| Literature DB >> 30517210 |
Lyana Rodrigues Pinto Lima1, Nathália Alves de Araújo1, Alexandro Guterres2, José Henrique Pilotto3,4, Christian Niel1, Vanessa Salete de Paula1.
Abstract
BACKGROUND Human herpesvirus 2 (HHV-2) have DNA genome with a limited genetic variability and have been classified into two clades. OBJECTIVES To identify and characterise six HHV-2 isolates derived from Brazilian women. METHODS HHV-2 isolates were performed polymerase chain reaction (PCR) and sequencing of 2250 pb of the glycoprotein B (gB) coding regions. FINDINGS Four HHV-2 isolates were classified into clade B, while the remaining two, derived from HIV-1 co-infected women, showed a notable genetic divergence (> 1%). MAIN CONCLUSION The results reveal novel HHV-2 variants. The impact of these novel variants on HHV-2 pathogenesis and HIV/HHV-2 coinfection need to be investigated.Entities:
Mesh:
Year: 2018 PMID: 30517210 PMCID: PMC6276022 DOI: 10.1590/0074-02760180328
Source DB: PubMed Journal: Mem Inst Oswaldo Cruz ISSN: 0074-0276 Impact factor: 2.743
Oligonucleotide primers used in this study
| Primer | Genome position | Sequence (5´ → 3´) | Reference |
| gB1 For | CCCATCCCCTCGAAGAAC | Abrão et al.(19) | |
| gB1 Rev | 577 | CAGACCCCCTTGGCGTTAAT | This study |
| gB2 For | 424 | TTCAAGGAGAACATCGCCCC | This study |
| gB2 Rev | 744 | GGGGTTGTACTTGAGGTCGG | This study |
| gB3 For | 557 | ATTAACGCCAAGGGGGTCTG | This study |
| gB3 Rev | 885 | GTAGCCGTAAAACGGGGACA | This study |
| gB4 For | 725 | CCGACCTCAAGTACAACCCC | This study |
| gB4 Rev | 1164 | GGTGAAGGTGGTCGAGATGG | This study |
| gB5 For | 1008 | GCTGACGACCCCAAGTTTA | This study |
| gB5 Rev | 1487 | TCGATCGAGGAGGTGGTCTT | This study |
| gB6 For | 1158 | CCTTCACCACCAACCTGACC | This study |
| gB6 Rev | 1532 | CGTGGCGCTGTATGTGGTTA | This study |
| gB7 For | 1464 | GCATCAAGACCACCTCCTCG | This study |
| gB7 Rev | 1912 | GAAGATGAAGTAGCGCCGGT | This study |
| gB8 For | 1604 | CGAGCTGACTCTCTCGGAACG | This study |
| gB8 Rev | 2035 | CACAAACTCGTGGTCCTCCA | This study |
| gB9 For | 1916 | GGGGCTACGTGTACTTCGAG | This study |
| gB9 Rev | 2410 | ACAGGGCCTTCATGGGATTG | This study |
| gB10 For | 2391 | CAATCCCATGAAGGCCCTGT | This study |
| gB10 Rev | 2606 | GTTGGTGACCTTGGAGCTGA | This study |
*: numbering from the initiation codon of the glycoprotein B (gB) coding region.
Phylogenetic relationshipsamong human herpesvirus 2 (HHV-2) based on Bayesian analysis of genetic distances generated from comparisons of a 2,250-bp fragment of the glycoprotein B (gB) sequences. The scale bar indicates an evolutionary distance of 0.003 substitutions per position. Numerical values (≥ 0.7) at the nodes indicate posterior probability replicates that supported by the interior branch. The Tamura 3-parameter model with gamma-distributed rate heterogeneity (T92 + G) was selected as the best-fit evolutionary model. Clades A and B are in accordance with previous studies. ,
Specific mutations found in the glycoprotein B (gB) coding regions of two human herpesvirus 2 (HHV-2) isolates derived from Brazilian HIV co-infected women
| Nucleotide change | Presence in ChHV prototype | Amino acid change |
| G1254C | No | - |
| C1323G | No | - |
| G1411C | No | A471P |
| C1617G | No | - |
| C1668G | No | - |
| C1683G | No | - |
| G1731C | No | - |
| G1734A | Yes | - |
| G1747A | No | V583I |
| G1761C | Yes | - |
| G1767C | No | - |
| C1816T | Yes | - |
| C1836G | No | - |
| C1857G | No | - |
| G1972A | Yes | - |
| G2001C | No | - |
a: numbering from the initiation codon of the gB coding region; b: number access of chimpanzee alphaherpesvirus (ChHV) prototype: NC_023677.1.