Yinghong Zhou; Yubin Zhou; Zheng-Yu Zhou; Zhou Zhou; Binglin Zhu; Changlian Zhu; Guo-Qing Zhu; Haining Zhu; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Yanping Zhu; Yushan Zhu; Haixia Zhuang; Xiaohong Zhuang; Katarzyna Zientara-Rytter; Christine M Zimmermann; Elena Ziviani; Teresa Zoladek; Wei-Xing Zong; Dmitry B Zorov; Antonio Zorzano; Weiping Zou; Zhen Zou; Zhengzhi Zou; Steven Zuryn; Werner Zwerschke; Beate Brand-Saberi; X Charlie Dong; Chandra Shekar Kenchappa; Zuguo Li; Yong Lin; Shigeru Oshima; Yueguang Rong; Judith C Sluimer; Christina L Stallings; Chun-Kit Tong Journal: Autophagy Date: 2021-02-08 Impact factor: 13.391
Figure 1
Figure 2
Figure 3
Figure 4