| Literature DB >> 30500817 |
Sadia Liaquat1,2, Yasra Sarwar1, Aamir Ali1, Abdul Haque3, Muhammad Farooq1, Ilargi Martinez-Ballesteros4, Lorena Laorden4, Javier Garaizar4, Joseba Bikandi4.
Abstract
The pathogenesis of Salmonella enterica serovar Typhi (S. Typhi), the cause of typhoid fever in humans, is mainly attributed to the acquisition of horizontally acquired DNA elements. Salmonella pathogenicity islands (SPIs) are indubitably the most important form of horizontally acquired DNA with respect to pathogenesis of this bacterium. The insertion or deletion of any of these transferrable SPIs may have impact on the virulence potential of S. Typhi. In this study, the virulence potential and genetic relatedness of 35 S. Typhi isolates, collected from 2004 to 2013 was determined by identification of SPI and non-SPI virulence factors through a combination of techniques including virulotyping, Whole Genome Sequencing (WGS), and Variable Number of Tandem Repeats (VNTR) profiling. In order to determine the virulence potential of local S. Typhi isolates, 56 virulence related genes were studied by PCR. These genes are located in the core as well as accessory genome (SPIs and plasmid). Major variations among studied virulence determinants were found in case of SPI-7 and SPI-10 associated genes. On the basis of presence of virulence related genes, the studied S. Typhi isolates from Pakistan were clustered into two virulotypes Vi-positive and Vi-negative. Interestingly, SPI-7 and SPI-10 were collectively absent or present in Vi-negative and Vi-positive strains, respectively. Two Vi-negative and 11 Vi-positive S. Typhi strains were also analyzed by whole genome sequencing (WGS) and their results supported the PCR results. Genetic diversity was tested by VNTR-based molecular typing. All 35 isolates were clustered into five groups. Overall, all Vi-negative isolates were placed in a single group (T5) whereas Vi-positive isolates were grouped into four types. Vi-negative and Vi-positive isolates were mutually exclusive. This is the first report on the comparative distribution of SPI and non-SPI related virulence genes in Vi-negative and Vi-positive S. Typhi isolates with an important finding that SPI-10 is absent in all Vi-negative isolates.Entities:
Mesh:
Substances:
Year: 2018 PMID: 30500817 PMCID: PMC6267989 DOI: 10.1371/journal.pntd.0006839
Source DB: PubMed Journal: PLoS Negl Trop Dis ISSN: 1935-2727
Distribution of virulence related genes of chromosomal (SPIs, Non-SPI) and extrachromosomal origin (plasmids) among local isolates of S. Typhi (in percent).
| Location | Virulence Related Genes | Percentage of | |
|---|---|---|---|
| Vi-positive | Vi-negative | ||
| SPI-1 | 100 | 100 | |
| SPI-2 | 100 | 100 | |
| SPI-3 | 100 | 100 | |
| SPI-4 | 100 | 100 | |
| SPI-5 | 100 | 100 | |
| SPI-6 | 100 | 100 | |
| SPI-7 | 100 | 0 | |
| SPI-7 | 100 | 100 | |
| SPI-8 | STY3280, STY3282 | 100 | 100 |
| SPI-9 | 100 | 100 | |
| SPI-10 | 100 | 0 | |
| SPI-11 | 100 | 100 | |
| SPI-12 | 100 | 100 | |
| SPI-16 | 100 | 100 | |
| SPI-17 | STY-2629 | 100 | 100 |
| SPI-18 | 100 | 100 | |
| Non-SPI | 100 | 100 | |
| 29 | 0 | ||
| 0 | 0 | ||
*Plasmids
Fig 1Physical map of the SPI-10 in the Salmonella enterica serovar Typhi CT18 NC_003198.1.
Genes are depicted by arrows with gene designation indicated within arrows. Virulence genes are dotted and in black are phage-related genes. The schematic locations of primer pairs specific for SPI-10up, SPI-10dn, prkX, prkY, prpZ, sefB, sefC, and sefR are shown below genes. The position and length of expected PCR product (including region and genes investigated in this study) are mentioned according to the CT18 genome coordinates [26].
Fig 2Comparative genome analysis of SalmonellaTyphi strains for pathogenicity Islands.
The outer circle corresponds to the reference genome of S. Typhi (Acc: AL513382) whereas inner circles depict the strains with clear depiction of absence of SPI-7 and SPI-10 in S. Typhi strain 5 and 25. The gene labels are displayed at 1500bp distance window size for figure adjustment.
Fig 3Agarose gel analysis of the all five types of VNTR profiles from representative S. Typhi local isolates.
Lane 1 and 8:100bp DNA ladder (Invitrogen 15628–019; showing bands of 2072, 1500, 1400, 1300, 1200, 1100, 1000, 900, 800, 700, 600, 500, 400, 300, 200 and 100 bp), Lane 2–6: Vi-positive S. Typhi isolates, Lane 7: Vi- negative S. Typhi isolates.
VNTR profiles of 35 local isolates of S. Typhi.
| Sr. # | VNTR profile | No. of isolates | VNTR profile designation |
|---|---|---|---|
| 1 | 3.9x/10.5x/2.3x | 15(Vi+) | T1 |
| 2 | 5x/13.9x/2.3x | 6(Vi+) | T2 |
| 3 | 3.9x/12.5x/2.3x | 6(Vi+) | T3 |
| 4 | 3.9x/ND/2.3x | 4(Vi+) | T4 |
| 5 | 9.6x/3.1x/3.3x | 4 (Vi-) | T5 |
ND (not detected); x = copy number
List of primers sequences used to detect the virulence genes of Salmonella enteric serovar Typhi isolates.
| Sr.# | Location | Gene | Primer Sequence | Annealing Temp°C | Amplicon size (bp) | Reference |
|---|---|---|---|---|---|---|
| 1 | SPI-1 | GTGAAATTATCGCCACGTTCGGGCAA | 64 | 284 | [ | |
| 2 | SPI-1 | CAGGTAACAGAGGCGCTGGATAAA | 55 | 121 | [ | |
| 3 | SPI-1 | ACGGACAGGGTTATCGGTTTAAT | 50 | 92 | [ | |
| 4 | SPI-1 | GTTAAGTAATGTGCTGGACGGCCT | 55 | 100 | [ | |
| 5 | SPI-1 | TCATAATCGCCCCTCGCTAA | 50 | 70 | [ | |
| 6 | SPI-2 | CCTGGATAATGACTATTGAT | 50 | 301 | [ | |
| 7 | SPI-2 | ATATGGCGATCATGGGAAGCTGGA | 55 | 84 | [ | |
| 8 | SPI-3 | GGCAGGAGTTTCGCACTAAC | 55 | 445 | [ | |
| SPI-3 | TCGGCGTGTTATGCGGCTTA | 55 | 264 | [ | ||
| 10 | SPI-3 | GTTGGCGCTGGGCGGATTCT | 60 | 616 | This study | |
| 11 | SPI-4 | GTTCATGGTCAGGGCGTTAT | 55 | 275 | [ | |
| 12 | SPI-4 | GGAGTATCGATAAAGATGTT | 50 | 332 | [ | |
| 13 | SPI-5 | TAAGAAGAAGCAATGAAAGATGGTT | 50 | 305 | [ | |
| 14 | SPI-5 | CGGCGATTCATGACTTTGAT | 50 | 399 | [ | |
| 15 | SPI-5 | CGGACCGCCCAGCAACAAAACAAGAAGAAG | 55 | 220 | [ | |
| 16 | SPI-6 | CATTTATTCTCAGGGGGAGCG | 57 | 1049 | [ | |
| 17 | SPI-6 | TGTTCTGGCTCCTTGTTTGACG | 57 | [ | ||
| 18 | SPI-7 | GTATCAACATTAAATCCATGC | 50 | 502 | [ | |
| 19 | SPI-7 | GTTATTTCAGCATAAGGAG | 50 | 599 | [ | |
| 20 | SPI-7 | CGAGTGAAACCGTTGGTACA | 50 | 846 | [ | |
| 21 | SPI-7 | TACCTAGCGAGCCAGTACAGAG | 55 | 2500 | [ | |
| 22 | SPI-7 | GCTGACTTTGGTGCTGCTGCTCTCG | 50 | 2000/2425 | [ | |
| 23 | SPI-8 | STY3280 | ATATGACTCGAATGAAATCAGG | 50 | 132 | [ |
| 24 | SPI-8 | STY3282 | AAAAAGAGGTCGAGCGCCTTACTCC | 50 | 142 | [ |
| 25 | SPI-9 | TAACCTGTGCGGCGTGCTGG | 55 | 559 | This study | |
| 26 | SPI-9 | STY-2875 | TGGCGACACTCTGCTTGGCG | 50 | 276 | This study |
| 27 | SPI-10 | GAAGAAAACCACAATTACTC | 50 | 668 | [ | |
| 28 | SPI-10 | AATATTATGGCCTAAGATTGGG | 50 | 534 | [ | |
| 29 | SPI-10 | TGACATTCCTACGGCATATG | 50 | 625 | [ | |
| 30 | SPI-10 | CAATGGTGCGGTGCGAAAGATAAC | 57 | 115 | [ | |
| 31 | SPI-10 | AGCCATGACAAATATGCTCGACCG | 57 | 104 | [ | |
| 32 | SPI-10 | CGTCATGTCGGTCGCGTCAATAAT | 55 | 127 | [ | |
| 33 | SPI-11 | TTTAATGGTTGGGCCAGCCTATCG | 55 | 87 | [ | |
| 34 | SPI-11 | GCCAGGCGCACGCGAAATCATCC | 62 | 189 | [ | |
| 35 | SPI-11 | TGGTAGTAAAACCCCGCAACCACC | 60 | 89 | This study | |
| 36 | SPI-11 | ACAACTGTCGCATCTCGCCCCGTCATT | 58 | 268 | [ | |
| 37 | SPI-12 | GGGCTGCACCCGCAGAAGAG | 60 | 216 | This study | |
| 38 | SPI-16 | GCATCAGGCGCTGGCGAACT | 60 | 104 | This study | |
| 39 | SPI-16 | CATGCAACCGGGGATGCGGT | 60 | 364 | This study | |
| 40 | SPI-17 | STY-2629 | TGGGACGGGTTTAATTGGCGCA | 55 | 251 | This study |
| 41 | SPI-18 | GACCTTTGATGAAACCATAAAAGAG | 50 | 600 | [ | |
| 42 | SPI-18 | ATATCACCGATGCGGTGGGAATC | 55 | 141 | [ | |
| 43 | Non-SPI | TGCAAAGCGATGCCCGTAAATC | 55 | 151 | [ | |
| 44 | Non-SPI | CTTTAGAAGCATCGGCACGAAC CGCAATGGTTATGGCTATGGG | 57 | 505 | [ | |
| 45 | Non-SPI | TGCCAGGTTACGCCACAAACC | 60 | 354 | [ | |
| 46 | Non-SPI | CCTTTCTCCATCGTCCTGAA | 58 | 85 | [ | |
| 47 | Non-SPI | ACGCCCCAGTTCCTGCTCCA | 60 | 277 | This study | |
| 48 | Non-SPI | CCGCACTCGGTTCGTGGTCC | 60 | 345 | This study | |
| 49 | Non-SPI | ATGCAAAGCCCGACCATGACG | 62 | 299 | [ | |
| 50 | Non-SPI | TACCCAGGCGCAAAAAGAGGCTATC | 60 | 161 | [ | |
| 51 | Non-SPI | TTTGCCGAACGCGCCCCCACACG | 55 | 449 | [ | |
| 52 | Non-SPI | TACCGGGGTGGATGCGCTGA | 60 | 322 | This study | |
| 53 | pRST98 | ATGTTGATACTAAATGGTTTTTCA | 55 | 1776 | [ | |
| 54 | pRST98 | ATGGATTTCATTAATAAAAAATTA | 55 | 894 | [ | |
| 55 | R27, pHCM1 | ACTGGCCAGGTTCCCGCAGA | 60 | 109 | This study | |
| 56 | Non-SPI | GCTCCGTCAGGTGCTTCTAC | 60 | 143 | [ |
aGenome coordinates of the location of the genes for which primers have been designed in this study based on S. enterica Typhi CT8 reference genome [26]
List of primers used to detect the complete presence/absence of SPI-7 and SPI-10.
| Sr.# | Primers | Primer Sequence | Annealing Temp°C | Amplicon size (bp) | Reference/(genome Coordinates |
|---|---|---|---|---|---|
| 1 | DE0032-F | GCTCAGTCGGTAGAGCAGGGGATT | 57 | 1275 | [ |
| 2 | Spi10up-F | TTCGAGTCCGGCCTTCGGCA | 50 | 1134 | This study (4683667–4684800) |
| 3 | Spi10dn-F | CCACCACCCGCGCTCTTTCC | 50 | 1039 | This study (4716415–4717453) |
aGenome coordinates of the location of the genes for which primers have been designed in this study based on S. enterica Typhi CT8 reference genome [26]
List of primers used for S. Typhi isolates molecular typing based on VNTR.
| Sr. # | Primer | Primer Sequences | Repeat sequences | Reference |
|---|---|---|---|---|
| 1 | TR1 | AGAACCAGCAATGCGCCAACGA | AGAAGAA | [ |
| 2 | TR2 | CCCTGTTTTTCGTGCTGATACG | CCAGTTCC | [ |
| 3 | TR3 | CGAAGGCGGAAAAAACGTCCTG | CGCGGGGATCGGTTTATCCCCGCTGG | [ |