Literature DB >> 30483762

MicroRNA-30e inhibits adhesion, migration, invasion and cell cycle progression of prostate cancer cells via inhibition of the activation of the MAPK signaling pathway by downregulating CHRM3.

Xin-Min Zheng1, Peng Zhang1, Man-Hua Liu2, Ping Chen1, Wei-Bing Zhang1.   

Abstract

Prostate cancer (PCa) testing is currently based on measurement of serum prostate‑specific antigen levels and digital rectal examination, which are limited by a low predictive value and the adverse effects associated with overdiagnosis and overtreatment. Recent studies have reported that the abnormal expression of microRNAs (miRNAs) is associated with the mechanism underlying the development of PCa. Thus, the aim of the present study was to investigate the effects of miR‑30e and its target gene, M3 muscarinic acetylcholine receptor (CHRM3), on the adhesion, migration, invasion and cell cycle distribution of PCa cells via the mitogen‑activated protein kinase (MAPK) signaling pathway. The differentially expressed genes were screened in the Gene Expression Omnibus database from a gene expression microarray (GSE55945) of PCa. PCa tissues and adjacent tissues were collected from patients with PCa. The PC‑3 and DU145 human PCa cell lines were treated with activator, inhibitor and siRNAs. The effects of miR‑30e on cell adhesion, migration, invasion and cell cycle distribution with the involvement of CHRM3 and the MAPK signaling pathway were investigated. The bioinformatics results demonstrated that the CHRM3 gene and the MAKP signaling pathway were involved in the progression of PCa, and has‑miR‑30e was selected for further study. The levels of miR‑30e were significantly downregulated, while the levels of CHRM3 were obviously upregulated in PCa. CHRM3 was verified as a target gene of miR‑30e. Upregulation of miR‑30e and downregulation of CHRM3 decreased the levels of p‑P38, p‑extracellular signal‑regulated kinase, p‑c‑Jun N‑terminal kinase, p‑c‑fos and p‑c‑JUN, cell adhesion, migration and invasion ability, and the number of cells in the S phase, while they increased the number of cells in the G0 and G1 phases. The findings of the present study suggest that miR‑30e inhibited the adhesion, migration, invasion and cell cycle entry of PCa cells by suppressing the activation of the MAPK signaling pathway and inhibiting CHRM3 expression. Thus, miR‑30e may serve as a candidate target for the treatment of PCa.

Entities:  

Mesh:

Substances:

Year:  2018        PMID: 30483762      PMCID: PMC6317654          DOI: 10.3892/ijo.2018.4647

Source DB:  PubMed          Journal:  Int J Oncol        ISSN: 1019-6439            Impact factor:   5.650


Introduction

Prostate cancer (PCa) is one of the most common cancers and one of the leading causes of cancer-related mortality in men worldwide. Early PCa may be managed by active surveillance, external beam radiotherapy, brachytherapy and radical prostatectomy, but a small proportion of patients eventually develop metastatic disease (1). Prostate tumors display marked biological heterogeneity; some patients succumb to metastatic disease 2-3 years after the diagnosis, while others may survive for 10-20 years with organ-confined disease, reflecting the potential genomic diversity (2). Digital rectal examination (DRE) and prostate-specific antigen (PSA) testing are commonly used for early detection of PCa, but the limited diagnostic value of these two methods is attributed to low sensitivity (DRE) and low specificity (PSA testing). PSA screening has led to a dramatic increase in the incidence of PCa, but it remains unknown whether it can significantly reduce fatality rates (3). Therefore, improved biomarkers for the diagnosis of PCa are needed. As small, non-coding RNA molecules, microRNAs (miRNAs) regulate gene expression via interacting with messenger RNAs (mRNAs), and abnormal expression of several miRNAs in PCa suggests that these miRNAs may play a role in diagnosis, prognosis and potential therapeutic interventions in PCa (4). Compared with mRNAs, miRNAs are more stable in clinical samples, such as formalin-fixed paraffin-embedded (FFPE) tissues and serum, and can be easily detected by highly specific and sensitive polymerase chain reaction (PCR)-based assays. A variety of miRNAs have been found to be differentially expressed between normal and cancer cells, making them optimal biomarkers for PCa (5). Mechanistically, miR-30e enhances the activation of nuclear factor (NF)-κB and the expression of cyclin D1, which promotes the phosphorylation of one of the regulators of PCa proliferation, indicating that miR-30e targeting of IκBα controls prostate tumor growth (6). Moreover, blockade of M3 muscarinic acetylcholine receptor (CHRM3) suppresses PCa growth and resistance to castration through shRNAs or a specific antagonist via the CaM/CaMKK-mediated phosphorylation of Akt, indicating regulation of autocrine activation of CHRM3 in cell growth and castration resistance of PCa (7). In addition, Id-1 was found to be associated with the activation of the MAPK signaling pathway, suggesting that Id-1 regulates PCa tumorigenesis and growth (8). Recently, miR-23a and miR-23b were reported to be potential therapeutic targets for PCa through the mitogen-activated protein kinase (MAPK) and Janus kinase (JNK)/signal transducer and activator of transcription signaling pathways, which play important roles in the proliferation and malignant transformation of various cancer cells, including PCa cells (9). However, the effect of miR-30e on PCa via the MAPK signaling pathway by targeting CHRM3 has not been reported in previous studies. Therefore, the aim of the present study was to investigate the effects of miR-30e by targeting CHRM3 in PCa via the MAPK signaling pathway.

Materials and methods

Bioinformatics prediction and construction of an expression heat map

In the Gene Expression Omnibus (GEO) database (http://www.ncbi.nlm.nih.gov/geo), the GSE55945 dataset, which contained 8 normal control groups and 13 PCa groups, was downloaded by using ‘prostate cancer’ as the key term via the sequencing platform GPL570. Differential analysis of the two sets of samples from four datasets was conducted by the ‘limma’ package of R language. Criteria for screening of the differentially expressed genes included |logFC| >2 and a P-value of <0.05. An expression heat map of the first 10 genes of the GSE55945 dataset was generated by the ‘pheatmap’ package of R language.

Expression of the CHRM3 gene in cholangiocarcinoma by The Cancer Genome Atlas (TCGA) database

The UALCAN (http://ualcan.path.uab.edu) website was used to analyze the gene expression data in TCGA (http://cancergenome.nih.gov/) using RNA-seq and clinical data of 497 tumor samples and 52 normal samples in TCGA. Box and whisker plots illustrated gene expression levels in different cancers and their subtypes/sub-stages. Level 3 TCGA RNA-seq data corresponding to the primary tumor and normal (if available) samples for each gene were represented as box and whisker plots in every TCGA cancer type. The expression of the CHRM3 gene in cholangiocarcinoma was acquired by direct input of CHRM3 in the analysis option and prostate adenocarcinoma in the type of cancer of UALCAN.

Prediction of regulatory miRNAs of CHRM3

Retrieval of regulatory miRNAs of CHRM3 was conducted via input of ‘human’ as the species in TargetScan (http://www.targetscan.org/vert_71/), microRNA.org (http://34.236.212.39/microrna/home.do), mirDIP (http://ophid.utoronto.ca/mirDIP/index.jsp#r) and RNA22 (https://cm.jefferson.edu/rna22/Precomputed/). Conserved sites were selected from the predicted results of TargetScan, all results from microRNA.org were analyzed, a minimum score was selected in mirDIP, and the first 500 RNAs of RNA22 were enrolled in the subsequent analysis. A Venn diagram composition website (http://bioinformatics.psb.ugent.be/webtools/Venn/) was used to construct Venn diagrams for the abovementioned four database analysis results and to determine the intersection of the four database analysis results.

Ethics statement

The study was approved by the Ethics Committee of Zhongnan Hospital, Wuhan University. Written informed consent was obtained from each participant and their families.

Study subjects

A total of 57 PCa tissues and adjacent tissues from patients with PCa (aged 46-70 years, mean age ± standard deviation 54.58±5.06 years) who were admitted to Zhongnan Hospital, WuHan University (Wuhan, China) between January 2015 and January 2017 were enrolled. The clinical stages were as follows: Stage I-II, n=22; stage III-IV, n=35; lymph node metastasis (LNM), n=38; non-LNM, n=19. The Gleason pathological grades were as follows: Grade 2-4, n=18; grade ≥5, n=39. Patients were included if they met the following criteria: Patients who fit into the World Health Organization diagnostic criteria for PCa (10); patients who had not received endocrine treatment, radiotherapy or chemotherapy prior to surgery; patients who had Gleason scores ≥2. Patients were excluded if they had other types of cancer and/or incomplete medical records.

Cell culture, transfection and grouping

PC-3 and DU145 human PCa cells were continuously cultured in a RPMI-1640 culture medium containing 10% fetal bovine serum (FBS) for 72 h at 37°C in a saturated humidified atmosphere of 5% CO2. PC-3 and DU145 cells in the logarithmic growth phase were grouped and transfected. The cells were grouped into the blank (no plasmids transfected), negative control (NC, transfected with 50 nM negative and nonsense sequence), miR-30e mimic (transfected with 50 nM miR-30e mimic sequence), miR-30e inhibitor (transfected with 50 nM miR-30e inhibitor sequence), si-CHRM3 (transfected with 50 nM CHRM3-siRNA plasmid) and miR-30e inhibitors + si-CHRM3 groups (transfected with 50 nM miR-30e inhibitor sequence and 50 nM CHRM3-siRNA plasmid). The inhibitor, mimic and NC of miR-30e were synthesized by Shanghai GenePharma Co., Ltd. (Shanghai, China), and the siRNA of CHRM3 was synthesized by RiboBio Co., Ltd. (Guangzhou, China). Transient transfection was performed using liposome Lipofectamine 2000 (Thermo Fisher Scientific, Inc., Waltham, MA, USA). PC-3 and DU145 cells in the logarithmic growth phase were inoculated in a 12-well culture plate at a density of 1×105 cells/ml 1 day prior to transfection. When cell confluency reached 50-70%, 800 µl serum-free medium was added to each well. A mixture of siRNA (dissolved by Opti-MEM) inhibitor or mimic or CHRM3 and lipo 2000 (11668027) (both from Thermo Fisher Scientific Inc.) was added to a 12-well culture plate. After culture for 6 h, a new culture medium was used for transfection. After 24 h of transfection, cells were collected and RNA was extracted. After cells were cultured for 48 h, they were observed under a fluorescence microscope and protein was extracted for subsequent experiments.

Dual-luciferase reporter gene assays

The target gene analysis of miR-30e was performed using the biological prediction site microRNA.org (http://www.microrna.org/microrna/home.do), and dual-luciferase reporter gene assays were used to determine whether CHRM3 was the direct target gene of miR-30e. The 3′-untranslated region (3′-UTR) of CHRM3 gene was cloned. The PCR product was cloned into a polyclonal site downstream in pmirGLO (E1330; Promega Corp., Madison, WI, USA) with the luciferase gene, named pCHRM3-wild-type (WT). According to bioinformatics, a putative miR-30e binding site in the target gene was predicted. Then, pCHRM3-mutant (Mut) was constructed. The pRL-TK vector expressing Renilla (item E2241; Promega Corp.) was used as a reference to control for differences in cell number and transfection efficiency. miR-30e mimic and NC were co-transfected with luciferase reporter vectors into PCa cells. Then, dual-luciferase reporter assays were performed according to the manufacturer’s instructions (Promega Corp.).

Reverse transcription-quantitative PCR (RT-qPCR) analysis

Total RNA was extracted from 100 mg frozen tissues or cells using the TRIzol™ kit (16096020; Thermo Fisher Scientific Inc., New York, NY, USA). Then, 10 µl RNA samples were diluted with UltraPure RNAse-free H2O by a factor of 20, followed by determination of the absorption values in a UV spectrophotometer at 260 and 280 nm, and detection of the concentration and purity of RNA and volume of total RNA [V = 1.25/optical density (OD) 260 (µl)]. A total of 5 µl Mix (4368702), 5 µl total RNA and 10 µl RNase-free H2O were added to an Eppendorf tube, mixed by centrifugation and reacted in an RT-qPCR instrument. The reaction conditions were as follows: 37°C for 15 min, 85°C for 5 sec, and 4°C for termination. Subsequently, cDNA was generated and stored in a refrigerator at −20°C. An ABI 7500 qPCR system (Applied Biosystems; Thermo Fisher Scientific Inc.) was used for RT-qPCR analysis. The reaction conditions were one cycle of initial denaturation at 95°C for 10 min, 40 cycles of denaturation at 95°C for 10 sec, annealing at 60°C for 20 sec, and elongation at 72°C for 34 sec. Then, SYBR-Green fluorescent dye assays (RR091A; Takara Biotechnology Ltd., Dalian, China) were performed. The primer sequences (Invitrogen; Thermo Fisher Scientific Inc., Shanghai, China) are shown in Table I. U6 was used as an internal reference for miR-30e and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an internal reference for the rest of the genes. Using the relative quantitative method and taking the control group as blank control, the relative mRNA levels of target genes were calculated using the 2−ΔΔCq method: ΔΔCq = ΔCqcase group − ΔCqcontrol group, ΔCq = Cqtarget gene − Cqinternal reference gene. This method was used for subsequent cell experiments. The experiment was repeated 3 times.
Table I

Primer sequences for RT-qPCR.

GenesSequences
miR-30eF: CCCGTTAACAACAAGGAAAGCAGGTGTATGAT
R: CCCTCGAGAAAGTCTAGGAGAAGTGGGCATC
miR-30bF: TGAAAGAGAGAACGATAAATGTT
R: ACTTCTGAATCAAAATATTGGTA
miR-30cF: TGTGTAAACATCCTACACTCTCAG
R: GAGTAAACAACCCTCTCCCA
CHRM3F: CACAATAACAGTACAACCTCGCC
R: GCCAGGATGCCCGTTAAGAAA
p38F: AACATCCTGTCGTCGCCTTAC
R: ACGTGCGTGACCTTAAAGTAGA
ERKF: CGGGGCATCTTCGAGATCG
R: CAGAACAACGCCGTTTCAGTT
JNKF: GGGTATGCCCAAGAGGACAGA
R: GTGTTGGAAAAGTGCGCTGG
c-fosF: ATGGACCAGTGAAGCGATCAT
R: GTTCCTCCAAACTAGAAGCAGC
c-JUNF: AGAGCGGTGCCTACGGCTACAGTAA
R: CGACGTGAGAAGGTCCGAGTTCTTG
GAPDHF: TGTGGGCATCAATGGATTTGG
R: ACACCATGTATTCCGGGTCAAT
U6F: AAAGCAAATCATCGGACGACC
R: GTACAACACATTGTTTCCTCGGA

F, forward; R, reverse; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; miR, microRNA; CHRM3, M3 muscarinic acetylcholine receptor; ERK, extracellular signal-regulated kinase; JNK, c-Jun N-terminal kinase; GAPDH, glyceraldehyde phosphate dehydrogenase.

Western blot analysis

The concentrations of proteins extracted from tissues and cells were determined using the BCA Protein Assay Kit (Wuhan Boster Biological Technology, Ltd., Wuhan, China) according to the manufacturer’s instructions. Extracted proteins were mixed with the loading buffer and boiled at 95°C for 10 min, followed by the addition of 30 µg protein to each well of a 10% polyacrylamide gel (Wuhan Boster Biological Technology, Ltd.). After electrophoresis at 80-120 V, the protein was transferred to a polyvinylidene fluoride membrane (100 mV for 45-70 min). The membrane was blocked with 5% bovine serum albumin for 1 h and then incubated with the following primary antibodies overnight at 4°C: CHRM3 (dilution 1:1,000, ab126128), P38 (diluted 1:1,000, ab170099), extracellular signal-regulated kinase (ERK; dilution 1:100, ab54230), JNK (dilution 1:1,000, ab124956), c-fos (dilution 1:1,000, ab134122), c-JUN (dilution 1:1,000, ab31419), p-P38 (dilution 1:1,000, ab47363), p-ERK (dilution 1:100, ab214362), p-JNK (dilution 1:1,000, ab219584), p-c-fos (dilution 1:1,000, ab27793), p-c-JUN (dilution 1:1,000, ab30620) and β-actin (dilution 1:1,000, ab16039). All primary antibodies were purchased from Abcam (Cambridge, MA, USA). After washing with Tris-buffered saline with Tween-20 (TBST) three times (5 min each time), the membrane was incubated with secondary antibodies (dilution 1:2,000; Wuhan Boster Biological Technology, Ltd.) for 1 h and then washed with TBST three times (5 min each time). Proteins were detected by chemiluminescence, and the relative protein expression level was expressed by the ratio of the gray value of the target protein band to the gray value of the internal reference, with β-actin as the internal reference. The experiment was repeated 3 times.

3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay

The experiment was performed in a 96-well culture plate. Each well contained 40 µg Matrigel for 1 h at 37°C. The plate was blocked and washed with RPMI-1640 containing 20% FBS; then, cells from each group were added at a density of 2.0×104 cell/well at 37°C in a saturated humidified atmosphere of 5% CO2. The non-adherent cells were washed off with phosphate-buffered saline (PBS) at 30, 60, 90, 120, 150 and 180 min, followed by replacement with serum-free RPMI-1640 medium and addition of 20 µl MTT solution (5 g/l) for continuous culture for 4 h. Then, the culture medium was absorbed, and 150 µl dimethyl sulfoxide (DMSO) was added. After 10 min, the absorbance value (A value) at 590 nm was measured using a microplate reader (Thermo Fisher Scientific, Inc., Waltham, MA, USA). The A value reflects the cell adhesion force (the higher the A value, the stronger the cell adhesion). The experiment was repeated 3 times.

Scratch test

The transfected cells in each group were seeded in a 6-well plate with 5×105 cells in each well. When the cell confluence was ~90%, a thin wound was created along the center of each well with a sterile pipette tip. After removal of the floating cells by washing in PBS, serum-free medium was added and incubated for 0.5-1 h to recover the cells. After the cells were restored, they were photographed at 0 and 48 h, and 4 images of each well were captured. Image-Pro-Plus 6 software (Media Cybernetics, Inc., Rockville, MD, USA) was used to analyze the cell scratch width, and then cell mobility was calculated as follows: Cell migration rate (%) = (scratch width at 48 h/scratch width at 0 h) ×100%. The experiment was repeated 3 times.

Transwell assay

Matrigel (BD Biosciences, Franklin Lakes, NJ, USA) diluted by pre-cooled and serum-free Dulbecco’s modified Eagle’s medium (DMEM)/F12 medium was added to a culture chamber containing an 8-µm small polycarbonate membrane, followed by the addition of 100 µl serum-free medium-diluted LNCaP cells (5×105 cells/ml). Then, 600 µl DMEM/F12 medium containing 10% serum was added to the lower chamber, and each culture was set up in triplicate for 24 h at 37°C in a saturated humidified atmosphere of 5% CO2. Subsequently, the chamber was taken out, fixed with methanol for 20 min, and then stained with 0.1% crystal violet solution for 20 min. Matrigel and non-invasive cells on the upper surface of the chamber were removed using wet swabs. Then, the chamber was inverted and the number of cells transferred to the basement membrane was counted in 3 random fields under an optical microscope (magnification, ×100). The experiment was repeated 3 times.

Flow cytometry

After transfection for 24 h, cells were rinsed with PBS once, the culture medium was discarded, cells were detached by 0.25% trypsin solution and the digested material was discarded. When the cells were observed to shrink and become round under the microscope, serum medium was added to stop digestion. Then, the cells were dissociated to decrease the cell attachment and create a mixed cell suspension. The suspension was centrifuged at 118 × g for 5 min, the supernatant was discarded, and the samples were rinsed by PBS twice, fixed with pre-cooled 70% ethanol for 30 min, and centrifuged again. Then, the cells were collected, rinsed by PBS, combined with 1% propidium iodide (PI) containing RNA enzyme for staining for 30 min, and then rinsed with PBS twice to remove PI. The volume was adjusted to 1 ml by PBS. The samples were then assessed by BD-Aria flow cytometry (FACSCalibur; BD Biosciences) for cell cycle detection. There were 3 samples in each group, and the experiment was repeated 3 times.

Statistical analysis

Statistical analyses were conducted by using SPSS 21.0 (IBM Corporation, Armonk, NY, USA). The results are expressed as the mean ± standard deviation. Differences between PCa tissues and adjacent tissues were compared by paired t-tests. Differences between two groups were compared by independent sample t-tests. Multiple groups were compared by one-way analysis of variance followed by Tukey’s post-hoc test. Pearson’s correlation analysis was used to analyze the correlation between miR-30e and CHRM3. A P<0.05 was considered to indicate statistically significant differences.

Results

Has-miR-30e-5p and CHRM3 analysis

Differential analysis of GSE55945 PCa chip data in the GEO database revealed 532 differentially expressed genes, among which 184 genes were highly expressed and 348 genes were poorly expressed in PCa. In addition, an expression heat map of the differentially expressed genes was established (Fig. 1A). Bibliographic retrieval of the functions of the differentially expressed genes in the expression heat map showed that hepsin was highly expressed in PCa (11-14). The SLC16A2, FNDC4 and RAB17 genes were not found to be correlated with PCa. Among the differentially expressed genes, CHRM3 has been confirmed to promote PCa by previous studies (15,16). In the analysis of the gene chip data, CHRM3 was also highly expressed in PCa tissues and cells. Moreover, analysis of CHRM3 in PCa in TCGA database revealed high expression levels (Fig. 1B). These results suggest that CHRM3 likely promotes the progression of PCa. Retrieval of PCa-related signaling pathways revealed that the MAPK signaling pathway plays an important role in PCa (17-19). However, whether CHRM3 affects the MAPK signaling pathway in PCa and the underlying mechanism remain to be further investigated. Regulatory miRNAs of CHRM3 were retrieved in the miRNA databases to further investigate the mechanism of action of CHRM3. The analysis identified 7 miRNAs in the microRNA. org database, 67 miRNAs belonging to conserved sites in the TargetScan database, 12 minimum score miRNAs belonging to very high in mirDIP, and 2,183 miRNAs in the RNA22 database, from which the first 500 miRNAs were selected. Venn analysis of the prediction results of the abovementioned four databases (Fig. 1C) revealed that has-miR-30c-5p, has-miR-30b-5p and has-miR-30e-5p appeared in the prediction results. Further literature search of studies on the association between the three miRNAs and PCa revealed that miR-30b and miR-30c were implicated in PCa (20,21). miR-30c regulated alternative splicing factor/splicing factor 2 (ASF/SF2), thereby affecting the progression of PCa. Interestingly, in the majority of the studies, miR-30e-5p exerted tumor-suppressive effects (22,23), but one study demonstrated that miR-30e-3p may promote PCa (6), while the detailed role and mechanisms of action of miR-30e-5p in PCa have not been reported to date. Therefore, has-miR-30e-5p was selected for subsequent experiments. RT-qPCR was performed to detect the levels of has-miR-30c-5p, has-miR-30b-5p and has-miR-30e-5p in the PCa cell lines PC-3 and DU145, and the results demonstrated that the miR-30e-5p expression was the lowest in the PC-3 and DU145 cell lines (Fig. 1D). Next, western blot analysis was performed to determine the levels of has-miR-30c-5p, has-miR-30b-5p, has-miR-30e-5p and CHRM3, and the results demonstrated that miR-30e suppressed the expression of CHRM3 in PCa cells (Fig. 1E).
Figure 1

Analysis of levels of CHRM3 and regulatory miRNAs of CHRM3 in PCa. (A) Differential analysis of GSE55945 chip data; the transverse coordinates represent the number of samples, an expression heat map of the differentially expressed genes was established, and the ordinate indicates the names of the differentially expressed genes. The upper right histogram represents color; from top to bottom, the color change indicates changes of expression in microarray data from large to small. Each rectangle in the graph corresponds to the expression value of a sample. Each column represents the expression of all the genes in each sample. The tree diagram on the left shows the results of cluster analysis of different genes from different samples, the top bars represent sample type, blue representing normal control samples, and red representing prostate cancer samples. (B) analysis of levels of CHRM3 in PCa in TCGA database exhibiting high levels of CHRM3. The left blue box graph represents the expression of CHRM3 in the 52 normal samples of TCGA database. The red box on the right shows the expression of CHRM3 in the 497 prostate cancer samples in TCGA database; *P<0.001. (C) has-miR-30c-5p, has-miR-30b-5p and has-miR-30e-5p appeared in the prediction results of four databases. The intersection of the results of the four databases was taken; blue represents prediction result of regulatory miRNAs of CHRM3 in microRNA.org, red represents prediction result of regulatory miRNAs of CHRM3 in TargetScan, green represents prediction results of regulatory miRNAs of CHRM3 in mirDIP, and yellow represents prediction result of regulatory miRNAs of CHRM3 in the RNA22 database. The blue arrow is the intersection of four database prediction results. (D) RT-qPCR was performed to detect the levels of has-miR-30c-5p, has-miR-30b-5p and has-miR-30e-5p in the PCa cell lines PC-3 and DU145, and the results demonstrated that the miR-30e-5p expression was the lowest in the PC-3 and DU145 cell lines. (E) Western blot analysis was performed to investigate the levels of has-miR-30c-5p, has-miR-30b-5p, has-miR-30e-5p and CHRM3, and the results demonstrated that miR-30e inhibited the expression of CHRM3 in PCa cells; *P<0.05; miR-30e, microRNA-30e; CHRM3, M3 muscarinic acetylcholine receptor; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; PCa, prostate cancer; TCGA, The Cancer Genome Atlas.

Low levels of miR-30e and high levels of CHRM3 are detected in PCa tissues

Next, the levels of miR-30e and CHRM3 were evaluated using RT-qPCR and western blot analysis. The results of RT-qPCR revealed that the PCa tissues had lower levels of miR-30e and higher mRNA levels of CHRM3 compared with the adjacent normal tissues (both P<0.05; Fig. 2A and B). Pearson’s correlation analysis revealed that miR-30e was negatively correlated with the mRNA levels of CHRM3 (r<0, P<0.05) (Fig. 2C). Taken together, all these data indicate that miR-30e is downregulated and CHRM3 is upregulated in PCa tissues and cell lines.
Figure 2

RT-qPCR and western blot analysis revealed low levels of miR-30e and high levels of CHRM3 in PCa tissues, and miR-30e was negatively correlated with the mRNA levels of CHRM3. (A) The results of RT-qPCR demonstrated lower levels of miR-30e in PCa tissues compared with the adjacent tissues. (B) The results of RT-qPCR demonstrated higher mRNA levels of CHRM3 in PCa tissues compared with the adjacent tissues. (C) Pearson’s correlation analysis showed that miR-30e was negatively correlated with the mRNA levels of CHRM3 in PCa tissues; n=57; P<0.01, P<0.001 were considered significant; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; miR-30e, microRNA-30e; CHRM3, M3 muscarinic acetylcholine receptor; PCa, prostate cancer.

CHRM3 is a target gene of miR-30e

To verify the downregulation of miR-30e on CHRM3 levels, this study was conducted using microRNA.org, an online bioinformatics software. The results identified CHRM3 as a downstream target gene of miR-30e. A WT CHRM3 plasmid, expressing a wild-type site for miR-30e binding, and a MUT CHRM3 plasmid, expressing a mutant site, were designed (Fig. 3A). The dual luciferase reporter gene assays revealed that the luciferase activity of the WT CHRM3 WT-3′-UTR co-transfection group decreased by ~45% in the miR-30e transfection group compared with the NC group (P<0.05), while the signal of MUT CHRM3 MUT-3′-UTR luciferase did not significantly decrease when compared with the NC group (P>0.05; Fig. 3B), indicating that CHRM3 is a potential target gene for miR-30e.
Figure 3

Biological information prediction and double luciferase reporter gene assays revealed that CHRM3 is a target gene of miR-30e. (A) miR-30e combined with CHRM3-3′-UTR predicted by a public database. (B) Dual-luciferase reporter gene assays revealed that CHRM3 is a potential target gene of miR-30e; *P<0.001 compared with WT + mimic. WT, wild-type; MT, mutant; UTR, untranslated region; miR-30e, microRNA-30e; CHRM3, M3 muscarinic acetylcholine receptor; PCa, prostate cancer.

miR-30e lowers the levels of CHRM3 in PCa cells

To investigate the effects of miR-30e on CHRM3, RT-qPCR and western blot analysis were performed. The results demonstrated that, compared with the blank and NC groups, the mRNA and protein levels of CHRM3 in the miR-30e mimic and si-CHRM3 groups were downregulated (P<0.05), but they were upregulated following transfection with a miR-30e inhibitor (P<0.05). Compared with the si-CHRM3 group, the mRNA and protein levels of CHRM3 in the miR-30e inhibitor + si-CHRM3 group notably increased (P<0.05), while there was no statistically significant difference in the mRNA and protein levels of CHRM3 between the blank and NC groups (P<0.05; Fig. 4). These results suggested that miR-30e lowered the levels of CHRM3 in PCa cells.
Figure 4

The results of RT-qPCR and western blot analysis revealed that miR-30e inhibits the expression of CHRM3 in PCa cells. (A) The mRNA level of miR-30e in the miR-30e mimic and si-CHRM3 groups was downregulated. (B) The protein level of CHRM3 in the miR-30e inhibitor + si-CHRM3 group was obviously increased. Blank group, no plasmids were transfected; negative control (NC) group, transfected with 50 nM negative and nonsense sequence; miR-30e mimic group, transfected with 50 nM miR-30e mimic sequence; miR-30e inhibitor group, transfected with 50 nM miR-30e inhibitor sequence; si-CHRM3 group, transfected with 50 nM CHRM3-siRNA plasmid; miR-30e inhibitors + si-CHRM3 group, transfected with 50 nM miR-30e inhibitor sequence and 50 nM CHRM3-siRNA plasmid. *P<0.05 compared with the blank and NC groups; #P<0.05 compared with the si-CHRM3 + miR-30e inhibitor group. RT-qPCR, reverse transcription-quantitative polymerase chain reaction; miR-30e, microRNA-30e; CHRM3, M3 muscarinic acetylcholine receptor; PCa, prostate cancer.

Upregulation of miR-30e suppresses the MAPK signaling pathway and its downstream genes by downregulating CHRM3 in PCa cells

In addition, to investigate the effects of miR-30e on MAPK, RT-qPCR and western blot analysis were performed. The results (Fig. 5) demonstrated that, compared with the blank and NC groups, the levels of p38, ERK, JUN, c-fos, c-JUN and phosphorylated proteins (p-P38, p-ERK, p-JNK, p-c-fos and p-c-JUN) of the MAPK signaling pathway notably decreased in the miR-30e mimic and si-CHRM3 groups, while the levels of the MAPK signaling pathway genes (p38, ERK and JUN) and downstream genes (c-fos and c-JUN) significantly increased in the miR-30e inhibitor group (all P<0.05). In comparison to the miR-30e inhibitor + si-CHRM3 group, the miR-30e inhibitor group exhibited increased levels of the MAPK signaling pathway genes (p38, ERK and JUN) and downstream genes (c-fos and c-JUN), while the si-CHRM3 group exhibited reduced levels of p38, ERK, JUN, c-fos, c-JUN and phosphorylated proteins (p-P38, p-ERK, p-JNK, p-c-fos and p-c-JUN) of the MAPK signaling pathway (all P<0.05). These results indicate that miR-30e downregulated the levels of the MAPK signaling pathway genes (p38, ERK and JUN) and downstream genes (c-fos and c-JUN) by targeting CHRM3 in PCa cells.
Figure 5

Upregulation of miR-30e lowers the levels of the MAPK signaling pathway genes (p38, ERK and JUN) and downstream genes (c-fos and c-JUN) via CHRM3 in PCa cells as shown by RT-qPCR and western blot analysis. (A) Τhe miR-30e inhibitor group had increased levels of the signaling pathway genes (p38, ERK and JUN) and downstream genes (c-fos and c-JUN) of the MAPK signaling pathway. (B) The si-CHRM3 group exhibited reduced levels of p38, ERK, JUN, c-fos, c-JUN and phosphorylated proteins (p-P38, p-ERK, p-JNK, p-c-fos and p-c-JUN) of the MAPK signaling pathway. (C) Gray values of the related proteins oν western blot analysis; blank group, no plasmids were transfected; negative control (NC) group, transfected with 50 nM negative and nonsense sequence; miR-30e mimic group, transfected with 50 nM miR-30e mimic sequence; miR-30e inhibitor group, transfected with 50 nM miR-30e inhibitor sequence; si-CHRM3 group, transfected with 50 nM CHRM3-siRNA plasmid; miR-30e inhibitors + si-CHRM3 group, transfected with 50 nM miR-30e inhibitor sequence and 50 nM CHRM3-siRNA plasmid. *P<0.05 compared with the blank and NC groups; #P<0.05 compared with the si-CHRM3 + miR-30e inhibitor group. RT-qPCR, reverse transcription-quantitative polymerase chain reaction; miR-30e, microRNA-30e; CHRM3, M3 muscarinic acetylcholine receptor; PCa, prostate cancer; ERK, extracellular signal-regulated kinase; JNK, c-Jun N terminal kinase.

Upregulation of miR-30e reduces adhesion of PCa cells

MTT assays were conducted to investigate the effects of miR-30e on the adhesion of PCa cells, and the results revealed that there was no significant difference in the adhesion of PCa cells between the blank and NC groups (P>0.05). Compared with the blank and NC groups, the adhesion of PCa cells was significantly decreased in the miR-30e mimic and si-CHRM3 groups and notably increased in the miR-30e inhibitor group (P<0.05), with no significant difference observed in the miR-30e inhibitor + si-CHRM3 group (P>0.05). The miR-30e inhibitor group exhibited a significant increase in adhesion of PCa cells and the si-CHRM3 group demonstrated an obvious decrease of the adhesion of PCa cells compared with the miR-30e inhibitor + si-CHRM3 group (P<0.05; Fig. 6). All these data suggest that upregulation of miR-30e reduces adhesion of PCa cells.
Figure 6

Upregulation of miR-30e is involved in the inhibition of the adhesion process of DU145 and PC-3 cells as determined by MTT assays. Blank group, no plasmids were transfected; negative control (NC) group, transfected with 50 nM negative and nonsense sequence; miR-30e mimic group, transfected with 50 nM miR-30e mimic sequence; miR-30e inhibitor group, transfected with 50 nM miR-30e inhibitor sequence; si-CHRM3 group, transfected with 50 nM CHRM3-siRNA plasmid; miR-30e inhibitors + si-CHRM3 group, transfected with 50 nM miR-30e inhibitor sequence and 50 nM CHRM3-siRNA plasmid. MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; miR-30e, microRNA-30e; CHRM3, M3 muscarinic acetylcholine receptor; ERK, extracellular signal-regulated kinase; MAPK, mitogen-activated protein kinase; JNK, c-Jun N terminal kinase; PCa, prostate cancer.

Upregulation of miR-30e inhibits migration and invasion of PCa cells

To investigate the effects of miR-30e on migration and invasion of PCa cells, scratch tests and Transwell assays were performed. The scratch test (Fig. 7A) and Transwell assay (Fig. 7B) results demonstrated that, compared with the blank and NC groups, the migration and invasion of PCa cells significantly decreased in the miR-30e mimic and si-CHRM3 groups, while they markedly increased in the miR-30e inhibitor group (P<0.05). The si-CHRM3 group exhibited an obvious decrease in the migration and invasion of PCa cells, while the miR-30e inhibitor group exhibited a significant increase in the migration and invasion of PCa cells compared with the miR-30e inhibitor + si-CHRM3 group (P<0.05). All these results indicate that upregulation of miR-30e inhibits the migration and invasion of PCa cells.
Figure 7

Upregulation of miR-30e inhibits migration and invasion of PCa cells as verified by scratch tests and Transwell assays. (A) Upregulation of miR-30e inhibits the migration of DU145 and PC-3 cells as shown by the scratch test. (B) Upregulation of miR-30e inhibits invasion of DU145 and PC-3 cells as shown by Transwell assays; *P<0.05 compared with the blank and negative control (NC) groups; #P<0.05 compared with the si-CHRM3 + miR-30e inhibitor group. miR-30e, microRNA-30e; CHRM3, M3 muscarinic acetylcholine receptor; PCa, prostate cancer.

Upregulation of miR-30e suppresses cell cycle progression of PCa cells

Finally, flow cytometry analysis was performed to investigate the effect of miR-30e on cell cycle progression of PCa cells. The results of PI single-staining indicated that there was no significant difference in the cell cycle distribution between the blank and NC groups (P>0.05). Compared with the blank and NC groups, the number of cells in the G1 phase was obviously increased and the number of cells in the S phase was significantly decreased in the miR-30e mimic and si-CHRM3 groups (P<0.05), while the results observed in the miR-30e inhibitor group were the opposite (P<0.05). There was no significant difference among the blank, NC and miR-30e inhibitor + si-CHRM3 groups (P>0.05; Fig. 8). These data indicate that upregulation of miR-30e suppresses cell cycle progression of PCa cells.
Figure 8

Upregulation of miR-30e inhibits cell cycle progression of DU145 and PC-3 cells as shown by PI single staining. (A) The number of cells in the G1 phase obviously increased and the number of cells in the S phase markedly decreased in the miR-30e mimic and si-CHRM3 groups, while the results in the miR-30e inhibitor group were the opposite. (B) Upregulation of miR-30e decreased the number of cells in the S phase, while it increased the number of cells in the G0 and G1 phases. *P<0.05 compared with the blank and negative control (NC) groups; miR-30e, microRNA-30e; CHRM3, M3 muscarinic acetylcholine receptor; PCa, prostate cancer.

Discussion

Conventional treatments for PCa include surgery, hormone ablation, radiation and chemotherapy, which have been found to be ineffective for patients with advanced and/or metastatic disease. In the majority of the cases, the failure of cancer treatment is due to incomplete eradication of tumor cells, leading to tumor recurrence (24). Recent research revealed that miRNAs may act as key mediators of the pathogenic and pathological processes of PCa (25,26). Moreover, abnormal expression of miRNAs may activate several signaling pathways; for example, miR-30e-5p may regulate the activation of MAPK (27,28). Based on these facts, we investigated whether miR-30 inhibited the adhesion, migration, invasion and cell cycle progression of PCa cells through the inhibition of the MAPK signaling pathway by targeting CHRM3. In the present study, decreased miR-30e and increased CHRM3 levels were found in PCa tissues. In PCa, dysregulation of miRNAs has been found to be associated with disease development, invasion and metastasis (29,30). A previous study reported that miR-30e was a novel clinical target, the overexpression of which resulted in decreased K562 cell proliferation (31). In addition, a recent study reported that inhibition of CHRM3 plays a growth-suppressive role in the proliferation and growth of PCa cells (15). Furthermore, suppression of CHRM3 by shRNA or treatment with darifenacin contributed to the inhibition of growth and castration resistance of PCa cells (7). Therefore, it may be inferred that CHRM3 and miR-30e are involved in the pathogenic and pathological aspects of PCa. It was reported that miRNAs may affect the behavior of malignant cells by downregulating a variety of target genes and regulating the downstream signaling pathways (32). In the present study, the results demonstrated that miR-30e inhibited the MAPK signaling pathway in PCa cells. MAPK is an important pathway in the occurrence and development of PCa; in addition, the MAPK pathway not only plays key roles in cell proliferation, differentiation and gene expression in different cells, but also plays an important role in the growth and metastasis of PCa, as its inhibition suppresses the growth of PCa cells (33,34). In a recent study, miR-30a-5p was reported to improve the inflammatory responses of spinal cord injury through inhibiting the MAPK/ERK signaling pathway (35). Therefore, it may be concluded that miR-30e suppresses the MAPK signaling pathway. Overexpression of miR-30e was shown to inhibit the adhesion, migration, invasion and cell cycle progression of PCa cells via inhibiting CHRM3 and suppressing the activation of the MAPK signaling pathway. miR-30e has 7,931 predicted targets in total, some of which play key roles in PCa, including JNK and the tumor suppressor genes phosphatase and tensin homolog, RB1 and NF-κB inhibitor-interacting Ras-like protein 1, an additional inhibitor of NF-κB (6). A recent study reported that the majority of primary PCas may be classified into 7 subtypes that are defined by specific gene mutation/fusions, whereas overexpression of mir-30e is associated with all subtypes of adjacent healthy tissue and is further enhanced in 3/6 of the subtypes delimited by ERG, ETV1 and SPOP fusion proteins, indicating that miR-30e is overexpressed in PCa (36). Moreover, miR-30e was found to be downregulated in normal human hair dermal papilla cells (nHHDPCs), thus leading to a decrease in the proliferation and viability of the nHHDPCs (37). A previous study demonstrated that miR-30c may serve as a tumor suppressor for PCa through suppressing tumor cell proliferation, migration and invasion (38). In addition, miR-30c inhibited PCa tumorigenesis by targeting ASF/SF2 (39). A previous study reported that CHRM3 may activate the MAPK signaling pathway in PCa (16). Importantly, upregulation of miR-30 together with triptolide may protect podocytes by silencing p38 MAPK activation (40). Therefore, it may be concluded that overexpression of miR-30e may result in the downregulation of CHRM3, which suppresses the adhesion, migration, invasion and cell cycle progression of PCa cells via the MAPK signaling pathway. In conclusion, the results of the present study suggest that miR-30e inhibits the adhesion, migration, invasion and cell cycle progression of PCa cells via suppressing CHRM3 expression and activating the MAPK signaling pathway (Fig. 9). However, the effects of miR-30e on PCa through the MAPK signaling pathway mediated by CHRM3 were only investigated in vitro (PCa cells). In the future, these results must be verified in in vivo experiments to provide a basis for the development of novel treatments for PCa.
Figure 9

miR-30e inhibits adhesion, migration, invasion and cell cycle progression of PCa cells via suppressing CHRM3 expression and activation of the MAPK signaling pathway. The miR-30e mimic inhibited the expression of the CHRM3 gene and inhibited the activation of the MAPK signaling pathway, including the phosphorylation of ERK and JNK, and inhibited the activation of downstream c-fos and JUN, thereby inhibiting the adhesion, migration and invasion of PCa cells. CHRM3, M3 muscarinic acetylcholine receptor; PCa, prostate cancer; MAPK, mitogen-activated protein kinase; ERK extracellular signal-regulated kinase; JNK, c-Jun N terminal kinase.

  39 in total

1.  Activation of MAPK signaling pathway is essential for Id-1 induced serum independent prostate cancer cell growth.

Authors:  Ming-Tat Ling; Xianghong Wang; Xue-Song Ouyang; Terence K W Lee; Tian-Yong Fan; Kexin Xu; Sai-Wah Tsao; Y C Wong
Journal:  Oncogene       Date:  2002-12-05       Impact factor: 9.867

Review 2.  Hepsin and prostate cancer.

Authors:  Qingyu Wu; Gordon Parry
Journal:  Front Biosci       Date:  2007-09-01

3.  Detection of early prostate cancer using a hepsin-targeted imaging agent.

Authors:  Kimberly A Kelly; Sunita R Setlur; Robert Ross; Rajesh Anbazhagan; Peter Waterman; Mark A Rubin; Ralph Weissleder
Journal:  Cancer Res       Date:  2008-04-01       Impact factor: 12.701

4.  Expression profiling reveals hepsin overexpression in prostate cancer.

Authors:  J A Magee; T Araki; S Patil; T Ehrig; L True; P A Humphrey; W J Catalona; M A Watson; J Milbrandt
Journal:  Cancer Res       Date:  2001-08-01       Impact factor: 12.701

5.  Integrative genomic profiling of human prostate cancer.

Authors:  Barry S Taylor; Nikolaus Schultz; Haley Hieronymus; Anuradha Gopalan; Yonghong Xiao; Brett S Carver; Vivek K Arora; Poorvi Kaushik; Ethan Cerami; Boris Reva; Yevgeniy Antipin; Nicholas Mitsiades; Thomas Landers; Igor Dolgalev; John E Major; Manda Wilson; Nicholas D Socci; Alex E Lash; Adriana Heguy; James A Eastham; Howard I Scher; Victor E Reuter; Peter T Scardino; Chris Sander; Charles L Sawyers; William L Gerald
Journal:  Cancer Cell       Date:  2010-06-24       Impact factor: 31.743

Review 6.  MicroRNAs in development and disease.

Authors:  Danish Sayed; Maha Abdellatif
Journal:  Physiol Rev       Date:  2011-07       Impact factor: 37.312

7.  Circulating microRNAs (miRNA) in serum of patients with prostate cancer.

Authors:  Robert Mahn; Lukas C Heukamp; Sebastian Rogenhofer; Alexander von Ruecker; Stefan C Müller; Jörg Ellinger
Journal:  Urology       Date:  2011-05       Impact factor: 2.649

8.  Delineation of prognostic biomarkers in prostate cancer.

Authors:  S M Dhanasekaran; T R Barrette; D Ghosh; R Shah; S Varambally; K Kurachi; K J Pienta; M A Rubin; A M Chinnaiyan
Journal:  Nature       Date:  2001-08-23       Impact factor: 49.962

9.  Detection of microRNAs in prostate cancer cells by microRNA array.

Authors:  Xiaoqing Tang; Xiaohu Tang; Jozsef Gal; Natasha Kyprianou; Haining Zhu; Guiliang Tang
Journal:  Methods Mol Biol       Date:  2011

Review 10.  Signal integration by JNK and p38 MAPK pathways in cancer development.

Authors:  Erwin F Wagner; Angel R Nebreda
Journal:  Nat Rev Cancer       Date:  2009-08       Impact factor: 60.716

View more
  10 in total

1.  The Role of MiRNA in Cancer: Pathogenesis, Diagnosis, and Treatment.

Authors:  Erez Uzuner; Gizem Tugçe Ulu; Sevim Beyza Gürler; Yusuf Baran
Journal:  Methods Mol Biol       Date:  2022

2.  Transmembrane Domain 3 Is a Transplantable Pharmacophore in the Photodynamic Activation of Cholecystokinin 1 Receptor.

Authors:  Yuan Li; Zong Jie Cui
Journal:  ACS Pharmacol Transl Sci       Date:  2022-07-08

Review 3.  Muscarinic Receptors Associated with Cancer.

Authors:  Gloria M Calaf; Leodan A Crispin; Juan P Muñoz; Francisco Aguayo; Tammy C Bleak
Journal:  Cancers (Basel)       Date:  2022-05-07       Impact factor: 6.575

4.  Research trends for papillary thyroid carcinoma from 2010 to 2019: A systematic review and bibliometrics analysis.

Authors:  Fengyan Huang; Lihua Wang; Hongying Jia
Journal:  Medicine (Baltimore)       Date:  2021-05-28       Impact factor: 1.817

5.  Dexmedetomidine Attenuates Monocyte-Endothelial Adherence via Inhibiting Connexin43 on Vascular Endothelial Cells.

Authors:  Yunfei Chai; Runying Yu; Yong Liu; Sheng Wang; Dongdong Yuan; Jimei Chen
Journal:  Mediators Inflamm       Date:  2020-02-10       Impact factor: 4.711

6.  Eicosapentaenoic Acid Regulates Inflammatory Pathways through Modulation of Transcripts and miRNA in Adipose Tissue of Obese Mice.

Authors:  Theresa Ramalho; Mandana Pahlavani; Nishan Kalupahana; Nadeeja Wijayatunga; Latha Ramalingam; Sonia Jancar; Naima Moustaid-Moussa
Journal:  Biomolecules       Date:  2020-09-07

7.  Biological evaluation of linalool on the function of blood vessels.

Authors:  Yunyu Liang; Yan Zhong; Xinmei Li; Yingying Xiao; Yu Wu; Pingchang Xie
Journal:  Mol Med Rep       Date:  2021-10-29       Impact factor: 2.952

Review 8.  Cholinergic blockade of neuroinflammation: from tissue to RNA regulators.

Authors:  Tamara Zorbaz; Nimrod Madrer; Hermona Soreq
Journal:  Neuronal Signal       Date:  2022-02-11

9.  Anticancer function of microRNA-30e is mediated by negative regulation of HELLPAR, a noncoding macroRNA, and genes involved in ubiquitination and cell cycle progression in prostate cancer.

Authors:  Kavya Ganapathy; Christopher Ngo; Thomas Andl; Domenico Coppola; Jong Park; Ratna Chakrabarti
Journal:  Mol Oncol       Date:  2022-06-14       Impact factor: 7.449

10.  RNA sequencing profiles and diagnostic signatures linked with response to ramucirumab in gastric cancer.

Authors:  Maxim Sorokin; Elena Poddubskaya; Madina Baranova; Alex Glusker; Lali Kogoniya; Ekaterina Markarova; Daria Allina; Maria Suntsova; Victor Tkachev; Andrew Garazha; Marina Sekacheva; Anton Buzdin
Journal:  Cold Spring Harb Mol Case Stud       Date:  2020-04-01
  10 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.