Arul Subramanian1, Lauren Fallon Kanzaki1, Jenna Lauren Galloway2, Thomas Friedrich Schilling1. 1. Department of Developmental and Cell Biology, University of California, Irvine, Irvine, United States. 2. Center for Regenerative Medicine, Department of Orthopaedic Surgery, Massachusetts General Hospital, Harvard Stem Cell Institute, Boston, United States.
Abstract
Mechanical forces between cells and extracellular matrix (ECM) influence cell shape and function. Tendons are ECM-rich tissues connecting muscles with bones that bear extreme tensional force. Analysis of transgenic zebrafish expressing mCherry driven by the tendon determinant scleraxis reveals that tendon fibroblasts (tenocytes) extend arrays of microtubule-rich projections at the onset of muscle contraction. In the trunk, these form a dense curtain along the myotendinous junctions at somite boundaries, perpendicular to myofibers, suggesting a role as force sensors to control ECM production and tendon strength. Paralysis or destabilization of microtubules reduces projection length and surrounding ECM, both of which are rescued by muscle stimulation. Paralysis also reduces SMAD3 phosphorylation in tenocytes and chemical inhibition of TGFβ signaling shortens tenocyte projections. These results suggest that TGFβ, released in response to force, acts on tenocytes to alter their morphology and ECM production, revealing a feedback mechanism by which tendons adapt to tension.
Mechanical forces between cells and extracellular matrix (ECM) influence cell shape and function. Tendons are ECM-rich tissues connecting muscles with bones that bear extreme tensional force. Analysis of transgenic zebrafish expressing mCherry driven by the tendon determinant scleraxis reveals that tendon fibroblasts (tenocytes) extend arrays of microtubule-rich projections at the onset of muscle contraction. In the trunk, these form a dense curtain along the myotendinous junctions at somite boundaries, perpendicular to myofibers, suggesting a role as force sensors to control ECM production and tendon strength. Paralysis or destabilization of microtubules reduces projection length and surrounding ECM, both of which are rescued by muscle stimulation. Paralysis also reduces SMAD3 phosphorylation in tenocytes and chemical inhibition of TGFβ signaling shortens tenocyte projections. These results suggest that TGFβ, released in response to force, acts on tenocytes to alter their morphology and ECM production, revealing a feedback mechanism by which tendons adapt to tension.
Cells in all multicellular organisms are exposed to mechanical forces through adhesions to neighboring cells and to the extracellular matrix (ECM), as well as the ebb and flow of the environment. Force has been shown to influence cellular processes such as cell division, survival, migration, and differentiation (Behrndt et al., 2012; Culver and Dickinson, 2010; Hamada, 2015; Keller et al., 2008; Roman and Pekkan, 2012). Cellular responses to force include the activation of cell surface receptors such as integrins (Itgs), G-protein-coupled receptors (GPCRs), transient receptor potential (TRP) ion channels, and Piezo channels (Busch et al., 2017; Chachisvilis et al., 2006; Maartens and Brown, 2015; Mederos y Schnitzler et al., 2008; Popov et al., 2015; Wu et al., 2017). Despite recent insights into the nature of such responses, few in vivo studies have investigated how cells adapt to force and alter the ECM landscape to strengthen or weaken it accordingly (Maeda et al., 2011; Ng et al., 2014).The musculoskeletal system bears among the strongest forces experienced by any tissue, such as the tensional forces exerted upon tendons and ligaments (Heinemeier et al., 2013; Wang, 2006). Tendons can withstand such forces due to the specialized organization of collagen (Col) fibers and proteoglycans within each tendon fibril. Tendon injuries are extremely common and debilitating, especially in athletes, the elderly, and patients with neuromuscular diseases such as muscular dystrophy (Bönnemann, 2011; Walden et al., 2017). Despite their prevalence, little is known about how tendon fibroblasts (tenocytes) respond in vivo to tensional force at muscle attachments, or how they adapt to changes in mechanical load. Tendons form a variety of attachment sites - connecting muscles to cartilages and bones as well as other muscles and soft tissues. A myotendinous junction (MTJ) is a specialized ECM-rich region at the interface of muscle-tendon attachment sites that functions as the primary sources of force transmission. Each type of attachment bears varying levels of force, which correlates with distinct composition and organization of its tendon ECM (Ker et al., 2000; Wang, 2006). While extensive research has been conducted to evaluate the effects of exercise on size and strength of muscle fibers, less is known about how it effects tendon morphology and function. Understanding this is key to gaining insights into the causes of tendon defects and developing new treatments for tendon injuries or atrophy.Previous studies in vitro have suggested that tenocytes actively respond to changes in force in their environment by modulating ECM composition and organization (Maeda et al., 2010; Rullman et al., 2009). Excised tendons stretched in collagen gels, as well as tissue samples from chronic Achilles tendonitispatients, upregulate various collagens and ECM-modulating proteins, particularly Col3, Matrix Metalloproteinase 9 (MMP9) and MMP13 (Ireland et al., 2001; Pingel et al., 2014). In addition, collagen fibril size decreases and fibril packing increases in tendinopathies, likely due to increased ECM turnover (Pingel et al., 2014). These studies have suggested ECM modifications and morphological changes in tendinopathies but they have largely been limited to cultured tendons or tendon fragments. In vivo, several growth factor signaling pathways and transcription factors have been implicated downstream of mechanical force in tendon development and repair in mice. These include several members of the Transforming Growth Factor (TGF) superfamily, including TGFβ and Bone Morphogenetic Proteins (BMPs), as well as Fibroblast Growth Factors (FGF) (Gumucio et al., 2015; Nourissat et al., 2015). Mice lacking the transcription factor Scleraxis (Scx) show severe defects in force-transmitting and load-bearing tendons, suggesting that Scx is essential for maintenance of tendon ECM in response to mechanical force (Murchison et al., 2007). In addition, Scx directly regulates transcription of tendon ECM components, including Col1a1 (Havis et al., 2014; Subramanian and Schilling, 2015). Our studies of the ECM protein Thrombospondin 4b (Tsp4b) in zebrafish have shown that it is an essential scaffolding protein for tendon ECM assembly, required to maintain muscle attachments subjected to mechanical force via muscle contraction, and able to strengthen attachments when overexpressed (Subramanian and Schilling, 2014).Here, we show that mechanical force causes remarkable morphological changes in tenocytes in zebrafish, which form a dense curtain of projections at MTJs, and in their surrounding ECM. Tenocyte projections have been reported in electron micrographs of mammalian tendon fascicles yet how they form and their functions in tendon development remain largely unexplored (Kalson et al., 2015; Knudsen et al., 2015). Our results suggest that tenocytes play an active role in sensing force and thereby regulating ECM composition and overall tendon strength. In addition, we show that the force of muscle contraction regulates the growth and branching of tenocyte projections via TGFβ signaling. Such feedback between tenocytes and ECM may be a common mechanism for force adaptation within the musculoskeletal system.
Results
Tenocytes elongate with the onset of muscle contraction
Tenocytes in zebrafish express two Scx orthologues, scxa and scxb (Chen and Galloway, 2014). Using a bacterial artificial chromosome (BAC) transgenic line that expresses mCherry under the control of regulatory elements for scxa, Tg(scxa:mCherry), we examined the morphogenesis of tenocytes during embryonic (20 hr post fertilization (hpf) to 72 hpf) and early larval (72 hpf to 5 dpf) zebrafish development. Expression of scxa:mCherry was first detected at 20 hpf in muscle and tendon progenitors of the somites. In a developing zebrafish embryo, muscles in the trunk establish attachments at bilateral, ‘chevron’ shaped somite boundaries that subdivide each muscle segment forming the vertical myoseptum (VMS). In addition, dorsal and ventral compartments within each somite are subdivided by a horizontal myoseptum (HMS), which extends laterally from the notochord (NC), along which oblique myofibers attach. By 24 hpf, as the first myofibers differentiated, scxa:mCherry expression in muscle progenitors diminished and became progressively restricted to scattered tendon progenitors along the HMS and VMS (~24 cells per VMS) (Figure 1A,D,G) (Figure 1—video 1). Cells with the highest levels of scxa:mCherry expression were located laterally, adjacent to the HMS, while more medial cells expressed lower levels (Figure 1A’, D’, G’). By 36 hpf, scxa:mCherry+ cells doubled in number (~44/VMS) and became increasingly localized to the HMS and VMS at future MTJs (Figure 1B,E,H) (Figure 1—video 1). At this stage, cells with the highest scxa:mCherry expression that were located medially and in the ventral somites began to extend projections laterally along the VMS, perpendicular to the orientation of muscle fibers (Figure 1B’, E’, H’). By 48 hpf these projections extended 70–80 μm (Figure 1C,F,I). 3D-reconstructions of confocal stacks at 60 hpf revealed that this polarized network of tenocyte projections covered the entire VMS (Figure 1C’, F’, I’; Figure 1—figure supplement 1). Time-lapsed videos of Tg(scxa:mCherry) embryos capturing images at 20 min intervals from 48 to 60 hpf showed that tenocyte projections are dynamic and constantly changing in length and branching pattern (Figure 1—video 2). Tenocytes along the HMS near the NC have shorter, more convoluted projections than tenocytes along the VMS (Figure 1I’; Figure 1—figure supplement 1B). Thus, during the period in which axial muscles in the trunk begin to contract and embryos become motile, tenocytes align along future MTJs and undergo dramatic changes in cell shape that correlate with the establishment and strengthening of muscle attachments.
Figure 1.
Axial tenocyte morphogenesis.
(A–C) Lateral views of live Tg(scx:mCherry) embryos showing developing tenocytes (A - 24 hpf, B - 36 hpf, C - 48 hpf). (A’–C’) Transverse views from 3D projections showing the positions of developing tenocytes in relation to the notochord (NC) and neural tube (NT) along the horizontal (HMS) and vertical myosepta (VMS) (arrows). Tenocytes form projections at 36–48 hpf (B’ and C’). (D–F) Diagrams of lateral views showing the morphology of tenocytes in the developing somites. (D’–F’) Diagrams of transverse views from 3D projections of live Tg(scx:mCherry) embryos show the development of tenocyte projections (E’ and F’). (G–I) Lateral views of co-immunostained Tg(scx:mCherry) embryos showing developing tenocytes (anti-mCherry - white) and muscle fibers (anti-MHC - green) (G – 24 hpf, H – 36 hpf, I – 48 hpf). (G’–I’) Transverse views from 3D projections of live Tg(scx:mCherry) embryos showing the positions of developing tenocytes (arrowheads in G’ and H’) in relation to the myotome. Scale bars = 20 microns.
(A) Lateral and (B) transverse views of live 60 hpf Tg(scx:mCherry) embryos showing tenocytes, which are pseudocolored to highlight the depth of the 3D reconstructed image. Transgene expression is also observed in neuronal cell bodies in the neural tube. Scale bars = 10 microns.
Co-immunostained Tg(scx:mCherry) embryos (anti-mCherry – red; anti-MHC – green) showing temporal changes in tenocyte morphogenesis in relation to developing muscles. (A, D, G – 48 hpf; B, E, H – 62 hpf; C, F, I, – 72 hpf). Ventral views of Tg(scx:mCherry) embryonic heads. Abbreviations: IMA – intermandibularis anterior, IMP – intermandibularis posterior, IH – interhyal, AM – adductor mandibulae, HH – hyohyal, SH – sternohyoideus, mc – Meckels cartilage, bh – basihyal, ch – ceratohyal. Scale bar = 20 microns.
Time-lapse video of a developing Tg(scx:mCherry) embryo between 20 and 36 hpf at 15 min intervals. Tenocyte progenitors express scx:mCherry at 24 hpf, when muscle fibers have already formed initial attachments at the VMS. A transverse view shows migration of tenocyte progenitors to a medial position (HMS) around the notochord (NC) and along the VMS.
A time-lapse video of a developing Tg(scx:mCherry) embryo between 48 and 60 hpf at 15 min intervals shows activity of tenocyte projections along VMS and HMS.
Figure 1–video 1.
Axial tenocyte progenitors align along HMS and VMS following muscle fiber differentiation.
Time-lapse video of a developing Tg(scx:mCherry) embryo between 20 and 36 hpf at 15 min intervals. Tenocyte progenitors express scx:mCherry at 24 hpf, when muscle fibers have already formed initial attachments at the VMS. A transverse view shows migration of tenocyte progenitors to a medial position (HMS) around the notochord (NC) and along the VMS.
Figure 1—figure supplement 1.
Axial tenocytes form polarized projections orthogonal to muscle fibers.
(A) Lateral and (B) transverse views of live 60 hpf Tg(scx:mCherry) embryos showing tenocytes, which are pseudocolored to highlight the depth of the 3D reconstructed image. Transgene expression is also observed in neuronal cell bodies in the neural tube. Scale bars = 10 microns.
Figure 1–video 2.
Tenocyte projections are dynamic.
A time-lapse video of a developing Tg(scx:mCherry) embryo between 48 and 60 hpf at 15 min intervals shows activity of tenocyte projections along VMS and HMS.
Axial tenocyte morphogenesis.
(A–C) Lateral views of live Tg(scx:mCherry) embryos showing developing tenocytes (A - 24 hpf, B - 36 hpf, C - 48 hpf). (A’–C’) Transverse views from 3D projections showing the positions of developing tenocytes in relation to the notochord (NC) and neural tube (NT) along the horizontal (HMS) and vertical myosepta (VMS) (arrows). Tenocytes form projections at 36–48 hpf (B’ and C’). (D–F) Diagrams of lateral views showing the morphology of tenocytes in the developing somites. (D’–F’) Diagrams of transverse views from 3D projections of live Tg(scx:mCherry) embryos show the development of tenocyte projections (E’ and F’). (G–I) Lateral views of co-immunostained Tg(scx:mCherry) embryos showing developing tenocytes (anti-mCherry - white) and muscle fibers (anti-MHC - green) (G – 24 hpf, H – 36 hpf, I – 48 hpf). (G’–I’) Transverse views from 3D projections of live Tg(scx:mCherry) embryos showing the positions of developing tenocytes (arrowheads in G’ and H’) in relation to the myotome. Scale bars = 20 microns.
Axial tenocytes form polarized projections orthogonal to muscle fibers.
(A) Lateral and (B) transverse views of live 60 hpf Tg(scx:mCherry) embryos showing tenocytes, which are pseudocolored to highlight the depth of the 3D reconstructed image. Transgene expression is also observed in neuronal cell bodies in the neural tube. Scale bars = 10 microns.
Cranial tenocyte morphogenesis correlates with onset of muscle contraction.
Co-immunostained Tg(scx:mCherry) embryos (anti-mCherry – red; anti-MHC – green) showing temporal changes in tenocyte morphogenesis in relation to developing muscles. (A, D, G – 48 hpf; B, E, H – 62 hpf; C, F, I, – 72 hpf). Ventral views of Tg(scx:mCherry) embryonic heads. Abbreviations: IMA – intermandibularis anterior, IMP – intermandibularis posterior, IH – interhyal, AM – adductor mandibulae, HH – hyohyal, SH – sternohyoideus, mc – Meckels cartilage, bh – basihyal, ch – ceratohyal. Scale bar = 20 microns.
Axial tenocyte progenitors align along HMS and VMS following muscle fiber differentiation.
Time-lapse video of a developing Tg(scx:mCherry) embryo between 20 and 36 hpf at 15 min intervals. Tenocyte progenitors express scx:mCherry at 24 hpf, when muscle fibers have already formed initial attachments at the VMS. A transverse view shows migration of tenocyte progenitors to a medial position (HMS) around the notochord (NC) and along the VMS.
Tenocyte projections are dynamic.
A time-lapse video of a developing Tg(scx:mCherry) embryo between 48 and 60 hpf at 15 min intervals shows activity of tenocyte projections along VMS and HMS.Cranial tendons also undergo dramatic morphological changes during the onset of muscle attachment and contractility. A cluster of scxa:mCherry+ tenocyte progenitors is first observed at 36 hpf in the ventral midline near the future attachment sites of the sternohyoideus (SH) and adductor mandibulae (AM), which are among the earliest muscles to differentiate at 53 hpf (Schilling and Kimmel, 1997). By 48 hpf, three major clusters of scxa:mCherry+ tenocytes are visible ventrally, one anterior that forms ventral mandibular, hyoid, and oculomotor muscle tendons and two posterior clusters associated with each SH (Figure 1—figure supplement 2A). The anterior cluster subdivides over 14 hr into separate attachment sites for mandibular (IMA, IMP, AM) and hyoid (IH) muscles (Figure 1—figure supplement 2B). Double labeling with anti-MHC and anti-mCherry antibodies revealed a tight correlation between the timing of the onset of muscle contraction and tenocyte morphogenesis in each of these clusters (Figure 1—figure supplement 2A,B,D,E,G,H). Cranial myofibers remain immotile at 48–62 hpf and their corresponding tenocytes form clusters of rounded cells at future attachment sites. These tenocytes then undergo compaction and elongation as contractions begin at 72 hpf (Figure 1—figure supplement 2C,F,I).
Figure 1—figure supplement 2.
Cranial tenocyte morphogenesis correlates with onset of muscle contraction.
Co-immunostained Tg(scx:mCherry) embryos (anti-mCherry – red; anti-MHC – green) showing temporal changes in tenocyte morphogenesis in relation to developing muscles. (A, D, G – 48 hpf; B, E, H – 62 hpf; C, F, I, – 72 hpf). Ventral views of Tg(scx:mCherry) embryonic heads. Abbreviations: IMA – intermandibularis anterior, IMP – intermandibularis posterior, IH – interhyal, AM – adductor mandibulae, HH – hyohyal, SH – sternohyoideus, mc – Meckels cartilage, bh – basihyal, ch – ceratohyal. Scale bar = 20 microns.
Tenocyte elongation requires muscle contraction
Based on the close correlation between the onset of muscle contraction and tenocyte morphogenesis, we hypothesized that mechanical force serves as a cue for tenocytes to elongate and form projections. To test this idea, we first injected full-length mRNA encoding codon-optimized α-bungarotoxin (αBtx), a specific irreversible antagonist of acetylcholine receptors that blocks neuromuscular synapses and prevents skeletal muscle contractions (Swinburne et al., 2015; Westerfield et al., 1990). Embryos injected with αBtx mRNA at the one-cell stage were completely paralyzed until 60 hpf, after which they gradually recovered motility as αBtx activity declined. Depth-coded, 3D-reconstructed images of living trunk tenocytes along the MTJs of somites 16–17 at 48 hpf revealed an average reduction of 13 μm (18%) in axial tenocyte projection length in αBtx-injected embryos compared to uninjected controls (Figure 2A,B,E). Paralyzed embryos also showed reduced branching complexity in their projections (Figure 2F) and projection density along the VMS (Figure 2—figure supplement 1). To restore mechanical force, we electrically stimulated αBtx-injected embryos to induce muscle contractions, as described previously (Subramanian and Schilling, 2014). Stimulation at 48 hpf for 2 min at 20V caused no visible muscle damage or significant change in tenocyte projection lengths compared to controls (Figure 2C,E) while the same stimulation of αBtx-injected embryos rescued both tenocyte projection length and density along the VMS almost completely (Figure 2D,E; Figure 2—figure supplement 1). The observed reductions in projection length and density were caused by paralysis rather than any unanticipated effect of αBtx, since homozygous mutants paralyzed due to lack of a functional voltage-dependent L-type calcium channel subtype beta-1 (Cacnb1), necessary for excitation-contraction coupling in muscle, showed similar (10–15 μm) reductions in projection length (Figure 2—figure supplement 2) (Zhou et al., 2006). Tenocytes in cacnb1 mutant embryos fail to compact and elongate. Since αBtx-injected embryos recover from paralysis at 65 hpf, prior to cranial muscle contractions, we compared cranial tenocyte patterning in immunostained 4 dpf cacnb1 mutant embryos with their siblings. We observed both a failure of cranial tenocytes to compact and elongate, as well as reduced projections and frayed myofibers (Figure 2—figure supplement 3). These results indicate a strong correlation between mechanical force from muscle contraction and tenocyte morphogenesis, suggesting that force stimulates the dynamic growth and branching of tenocyte projections.
Figure 2.
Tenocyte projection length and branching density is regulated by mechanical force.
Lateral views of live Tg(scx:mCherry) embryos (48 hpf) showing tenocyte projections. Images are pseudocolored by depth from medial (red) to lateral (blue). Control embryos were imaged without stimulation (A) and after stimulation (B), and the length of tenocyte projections was compared with embryos injected with αBtx and imaged without (C) and with stimulation (D). Dot plot shows individual data points of tenocyte projection length under different conditions (E). The data points from each embryo are connected by a vertical line. NS – Not Stimulated, S – Stimulated. (n > 50 data points/embryo in three embryos/sample, p value was determined through ANOVA 1-way analysis ***<0.00001, **<0.0001). Histogram shows quantification of branch points along tenocyte projections per tenocyte in 36 hpf control and αBtx injected embryos for every level of branching (1o – primary, 2o – secondary, 3o – tertiary, 4o – quaternary). (n = 4, p value was determined through ttest *<0.01, ***<0.00001). The measurements used for quantitative analysis and creation of the plots can be accessed from Figure 2—source data 1 and Figure 2—source data 2.
Dot plot shows individual data points of tenocyte projection density at the ventral VMS in embryos injected with αBtx and imaged without and with stimulation. The data points from three VMSs in each embryo are connected by a vertical line. NS – Not Stimulated, S – Stimulated. (n ~ 10 embryos/sample, p value was determined through ANOVA 1-way analysis and Tukey test ***<0.00001). The measurements used for quantitative analysis and creation of the plots can be accessed from Figure 2—figure supplement 1—source data 1.
Lateral views of immunostained (A) sibling and (B) cacnb1 mutant embryos carrying the Tg(scx:mCherry) transgene showing tenocyte projections in a pseuodocolored, depth-coded pattern. (C) Dot plot shows individual data points of tenocyte projection length in sibling and cacnb1 mutant embryos (n = 50 data points/embryo in eight embryos/sample, p-value was determined by Wilcoxon Rank Sum Test - < 0.0001). The measurements used for quantitative analysis and creation of the plots can be accessed from Figure 2—figure supplement 2—source data 1.
Ventral views of 98 hpf wild-type (A–C) and cacnb1; scx:mCherry (D–F) embryonic heads showing muscle fibers (green) and corresponding tenocytes (red). (G–J) Higher magnification views of control Tg(scx:mCherry) embryonic heads (panel A insets - color coded boxes) and (K–N) higher magnification views of cacnb1; scx:mCherry embryonic heads (panel D insets - color-coded boxes) showing tenocyte projections in different tendons (arrows). Scale bars = 20 microns.
Figure 2—figure supplement 1.
Density of tenocyte projections is regulated by mechanical force.
Dot plot shows individual data points of tenocyte projection density at the ventral VMS in embryos injected with αBtx and imaged without and with stimulation. The data points from three VMSs in each embryo are connected by a vertical line. NS – Not Stimulated, S – Stimulated. (n ~ 10 embryos/sample, p value was determined through ANOVA 1-way analysis and Tukey test ***<0.00001). The measurements used for quantitative analysis and creation of the plots can be accessed from Figure 2—figure supplement 1—source data 1.
Figure 2—figure supplement 2.
cacnb1 mutants show reduced length and branching of tenocyte projections.
Lateral views of immunostained (A) sibling and (B) cacnb1 mutant embryos carrying the Tg(scx:mCherry) transgene showing tenocyte projections in a pseuodocolored, depth-coded pattern. (C) Dot plot shows individual data points of tenocyte projection length in sibling and cacnb1 mutant embryos (n = 50 data points/embryo in eight embryos/sample, p-value was determined by Wilcoxon Rank Sum Test - < 0.0001). The measurements used for quantitative analysis and creation of the plots can be accessed from Figure 2—figure supplement 2—source data 1.
Figure 2—figure supplement 3.
Cranial tenocyte patterning and morphogenesis is disrupted in pet mutants.
Ventral views of 98 hpf wild-type (A–C) and cacnb1; scx:mCherry (D–F) embryonic heads showing muscle fibers (green) and corresponding tenocytes (red). (G–J) Higher magnification views of control Tg(scx:mCherry) embryonic heads (panel A insets - color coded boxes) and (K–N) higher magnification views of cacnb1; scx:mCherry embryonic heads (panel D insets - color-coded boxes) showing tenocyte projections in different tendons (arrows). Scale bars = 20 microns.
Tenocyte projection length and branching density is regulated by mechanical force.
Lateral views of live Tg(scx:mCherry) embryos (48 hpf) showing tenocyte projections. Images are pseudocolored by depth from medial (red) to lateral (blue). Control embryos were imaged without stimulation (A) and after stimulation (B), and the length of tenocyte projections was compared with embryos injected with αBtx and imaged without (C) and with stimulation (D). Dot plot shows individual data points of tenocyte projection length under different conditions (E). The data points from each embryo are connected by a vertical line. NS – Not Stimulated, S – Stimulated. (n > 50 data points/embryo in three embryos/sample, p value was determined through ANOVA 1-way analysis ***<0.00001, **<0.0001). Histogram shows quantification of branch points along tenocyte projections per tenocyte in 36 hpf control and αBtx injected embryos for every level of branching (1o – primary, 2o – secondary, 3o – tertiary, 4o – quaternary). (n = 4, p value was determined through ttest *<0.01, ***<0.00001). The measurements used for quantitative analysis and creation of the plots can be accessed from Figure 2—source data 1 and Figure 2—source data 2.
Density of tenocyte projections is regulated by mechanical force.
Dot plot shows individual data points of tenocyte projection density at the ventral VMS in embryos injected with αBtx and imaged without and with stimulation. The data points from three VMSs in each embryo are connected by a vertical line. NS – Not Stimulated, S – Stimulated. (n ~ 10 embryos/sample, p value was determined through ANOVA 1-way analysis and Tukey test ***<0.00001). The measurements used for quantitative analysis and creation of the plots can be accessed from Figure 2—figure supplement 1—source data 1.
cacnb1 mutants show reduced length and branching of tenocyte projections.
Lateral views of immunostained (A) sibling and (B) cacnb1 mutant embryos carrying the Tg(scx:mCherry) transgene showing tenocyte projections in a pseuodocolored, depth-coded pattern. (C) Dot plot shows individual data points of tenocyte projection length in sibling and cacnb1 mutant embryos (n = 50 data points/embryo in eight embryos/sample, p-value was determined by Wilcoxon Rank Sum Test - < 0.0001). The measurements used for quantitative analysis and creation of the plots can be accessed from Figure 2—figure supplement 2—source data 1.
Cranial tenocyte patterning and morphogenesis is disrupted in pet mutants.
Ventral views of 98 hpf wild-type (A–C) and cacnb1; scx:mCherry (D–F) embryonic heads showing muscle fibers (green) and corresponding tenocytes (red). (G–J) Higher magnification views of control Tg(scx:mCherry) embryonic heads (panel A insets - color coded boxes) and (K–N) higher magnification views of cacnb1; scx:mCherry embryonic heads (panel D insets - color-coded boxes) showing tenocyte projections in different tendons (arrows). Scale bars = 20 microns.
ECM organization at MTJs requires muscle contraction
We previously showed that Tsp4b secreted by tenocytes is essential for ECM organization at MTJs and strengthens muscle attachments (Subramanian and Schilling, 2014). We hypothesized that force stimulates tenocytes to secrete Tsp4b from the projections they extend into the tendon ECM. Consistent with this, injection of tsp4b-gfp full length mRNA into Tg(scxa:mCherry) embryos produced Tsp4b-GFP protein that localized to MTJs along the attachment sites at 48 hpf (Figure 3A–C,I). This exogenous Tsp4b-GFP protein was dramatically reduced in αBtx-injected embryos, particularly around projections, and became diffuse compared to uninjected controls (Figure 3D–F,I). Likewise, immunohistochemical staining for Tsp4b at 48 hpf in αBtx-injected embryos showed dramatic reductions along the attachment sites compared to controls (Figure 3G,H,J). In contrast, other ECM proteins such as laminin (Lam) at 48 hpf and and fibronectin (Fn) at 24 hpf showed no significant changes at the MTJ in αBtx-injected embryos at 48 hpf (Figure 3—figure supplement 1). Defects in Tsp4b distribution were due to the lack of mechanical force, since restoring force in paralyzed embryos through electrical stimulation rescued both local levels and the overall area of Tsp4b protein localization along the VMS (Figure 3—figure supplement 2). To test the hypothesis that changes in Tsp4b localization were due to reduced tsp4b gene expression in response to lack of force, we performed real-time PCR and found a significant reduction in tsp4b expression at 48 hpf in αBtx-injected embryos, while no significant change in expression was observed at 24 hpf (Figure 3—figure supplement 3). These results suggest a role for mechanical force in both assembly of tendon ECM and expression of key MTJ ECM genes during development and demonstrate that muscle contractions regulate the composition and organization of the tendon ECM.
Figure 3.
Tsp4b localization to VMS and tenocyte projections requires mechanical force.
Lateral views of live control (A–C) and αBtx injected (D–F) Tg(scx:mCherry) embryos (48 hpf), injected with tsp4b-gfp mRNA showing localization of Tsp4b-GFP (green) (arrowheads) along the VMS and tenocyte projections (red). (I) Histogram shows the percentage of embryos with Tsp4b-GFP localized to VMS (n = 27, p value calculated by chi-squared test <0.05). (G–H) Lateral views of immunostained embryos showing Tsp4b protein localization detected immunohistochemically along VMS in control (G) and αBtx injected (H) embryos. (J) Dot plot shows individual data points of the fluorescent intensity of localized Tsp4b along the VMS in control and αBtx injected embryos. Three VMSs/embryo were sampled in control and αBtx-injected embryos. (n = 9, p value calculated by Wilcoxon Rank Sum Test - < 0.0001). Scale bars = 20 microns. The measurements used for quantitative analysis and creation of the plots can be accessed from Figure 3—source data 1 and Figure 3—source data 2.
Dot plot shows individual data points of the fluorescent intensity of localized Lam (A) and Fn (B) at MTJs along the VMS in control and αBtx-injected embryos at 48 hpf (A) and 24 hpf (B). Three VMSs/embryo were sampled in control and αBtx-injected embryos. (n = 9, p value calculated by ANOVA 1-way analysis and Tukey -*<0.002). Scale bars = 20 microns. The measurements used for quantitative analysis and creation of the plots can be accessed from Figure 3—figure supplement 1—source data 1 and Figure 3—figure supplement 1—source data 2.
Lateral view of immunostained 48 hpf embryos showing the localization of Tsp4b in control embryos without (A) and with stimulation (C), and αBtx-injected embryos without (B) and with stimulation (D). Histogram shows the mean area of Tsp4b localization in VMS (dotted region) (E). NS – Not Stimulated, S – Stimulated. Scale bar = 20 microns. The measurements used for quantitative analysis and creation of the plots can be accessed from Figure 3—figure supplement 2—source data 1.
Histogram shows relative expression of rpl13a, scxa and tsp4b in 24 hpf and 48 hpf control and αBtx-injected embryos. (p value calculated by ANOVA 1-way analysis and Tukey test -**<0.001).
Figure 3—figure supplement 1.
Early Lam and Fn organization do not depend on mechanical force.
Dot plot shows individual data points of the fluorescent intensity of localized Lam (A) and Fn (B) at MTJs along the VMS in control and αBtx-injected embryos at 48 hpf (A) and 24 hpf (B). Three VMSs/embryo were sampled in control and αBtx-injected embryos. (n = 9, p value calculated by ANOVA 1-way analysis and Tukey -*<0.002). Scale bars = 20 microns. The measurements used for quantitative analysis and creation of the plots can be accessed from Figure 3—figure supplement 1—source data 1 and Figure 3—figure supplement 1—source data 2.
Figure 3—figure supplement 2.
Tsp4b organization requires mechanical force.
Lateral view of immunostained 48 hpf embryos showing the localization of Tsp4b in control embryos without (A) and with stimulation (C), and αBtx-injected embryos without (B) and with stimulation (D). Histogram shows the mean area of Tsp4b localization in VMS (dotted region) (E). NS – Not Stimulated, S – Stimulated. Scale bar = 20 microns. The measurements used for quantitative analysis and creation of the plots can be accessed from Figure 3—figure supplement 2—source data 1.
Figure 3—figure supplement 3.
Mechanical force regulates expression of Tsp4b.
Histogram shows relative expression of rpl13a, scxa and tsp4b in 24 hpf and 48 hpf control and αBtx-injected embryos. (p value calculated by ANOVA 1-way analysis and Tukey test -**<0.001).
Tsp4b localization to VMS and tenocyte projections requires mechanical force.
Lateral views of live control (A–C) and αBtx injected (D–F) Tg(scx:mCherry) embryos (48 hpf), injected with tsp4b-gfp mRNA showing localization of Tsp4b-GFP (green) (arrowheads) along the VMS and tenocyte projections (red). (I) Histogram shows the percentage of embryos with Tsp4b-GFP localized to VMS (n = 27, p value calculated by chi-squared test <0.05). (G–H) Lateral views of immunostained embryos showing Tsp4b protein localization detected immunohistochemically along VMS in control (G) and αBtx injected (H) embryos. (J) Dot plot shows individual data points of the fluorescent intensity of localized Tsp4b along the VMS in control and αBtx injected embryos. Three VMSs/embryo were sampled in control and αBtx-injected embryos. (n = 9, p value calculated by Wilcoxon Rank Sum Test - < 0.0001). Scale bars = 20 microns. The measurements used for quantitative analysis and creation of the plots can be accessed from Figure 3—source data 1 and Figure 3—source data 2.
Early Lam and Fn organization do not depend on mechanical force.
Dot plot shows individual data points of the fluorescent intensity of localized Lam (A) and Fn (B) at MTJs along the VMS in control and αBtx-injected embryos at 48 hpf (A) and 24 hpf (B). Three VMSs/embryo were sampled in control and αBtx-injected embryos. (n = 9, p value calculated by ANOVA 1-way analysis and Tukey -*<0.002). Scale bars = 20 microns. The measurements used for quantitative analysis and creation of the plots can be accessed from Figure 3—figure supplement 1—source data 1 and Figure 3—figure supplement 1—source data 2.
Tsp4b organization requires mechanical force.
Lateral view of immunostained 48 hpf embryos showing the localization of Tsp4b in control embryos without (A) and with stimulation (C), and αBtx-injected embryos without (B) and with stimulation (D). Histogram shows the mean area of Tsp4b localization in VMS (dotted region) (E). NS – Not Stimulated, S – Stimulated. Scale bar = 20 microns. The measurements used for quantitative analysis and creation of the plots can be accessed from Figure 3—figure supplement 2—source data 1.
Mechanical force regulates expression of Tsp4b.
Histogram shows relative expression of rpl13a, scxa and tsp4b in 24 hpf and 48 hpf control and αBtx-injected embryos. (p value calculated by ANOVA 1-way analysis and Tukey test -**<0.001).
Microtubules maintain tenocyte projections and their interactions with tendon ECM
Cellular projections in neurons, keratinocytes and pigment cells are rich in microtubules (MTs) and in some cases F-actin, while filopodial extensions of cells are typically more actin-based (Eom et al., 2015; Witte et al., 2008). To determine the cytoskeletal structure of tenocyte projections we injected full-length mRNA encoding eGFP-αtubulin and found that this fusion protein localized to MTs along the length of tenocyte projections (Figure 4A–C) (Rusan et al., 2001). Similar injections of plasmids encoding EGFP-Lifeact-7 failed to show labeled actin in the projections. To determine if MTs are critical for maintaining projections, we treated embryos with Nocodazole, which caused them to fragment (Figure 4D,E). Immunohistochemical staining of Nocodazole-treated embryos for Tsp4b showed scattered Tsp4b + puncta localized at MTJs along the VMS and reduced Tsp4b protein levels in the VMS (Figure 4F,G,H,I). These results suggest that MTs are the key structural components of tenocyte projections required to sustain the organization of tendon ECM.
Figure 4.
Microtubule-rich tenocyte projections control tendon ECM localization.
Lateral views of live 48 hpf Tg(scx:mCherry) embryos injected with EGFP-alpha-Tubulin mRNA (A–C) showing localization of a-Tubulin along the length of projections colocalized with mCherry to mark in tenocytes. Transverse views of 3-D reconstructed live 60 hpf embryos showing tenocyte projections in DMSO-treated (D) and Nocodazole (Noco)-treated (E) embryos. Transverse view of 3-D reconstructed 60 hpf embryos immunostained for Tsp4b showing localization of Tsp4b in DMSO treated (F) and Noco treated (G) samples. Quantification of Tsp4b localization intensity in VMS (H) and distribution of Tsp4b aggregates in VMS (I) of DMSO-treated and Noco-treated embryos. (p value calculated by t-test for samples with unequal variance *<0.05, ***<0.0005). Scale bars = 20 microns. The measurements used for quantitative analysis and creation of the plots can be accessed from Figure 4—source data 1 and Figure 4—source data 2.
Microtubule-rich tenocyte projections control tendon ECM localization.
Lateral views of live 48 hpf Tg(scx:mCherry) embryos injected with EGFP-alpha-Tubulin mRNA (A–C) showing localization of a-Tubulin along the length of projections colocalized with mCherry to mark in tenocytes. Transverse views of 3-D reconstructed live 60 hpf embryos showing tenocyte projections in DMSO-treated (D) and Nocodazole (Noco)-treated (E) embryos. Transverse view of 3-D reconstructed 60 hpf embryos immunostained for Tsp4b showing localization of Tsp4b in DMSO treated (F) and Noco treated (G) samples. Quantification of Tsp4b localization intensity in VMS (H) and distribution of Tsp4b aggregates in VMS (I) of DMSO-treated and Noco-treated embryos. (p value calculated by t-test for samples with unequal variance *<0.05, ***<0.0005). Scale bars = 20 microns. The measurements used for quantitative analysis and creation of the plots can be accessed from Figure 4—source data 1 and Figure 4—source data 2.
TGFβ signaling is required for tenocytes to extend projections in response to force
Previous studies from primary cultures of tenocytes and stretch tests on isolated tendons in vitro have proposed a mechanoresponsive role for TGFβ signaling (Gumucio et al., 2015; Havis et al., 2016; Maeda et al., 2011). TGFβ secreted by muscles or latent in the ECM of the MTJ could be released in response to force and thereby regulate both tenocyte morphogenesis and ECM production. To address this hypothesis, we treated Tg(scxa:mCherry) embryos with a chemical inhibitor of TGFβ signaling (SB431542 – which blocks TGFβ receptors) for 12 hr from 24 to 36 hpf (Chen and Galloway, 2014). This treatment severely reduced signaling in both muscle fibers and tenocytes as confirmed by immunostaining for phosphorylated SMAD3 (pSMAD3) in SB431542-treated embryos compared to controls (Figure 5A–C,E–G,I). In addition, tenocyte projections were reduced in length by an average of ~20 μm in SB431542-treated embryos (Figure 5D,H,J), similar to the effects of αBtx (Figure 2B,E). However, unlike embryos injected with αBtx, SB431542-treated embryos continued to swim actively. These results suggest that TGFβsignaling acts downstream of muscle contraction to stimulate growth and branching of tenocyte projections. To confirm if muscle contraction is essential for activation of TGFβ signaling, we stained control and αBtx-injected, Tg(scx:mCherry) embryos with anti-pSMAD3. While control embryos showed strong pSMAD3 localization in the nuclei of muscles and tenocytes, pSMAD3 staining was strongly reduced in the nuclei of tenocytes in αBtx-injected embryos (Figure 6A–G). Here, in contrast to embryos treated with SB431542 (Figure 5C,G), paralysis specifically reduced pSMAD3 in tenocytes and not in muscle nuclei. This correlated with the reduction in length of tenocyte projections (Figure 6H). These results suggest that mechanical force from muscle contraction serves as a cue for TGFβ mediated signaling in tenocytes to control their morphogenesis and differentiation.
Figure 5.
TGFβ signaling regulates tenocyte morphogenesis.
Lateral views of immunostained Tg(scx:mCherry) control (A–D) and SB431542-treated (E–H) embryos showing nuclei (DAPI), tenocytes (anti-mCherry) and pSMAD3 (anti-pSMAD3). (I) Localization of pSMAD3 was quantified as fluorescent intensity of nuclear pSMAD3 signal (marked by yellow dotted ROI) and plotted as a dot plot showing data points (n = 9, p value was calculated by t test ***<0.000005). (D, H) Pseudocolored 3D projections show tenocyte cell projections in control (D) and SB 431542 treated embryos (H). (J) Dot plot shows individual data points representing tenocyte projection lengths (n = 50 data points/embryo in nine embryos/sample, p value was calculated by Wilcoxon Rank Sum test ***<0.00005). Representative muscle nuclei are marked by a blue continuous ROI. Scale bars = 10 microns. The measurements used for quantitative analysis and creation of the plots can be accessed from Figure 5—source data 1 and Figure 5—source data 2.
Figure 6.
TGFβ signaling in tenocytes requires mechanical force.
Lateral views of 48 hpf immunostained Tg(scx:mCherry) control (A–C) and αBtx injected (D–F) embryos showing nuclei (DAPI), tenocytes (anti-mCherry) and pSMAD3 (anti-pSMAD3) (marked by yellow-dotted ROI). (G) Localization of pSMAD3 was quantified as fluorescent intensity of nuclear pSMAD3 signal and plotted as a dot plot (n = 4, p value was calculated by t-test **<0.005). (H) Dot plot shows individual tenocyte projection lengths (p value was calculated by t-test **<0.00005). Representative muscle nuclei are marked by a blue continuous ROI. Scale bar = 10 microns. The measurements used for quantitative analysis and creation of the plots can be accessed from Figure 6—source data 1 and Figure 6—source data 2.
(A–F) Single plane images showing lateral views of paralyzed (αBtx) 48 hpf embryos without stimulation (A–C) and after stimulation (D–F), immunostained to show nuclei (DAPI), tenocytes (anti-mCherry) and pSMAD3 (anti-pSMAD3) (marked by yellow dotted ROI). Cell bodies are outlined by dotted lines. (G) pSMAD3 localization was quantified as fluorescent intensity of nuclear pSMAD3 signal and plotted as a dot plot (n = 3, p value was calculated by Wilcoxon Rank Sum test **<0.0005). NS – Not Stimulated, S – Stimulated. Representative muscle nuclei are marked by a blue continuous ROB. Scale bar = 10 microns. The measurements used for quantitative analysis and creation of the plots can be accessed from Figure 6—figure supplement 1—source data 1.
(A) qRT-PCR analysis shows relative expression of scxa, tsp4b, tgfbip and ctgfa2 genes in control (wild-type) embryos and paralyzed embryos (αBtx-inj) (without and with stimulation) (p value was calculated by ANOVA 1-way analysis and Tukey test **<.005). (B) ddPCR analysis shows absolute expression level of scxa, tsp4b, tgfbip and ctgfa2 genes in control (wild-type) embryos and paralyzed embryos (αBtx-injected) (without and with stimulation) in whole embryos.
Real time PCR analysis shows relative expression of scxa, tsp4b, tgfbip and ctgfa2 genes in control (DMSO treated) embryos, SB431542-treated embryos (A) and Nocodazole-treated embryos (B).
TGFβ signaling regulates tenocyte morphogenesis.
Lateral views of immunostained Tg(scx:mCherry) control (A–D) and SB431542-treated (E–H) embryos showing nuclei (DAPI), tenocytes (anti-mCherry) and pSMAD3 (anti-pSMAD3). (I) Localization of pSMAD3 was quantified as fluorescent intensity of nuclear pSMAD3 signal (marked by yellow dotted ROI) and plotted as a dot plot showing data points (n = 9, p value was calculated by t test ***<0.000005). (D, H) Pseudocolored 3D projections show tenocyte cell projections in control (D) and SB 431542 treated embryos (H). (J) Dot plot shows individual data points representing tenocyte projection lengths (n = 50 data points/embryo in nine embryos/sample, p value was calculated by Wilcoxon Rank Sum test ***<0.00005). Representative muscle nuclei are marked by a blue continuous ROI. Scale bars = 10 microns. The measurements used for quantitative analysis and creation of the plots can be accessed from Figure 5—source data 1 and Figure 5—source data 2.
TGFβ signaling in tenocytes requires mechanical force.
Lateral views of 48 hpf immunostained Tg(scx:mCherry) control (A–C) and αBtx injected (D–F) embryos showing nuclei (DAPI), tenocytes (anti-mCherry) and pSMAD3 (anti-pSMAD3) (marked by yellow-dotted ROI). (G) Localization of pSMAD3 was quantified as fluorescent intensity of nuclear pSMAD3 signal and plotted as a dot plot (n = 4, p value was calculated by t-test **<0.005). (H) Dot plot shows individual tenocyte projection lengths (p value was calculated by t-test **<0.00005). Representative muscle nuclei are marked by a blue continuous ROI. Scale bar = 10 microns. The measurements used for quantitative analysis and creation of the plots can be accessed from Figure 6—source data 1 and Figure 6—source data 2.
TGFβ signaling is elevated in response to mechanical force.
(A–F) Single plane images showing lateral views of paralyzed (αBtx) 48 hpf embryos without stimulation (A–C) and after stimulation (D–F), immunostained to show nuclei (DAPI), tenocytes (anti-mCherry) and pSMAD3 (anti-pSMAD3) (marked by yellow dotted ROI). Cell bodies are outlined by dotted lines. (G) pSMAD3 localization was quantified as fluorescent intensity of nuclear pSMAD3 signal and plotted as a dot plot (n = 3, p value was calculated by Wilcoxon Rank Sum test **<0.0005). NS – Not Stimulated, S – Stimulated. Representative muscle nuclei are marked by a blue continuous ROB. Scale bar = 10 microns. The measurements used for quantitative analysis and creation of the plots can be accessed from Figure 6—figure supplement 1—source data 1.
Mechanical force regulates expression of genes involved in tendon development.
(A) qRT-PCR analysis shows relative expression of scxa, tsp4b, tgfbip and ctgfa2 genes in control (wild-type) embryos and paralyzed embryos (αBtx-inj) (without and with stimulation) (p value was calculated by ANOVA 1-way analysis and Tukey test **<.005). (B) ddPCR analysis shows absolute expression level of scxa, tsp4b, tgfbip and ctgfa2 genes in control (wild-type) embryos and paralyzed embryos (αBtx-injected) (without and with stimulation) in whole embryos.
TGFβ signaling and tenocyte projection integrity affect tendon gene expression.
Real time PCR analysis shows relative expression of scxa, tsp4b, tgfbip and ctgfa2 genes in control (DMSO treated) embryos, SB431542-treated embryos (A) and Nocodazole-treated embryos (B).To further confirm that mechanical force has a role in induction of TGF-β responses in tenocytes, we stained control and αBtx-injected embryos with or without electrical stimulation, with anti-pSMAD3 antibody to verify if localization of pSMAD3 in nuclei of tenocytes could be rescued. αBtx-injected embryos stimulated with mild electric current showed increased pSMAD3 localization in tenocyte nuclei strongly suggesting that mechanical force from muscle contraction can rescue TGFβ signaling in tenocytes (Figure 6—figure supplement 1).
Figure 6—figure supplement 1.
TGFβ signaling is elevated in response to mechanical force.
(A–F) Single plane images showing lateral views of paralyzed (αBtx) 48 hpf embryos without stimulation (A–C) and after stimulation (D–F), immunostained to show nuclei (DAPI), tenocytes (anti-mCherry) and pSMAD3 (anti-pSMAD3) (marked by yellow dotted ROI). Cell bodies are outlined by dotted lines. (G) pSMAD3 localization was quantified as fluorescent intensity of nuclear pSMAD3 signal and plotted as a dot plot (n = 3, p value was calculated by Wilcoxon Rank Sum test **<0.0005). NS – Not Stimulated, S – Stimulated. Representative muscle nuclei are marked by a blue continuous ROB. Scale bar = 10 microns. The measurements used for quantitative analysis and creation of the plots can be accessed from Figure 6—figure supplement 1—source data 1.
Previous studies have linked mechanical force with the expression of tenogenic and myogenic genes (Chen et al., 2012; Maeda et al., 2011). Our results showing similar tenocyte projection defects in Nocodazole-treated, αBtx-injected and SB431542 treated embryos suggest that they induce similar changes in expression of force-responsive genes. Real-time PCR analysis on cDNA prepared from 48 hpf control and αBtx-injected embryos revealed that paralysis led to an almost complete loss of expression of tsp4b, as well as TGFβ-induced protein (tgfbip) and, connective tissue growth factor a (ctgfa), while expression levels of other tendon genes, such as scxa, were unaffected (Figure 6—figure supplement 2A). All three genes (tsp4b, tgfbip and ctgfa) were restored to control levels of expression with electrical stimulation (Figure 6—figure supplement 2A). We further validated the results with digital droplet PCR (ddPCR) on cDNA prepared from FACS sorted tenocytes and whole embryos respectively. Our ddPCR results from whole embryo cDNA preparation agreed with the real-time PCR analysis (Figure 6—figure supplement 2B). Real-time PCR analysis of SB431542-treated embryos showed significant reductions in expression of tsp4b and tgfbip genes (Figure 6—figure supplement 3A). Loss of tenocyte projections through destabilization of microtubules in nocodazole-treated embryos also led to reduced expression of tsp4b and tgfbip while expression of ctgfa and scxa were elevated (Figure 6—figure supplement 3B). Taken together, these results are consistent with the hypothesis that mechanical force acts through TGFβ signaling to regulate tenocyte-specific transcription including ECM components such as Tsp4b.
Figure 6—figure supplement 2.
Mechanical force regulates expression of genes involved in tendon development.
(A) qRT-PCR analysis shows relative expression of scxa, tsp4b, tgfbip and ctgfa2 genes in control (wild-type) embryos and paralyzed embryos (αBtx-inj) (without and with stimulation) (p value was calculated by ANOVA 1-way analysis and Tukey test **<.005). (B) ddPCR analysis shows absolute expression level of scxa, tsp4b, tgfbip and ctgfa2 genes in control (wild-type) embryos and paralyzed embryos (αBtx-injected) (without and with stimulation) in whole embryos.
Figure 6—figure supplement 3.
TGFβ signaling and tenocyte projection integrity affect tendon gene expression.
Real time PCR analysis shows relative expression of scxa, tsp4b, tgfbip and ctgfa2 genes in control (DMSO treated) embryos, SB431542-treated embryos (A) and Nocodazole-treated embryos (B).
Discussion
Mechanical forces generated by cells adhering to ECM alter their shapes and functions during development, but few studies have investigated the underlying mechanisms in vivo (Dan et al., 2015; Hamada, 2015; Ladoux et al., 2015). Here we show that early developing tenocytes in zebrafish express the tenogenic fate determinant, scxa, prior to the differentiation of muscle fibers and respond to the onset of muscle contraction by elongating and extending an array of polarized projections. These projections are disrupted by changes in force as is the corresponding organization of the tendon ECM, which is critical for MTJ function (Subramanian and Schilling, 2014). Our results show for the first time in vivo that TGFβ signaling responses induced by mechanical force from muscle contraction correlate with changes in tenocyte morphogenesis and tendon ECM composition during tendon development. These results suggest a novel role for tenocyte projections as force sensors and responders in the feedback between tenocyte and ECM that physically balance responses to mechanical force (Figure 7).
Figure 7.
TGFβ-mediated mechanotransduction is essential for tenocyte differentiation and morphogenesis.
(A) In the presence of tensile force from muscle contraction (1) changes in ECM organization and other factors lead to release of active Tgfβ ligand (2). Tgfβ ligand binds to receptors on tenocytes to increase pSMAD3 signaling (3), secretion of ECM components (4) and growth/branching of microtubule rich projections (5). Cartoon depiction of tenocyte morphogenesis in the presence of mechanical force (during onset of muscle contraction in embryonic development or through electrical stimulation of paralyzed embryos). (B) In the absence of mechanical force (before onset of muscle contraction or in paralyzed embryos) there is reduced active Tgfβ ligand, pSMAD3 signaling, expression of ECM proteins and growth/branching of projections. Depiction of tenocyte morphogenesis in the absence of mechanical force.
TGFβ-mediated mechanotransduction is essential for tenocyte differentiation and morphogenesis.
(A) In the presence of tensile force from muscle contraction (1) changes in ECM organization and other factors lead to release of active Tgfβ ligand (2). Tgfβ ligand binds to receptors on tenocytes to increase pSMAD3 signaling (3), secretion of ECM components (4) and growth/branching of microtubule rich projections (5). Cartoon depiction of tenocyte morphogenesis in the presence of mechanical force (during onset of muscle contraction in embryonic development or through electrical stimulation of paralyzed embryos). (B) In the absence of mechanical force (before onset of muscle contraction or in paralyzed embryos) there is reduced active Tgfβ ligand, pSMAD3 signaling, expression of ECM proteins and growth/branching of projections. Depiction of tenocyte morphogenesis in the absence of mechanical force.
Roles for tensional force in tendon morphogenesis
Tendons primarily experience tension from muscle contractions (Lavagnino et al., 2015; Wang, 2006). In contrast, skeletal cell types (e.g. osteocytes, osteoblasts, chondrocytes) are exposed to compressive forces (Klein-Nulend et al., 2012) or shear forces in the case of chondrocytes in joints exposed to fluid flow (Servin-Vences et al., 2017).We show that in the absence of tension during development, tenocytes reduce the extent and spread of their projections into the tendon ECM and this can be rescued by a short bout of contraction. Tendon defects and injuries result from dramatic changes in tension experienced either instantly or periodically over extended periods of muscle disuse or overuse (Franchi et al., 2013; Gaut and Duprez, 2016; Wang et al., 2012). Embryonic tenocyte progenitors experience muscle contractions at early stages and must continuously adapt to changes in muscle strength. Our results support the idea that the establishment and adaptation of MTJs occurs in response to mechanical force from muscle contraction and involves both changes in tenocyte morphogenesis and ECM production.We show that paralysis reduces tenocyte branching and tendon ECM, which can be rescued by restoring muscle contractions through electrical stimulation. Early experiments on developing chick embryos have shown that induced lack of muscle activity (either by lack of neuronal innervation or by injecting paralysis-inducing drugs) negatively affects the growth of associated skeletal structures, suggesting a role for force from muscle contraction as an essential cue for proper growth and differentiation of the skeleton (Hall and Herring, 1990; Hamburger and Waugh, 1940). During development, the skeleton is exposed to two major types of force – contractile (tension) force from muscles and compressional force (e.g. gravity). A contractile force from muscles has a greater impact on the growth of bones when compared to compression, indicating a primary role for muscle function in guiding the growth of associated skeletal tissues (Ellman et al., 2014; Warden et al., 2013). Recent studies in paralyzed limbs have shown that the development of a tendon-bone attachment unit, the enthesis, is affected by lack of muscle contraction (Schwartz et al., 2013; Tatara et al., 2014). Our studies suggest that muscle contraction has a similar role in the development of tendons. Immobilization experiments performed on canine models have shown that mechanical force is required for repair of tendon injuries (Gelberman et al., 1982). More recent studies using paralysis and restricted movement have shown that mechanical force has multiple roles in the maintenance of tenogenic gene expression, secretion of tendon ECM, and tenocyte survival (Gaut et al., 2016; Hettrich et al., 2011; Maeda et al., 2011).
Microtubules are essential for tenocyte projection stability and function
Cellular filopodia and neuronal axons require either F-actin and MTs or both in the formation and maintenance of projections, and new classes of cellular projections are emerging from recent studies such as cytonemes and airinemes (Bornschlögl, 2013; Eom et al., 2015; Huang and Kornberg, 2015; Witte et al., 2008). MTs also serve as pathways for trafficking various proteins, RNA, and other intracellular components along projections. Tenocytes in Drosophila rely on a network of polarized MTs for the maintenance of cellular structure and function (Subramanian et al., 2003), but similar requirements for cytoskeletal components have not been investigated in vertebrate tendons. Here, we show that zebrafish tenocytes are rich in MTs, which are required to maintain projections. Pharmacological disruption of MTs destabilized the projections without affecting tenocyte cell bodies. This reduced Tsp4b localization suggesting that tenocyte projections both sense force and respond to it by altering ECM organization in an MT-dependent manner. A caveat to this result is that treatment of embryos with Nocodazole causes global destabilization of MT in the entire embryo. Hence, the effects on tenocyte projections and tendon ECM organization could also arise in response to MT destabilization in neighboring muscle fibers, axons and other cells. Similar roles for cellular projections have been observed in pigment cells, where airinemes composed of both F-actin and MTs play a role in long-range signaling by secreting signaling ligands at the tips of their projections (Eom et al., 2015). We find that loss of tenocyte projections leads to upregulated expression of scxa and ctgfa in MT-deficient embryos, suggesting that they revert to a more dedifferentiated state.
Tenocyte projections are force sensors in the tendon ECM
Previous EM studies of human and rat tendons have described tenocytes projecting into the tendon matrix, but their functional significance has remained unclear (McNeilly et al., 1996; Pingel et al., 2014). 3D reconstructions from EM studies suggest a role for these projections, referred to as ‘fibropositors’ in one study, in secreting collagen fibrils (Canty et al., 2004). Analysis of Scx expression in chick and mouse using immunostaining and transgenic reporter lines, respectively, have shown that limb tendons elongate as the musculoskeletal system matures (Brent et al., 2003; Kardon, 1998; Pryce et al., 2007). Our results in zebrafish reveal that such elongated projections are conserved, but quite distinct in different classes of tenocytes. While cranial tenocytes resemble those in the limb in that they extend in parallel to the direction of force, axial tenocytes extend their projections perpendicular to the plane of muscle contraction (with opposing directions of contractile force) (Figure 1 and Figure 1—figure supplement 2). Based on our results, we propose that these distinct morphologies reflect a more structural, load-bearing role for cranial (and limb) tenocytes, while early larval axial tenocytes in zebrafish function as tension sensors in the myoseptum. Many important questions remain and form the basis of future studies, including why these cells are so polarized and how this mediolateral polarity develops. Consistent with the tension-sensor hypothesis, the timing of the outgrowth of tenocyte projections tightly correlates with the onset of muscle contraction. Tension sensing projections are observed in other musculoskeletal tissues as osteocytes extend projections into the bone matrix where they are thought to form a network of force sensors (Cowin et al., 1991) that modulate bone formation and resorption (Klein-Nulend et al., 2012; Schaffler et al., 2014). Likewise, the cues that cause osteoblasts to form these projections as they differentiate into osteocytes remain unknown (Franz-Odendaal et al., 2006). Similar to our results with zebrafish tenocytes, mammalian osteocyte projections increase in density in response to force, consistent with a role as force sensors and responders in both cases.In both bone and tendon, the ECM undergoes dynamic changes in expression of collagens, fibronectin, laminin and MMPs, and this is also the case in the developing somites of zebrafish embryos (Jenkins et al., 2016; Snow and Henry, 2009). Tenocyte projection formation also correlates with the establishment of tendon ECM. Previous studies have shown remodeling of MTJ ECM between 24 and 48 hpf with a progressive reduction of Fn, which is replaced by increased in levels of Lam at the MTJ (Jenkins et al., 2016). Our results suggest that initial production and accumulation of Fn is independent of force at 24 hpf, when tsp4b also shows force-independent expression. The later force-dependent expression and localization of Tsp4b at 48 hpf indicates that dynamic regulation of tendon ECM occurs after the onset of muscle contraction, which suggests a role for mechanical force in the process. Mammalian tenocytes actively sense mechanical force in vitro, resulting in changes in gene expression, cytoskeletal organization and ECM secretion (Banos et al., 2008; Gaut et al., 2016; Havis et al., 2016; Maeda et al., 2010; Maeda et al., 2013; Maeda et al., 2011). This depends, at least in part, on gap junctional complexes that localize to tenocyte projections (Maeda et al., 2012). Exercise induces Tenomodulin (Tnmd) and Col1a1 expression and tenocyte proliferation in rats (Eliasson et al., 2009; Zhang and Wang, 2013) and stress induces COL4A1 and COL6A1 expression in chick tenocytes (Marturano et al., 2014). Despite these changes in gene expression, the molecular mechanisms underlying these cellular signaling responses to force are unclear. Embryonic tenocyte projections in zebrafish end in bouton-like structures close to the dermis (Figure 1—figure supplement 1A,B), which may act as signaling beacons and ECM secreting centers.The strong correlation between onset of muscle function, changing myotendinous ECM and tenocyte morphogenesis suggests a model in which force is transduced through cues from the ECM that induce the formation of projections (Figure 7A). Similar processes may underlie the projections of osteocytes and other mesenchymal cell types. Such feedback likely allows tendons to adapt to changing mechanical force during normal development and exercise, as well as in healing and repair of tendon injuries.
Mechanical forces and signaling
Our results show for the first time that activation of TGFβ signaling in response to mechanical force is required for tenocyte morphogenesis, in particular the growth and branching of tenocyte projections. Paralyzed embryos (αBTX-injected) lose pSMAD3 expression in tenocytes and projections shorten, which is rescued by restoring muscle contraction. Similarly, pharmacological inhibition of TGFβ receptors reduces pSMAD3 expression and shortens tenocyte projections. Studies of mechanotransduction have identified several putative signaling pathways involved, depending on the tissue, including TGFβ, YAP/TAZ, and Integrins, as well as membrane channels such as TrpV4 and Piezo receptors (Busch et al., 2017; Gumbiner and Kim, 2014; Lavagnino et al., 2015; Servin-Vences et al., 2017). Some of these pathways such as TGFβ and YAP/TAZ share intermediate signaling components and targets, which complicates our understanding of their role in mechanotransduction in specific tissues (Qin et al., 2018; Szeto et al., 2016). This could help explain the modest reduction in expression of tgfbip and ctgfa2 in SB431542-treated embryos, as other mechanotransduction signaling pathways may still function in these embryos to partially maintain expression levels of these genes (Figure 6—figure supplement 3) In vitro studies of tenocyte primary cultures and excised tendon tissue have shown elevated TGFβ signaling in response to mechanical load (Heinemeier et al., 2003; Heinemeier et al., 2007; Maeda et al., 2013; Maeda et al., 2011; Yang et al., 2004) and mice show elevated TGFβ signaling in muscles and tendons following exercise (Maeda et al., 2011). These studies suggest that TGFβ signaling, in addition to its earlier role in tenocyte specification (Havis et al., 2016), is involved in mechanotransduction in these cells after they differentiate. TGFβ signaling is activated by many factors, including integrins, BMP1 and MMPs which can act on the large latent complex (LLC), to release active TGFβ ligand from the ECM (Horiguchi et al., 2012; Keski-Oja et al., 2004; Todorovic et al., 2005). This could be the critical cue from the ECM that induces and modulates the formation of tenocyte projections. One candidate for initiating these events is Tsp4, since Tsps can activate TGFβ signaling by destabilizing latency-associated peptide (LAP) (Bailey Dubose et al., 2012). The tendon matrix is rich in MMPs and Tsps, which dynamically change in composition and activity depending on mechanical force (Jenkins et al., 2016; Popov et al., 2015; Subramanian and Schilling, 2014). The dynamic reductions in Tsp4b that we have shown in response to paralysis could fail to activate latent TGFβ in the tendon ECM. Furthermore, because we see reductions in Tsp4b expression in paralyzed embryos, our results support a model where force triggers TGFβ signaling leading to increased expression of Tsp4b, which in turn activates TGFβ expression, creating a positive feedback loop (Figure 7A,B). Transection of tendons or injection of botulinum toxin (Botox) to induce paralysis in mice causes tenocyte death and reduced expression of tenogenic genes (Maeda et al., 2011). In contrast, we observe neither cell death nor significant changes in tenogenic gene expression in paralyzed (cacnb1 mutant) zebrafish embryos until 5 dpf, several days after tenocyte differentiation. We interpret such a response as a separate response to prolonged disuse rather than an adaptation to force.These studies have shown a direct relationship between mechanical force and tendon development through TGFβ signaling in tenocytes. How do tenocyte progenitors begin the process of elongation and growth of projections? What are the roles of these projections during tendon embryonic development and in adult tendons? Osteocytes are known to induce repair pathways in bone when cracks or stress damage their processes (Dooley et al., 2014; Mulcahy et al., 2011). Do tenocyte projections perform a similar role in tendon repair? These are some of the questions that need to be addressed in the field of tendon biology. Understanding the relationship between force and tendon development is essential for developing effective treatment strategies that include engineering tendons to treat tendon injuries. Force sensing projections that allow cells to adjust their surrounding ECM, such as those we have described in tenocytes, may also be a more general feature of cells, particularly within the musculoskeletal system.
Materials and methods
Zebrafish transgenics and mutants
Tg(scx:mCherry) transgenics were generated by injecting a BAC construct (CH211-251g8) containing mCherry ORF inserted in frame after the start codon of the scxa gene (McGurk et al., 2017). A new mutant allele of cacnb1 was identified in a forward genetic screen and outcrossed with Tg(scxa:mCherry) to create a cacnb1;Tg(scxa:mCherry) line. All embryos were raised in embryo medium at 28.5°C (Westerfield, 2007), and staged as described previously (Kimmel et al., 1995). Craniofacial muscles and cartilages were labeled as described previously (Schilling and Kimmel, 1997). Adult fish and embryos were collected and processed in accordance with approved UCI-IACUC guidelines.
mRNA injections and drug treatments
A Pmtb-t7-alpha-bungarotoxin (αBtx) vector (Megason lab, Addgene, 69542) was used to synthesize αBtx mRNA following a previously published protocol and injected into Tg(scx:mCherry) embryos at the 1–2 cell stage (Subramanian and Schilling, 2014; Swinburne et al., 2015). A pIRESneo-EGFP-alpha Tubulin plasmid (Wadsworth lab, Addgene, 12298) was used to synthesize EGFP-α Tubulin mRNA following a previously published protocol and injected into Tg(scx:mCherry) embryos at the 1–2 cell stage (Rusan et al., 2001; Subramanian and Schilling, 2014).A stock solution of 50 mM SB431542 (Tocris 1614, SID: 241182574)), a selective inhibitor of TGFβ type I receptor was prepared in DMSO (Fisher Scientific D1281, SID: 349996472) and diluted to a final working concentration of 10 μM in embryo medium. Embryos were incubated in 10 μM SB431542 for 12 hr. Treated embryos were rinsed in pre-warmed (28.5°C) embryo medium before fixation for immunostaining or RNA extraction.A stock solution of 33 mM Nocodazole (Sigma M1404, SID: 336851328), an inhibitor of tubulin polymerization, was prepared in DMSO and diluted to a final working concentration of 0.33 mM in embryo medium. Embryos were incubated in 0.33 mM Nocodazole for 12 hr at 28.5°C. Treated embryos were either mounted for live imaging or fixed for immunostaining.
RT-PCR
Whole embryo RNA was extracted from control and paralyzed embryos collected at 48 hpf according to standard protocols using Trizol (Invitrogen 15596018) and Direct-zol RNA MinipPrep kits (Zymo Research R2061). RNA concentration was normalized between samples and used as a template for cDNA synthesis. cDNA was synthesized with oligodT primers using the standard protocol of ProtoScript II First Strand cDNA Synthesis Kit (NEB E6560). The synthesized cDNA was diluted to 1:20 and used as a template for RT-PCR using the protocol for the Luna Universal qPCR master mix (NEB M3003S). The primers used for RT-PCR are listed in Table 1. The reaction was run on a LightCycler 480 II Real time-PCR Instrument (Roche) and analyzed using LightCycler 480 Software. Each qPCR experiment was designed with triplicates of reactions for every biological sample and two biological samples were used for each analysis (Subramanian and Schilling, 2014).
Table 1.
List of primer sequences used for RT-PCR.
Name
Sequence
Gene
rpl13a-fp-qpcr
TCTGGAGGACTGTAAGAGGTATGC
ribosomal protein L13a
rpl13a-rp-qpcr
AGACGCACAATCTTGAGAGCAG
rps13-fp-qpcr
ATAGGCGAAGTGTCCCCACA
ribosomal protein S13
rps13-fp-qpcr
CAGTGACGAAACGCACCTGA
scxa-fp-qpcr
GGAGAACTCGCAGCCCAAA
scleraxis A
scxa-rp-qpcr
AATCCCTTCACGTCGTGGTTT
tsp4b-fp-qpcr
ACAATCCACGAGACAACAGC
thrombospondin 4b
tsp4b-rp-qpcr
GCACTCATCCTGCCATCTCT
ctgfa-fp-qpcr
CTTTACTGTGACTACGGCTCC
connective tissue growth factor a
ctgfa-rp-qpcr
ACAACTGCTCTGGAAAGACTC
tgfbip-fp-qpcr
CCCCAATGTTTGTGCTATGC
tgfβ induced peptide
tgfbip-rp-qpcr
CTCCAATCACCTTCTCATATCCAG
ddPCR
cDNA was prepared from whole embryo RNA using the standard protocol of ProtoScript II First Strand cDNA Synthesis Kit (NEB E6560). The cDNA concentration was determined following standard protocol and reagents from the Qubit SSDNA assay kit (Invitrogen Q10212) and fluorescence was read on a Qubit 2.0 fluorometer (Invitrogen Q32866). A total concentration of 1 ng was used from each sample to prepare 20 ml of ddPCR reaction following the instructions and reagents from QX200 EvaGreen ddPCR Supermix (Bio-Rad 186–4033).Primers for the PCR are listed in Table 1. The droplets were generated using QX200 Droplet Generation Oil for EvaGreen (Bio-Rad 1864005) on a QX200 Droplet Generator (Bio-Rad 1864002). The PCR reaction was run on a standard thermocycler under standard cycling conditions. Following the PCR the droplets were analyzed using QX200 Droplet Reader (Bio-Rad 1864003). The data were analyzed using QuantaSoft Analysis Pro Software.
Muscle stimulation
Electrical stimulation was used to induce muscle contraction, as previously described (Subramanian and Schilling, 2014). Both αBtx injected and control embryos or larvae were anaesthetized with Tricaine (ethyl 3-aminobenzoate methanesulfonate, Sigma A5040, SID: 329770864), placed on a silicone plate in embryo medium and stimulated for 2 min at 20V, 6 msec duration, 4 pulses/sec frequency and 6 msec delay between successive pulses. With these settings neither control nor paralyzed embryos showed any muscle detachment. Embryos were allowed to recover in embryo medium for 12 hr and further processed for immunostaining or RT-PCR.
Whole embryo immunohistochemistry
All embryos used for immunofluorescence experiments were fixed in 4% neutral pH buffered paraformaldehyde (PFA) for 2 hr at room temperature (25°C) or overnight at 4°C. The embryos were washed with 1X Phosphate Buffered Saline (PBS, CID: 24978514) and permeabilized with cold acetone (Fisher Scientific A94, SID: 349996362) for 15 min at −20°C. Following permeabilization, they were rehydrated in PBDT (PBS with 2% DMSO and 1% Triton X-100 (Sigma T9284)) and processed according to a standard antibody staining protocol. Primary antibodies used: rabbit anti-Tsp4b (1:500)(RRID: AB_2725793), mouse anti-myosin heavy chain (MHC) (Developmental Hybridoma - 1:250, A1025, RRID: AB_528356), chicken anti-GFP (Abcam – 1:1000, ab13970, RRID: AB_300798), rat monoclonal anti-mCherry (Molecular Probes −1:500, M11217, RRID: AB_2536611), rabbit anti-Laminin (Abcam – 1:200, ab11575, RRID: AB_298179), rabbit anti-Fibronectin (Abcam – 1:200, ab2413, RRID: AB_2262874 and rabbit anti-pSMAD3 (Antibodies-online – 1:500, ABIN1043888, RRID: AB_2725792). DiAmino PhenylIndole (DAPI) (Invitrogen – 1:1000, D1306, RRID: AB_2629482) was used to mark cell nuclei. Preabsorbed secondary antibodies were all obtained from Jackson ImmunoResearch and used for indirect immunofluorescence at 1:1000, including: Alexa Fluor 488 conjugated donkey anti-mouse IgG (715-546-150, RRID: AB_2340849), DyLight 549 conjugated donkey anti-rabbit IgG (711-506-152, RRID: AB_2616595), Alexa Fluor 488 conjugated donkey anti-rabbit IgG (711-545-152, RRID: AB_231358), Cy5 conjugated Goat anti-mouse IgG (115-176-071), Alexa Fluor 594 conjugated donkey anti-rat IgG (712-586-153, RRID: AB_2340691), and Alexa Fluor 488 conjugated donkey anti-chicken IgY (703-486-155). After staining, embryos were mounted in 1% low melt agarose in PBS and imaged.
Microscopy and image analysis
Embryos processed for fluorescent immunohistochemistry were imaged using a Nikon A1 confocal system with an Nikon Eclipse Ti inverted microscope using a CFI Plan Apochromat VC 60XC (water immersion) objective. Confocal stacks were analyzed using Image J software. The depth-coded 3D reconstructions were created using Nikon software (NIS-Elements AR 4.60.00 64-bit). To better visualize tenocyte projections along the Z-axis, the 3D reconstructed image was rotated to about 45o. The length of projections was measured using the Neurite Tracer plugin on Image J.
Statistical analysis
Sample size and number of data points required for each experiment were determined using a power analysis calculator (www.powerandsamplesize.com). The embryos were collected from a single tank of fish and processed for injection and downstream stimulation together to minimize variation introduced during handling. Fixation and staining of embryos were also performed together for all samples in a given experiment. Imaging of embryos within each experiment was performed with identical parameters. In order to control for variation in position of tenocyte cell bodies and antibody penetrance variation, projection length, fluorescence intensity of ECM proteins and pSMAD3 were always measured in the ventral half of the VMS in somites 16–19. In experiments where a normal distribution was not present, we analysed the significance using a Wilcoxon Rank Sum test. In datasets involving two samples of unequal variance, a t-test was used. In experiments with more than two experimental conditions, an ANOVA single-factor analysis was performed with posthoc multiple comparisons using Tukey method on R. Data were also quantified and analyzed separately by two of the authors to account for user bias and they obtained similar results. Fluorescence Intensity (FI) to quantify protein localization was measured as described previously (Subramanian and Schilling, 2014).In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.Thank you for submitting your manuscript entitled "Mechanical force regulates tendon extracellular matrix organization and tenocyte morphogenesis through TGFβ signaling" for peer review at eLife. Your article has been evaluated by three peer reviewers, and the evaluation has been overseen by a Reviewing Editor and by Anna Akhmanova as the Senior Editor. The reviewers have discussed the reviews with one another, and their discussion has raised a number of issues (elaborated below) that would need to be addressed through revisions to your manuscript.Summary:In this manuscript, Subramanian and colleagues investigate the role of tenocyte projections in the development of the muscle-tendon junction. Their newly generated scx:mCherry line has unlocked the ability to image the tenocyte and its interactions in living muscle tissue, providing unique insights in to the in vivo cell biology of tenocyte maturation. Using this line, they first observe the development of tenocytes and note that these cells form very long cellular protrusions that are microtubule-based. Through a clever set of experiments, they show that the protrusions require muscle contraction for their full extension. Impairing the full development of these tenocyte projections reduces the amount of the myotendinous protein Tsp4b and alters its localization pattern. This led the authors to ask if these projections sense mechanical force through TGFβ, a known latent ECM cue activated by mechanical stress. Similar to blocking muscle contraction, inhibition of TGFβ signaling also reduces pSMAD3 levels and reduces the length of tenocyte projections. Consistent with the idea that muscle contraction activates TGFβ signaling in tenocytes, the authors find that tenocyte genes are also down regulated when muscle contraction is blocked or TGFβ signaling is blocked. Altogether, this is an interesting study with spectacular imaging that has the potential to be an important paper in the field of tendon extracellular matrix biology. However, there are a few concerns that should be addressed before publication.Essential revisions:1) The Introduction does not quite accurately describe the state of the field. For example, the authors state: "Despite recent insights into the nature of such responses, few studies have investigated how cells adapt to force and alter the ECM landscape to strengthen or weaken it accordingly". Collagen synthesis at tendons has been linked to mechanical loading and inactivity decreasing collagen turnover has been identified since the early 2000s. (One example is "Role of Extracellular Matrix in Adaptation of Tendon and Skeletal Muscle to Mechanical Loading", 2004). It would be helpful to modify the text to highlight that there is a fair amount known about how cells in culture respond to force and change the matrix accordingly, but less is known in vivo (with appropriate references).2) The manuscript seems to be written for a reader who is quite familiar with the zebrafish system. The impact of the manuscript would be much higher if the authors made it more accessible for a broader range of readers (explaining the difference between what they are calling embryonic and larval development, what are the horizontal and vertical myosepta, what is a hemisegment, etc.). Also, while there is controversy amongst zebrafish investigators at which point the somite boundaries should be called vertical myosepta versus myotendinous junctions, it is also potentially true that the impact outside the field would be higher if the authors decided to call them MTJs.3) The authors see a reduction in the length of the projections from 70 μm to 50 μm. They imply that this is causal for mechanical sensing and gene expression by tenocytes. However, there is no evidence for this. They should tone down this statement a little. They should also clarify why they think that a reduction by 20% or so is consequential to the MTJ.4) Nocodazole treatment is a very harsh way of assessing the role of microtubules in tenocyte projection formation and mechanical tension. Treatment with Noco for 12 hours will most likely block many biological processes besides tenocyte projection formation, and some of these processes could indirectly impact tenocytes. Was this blocking performed for 12 hours directly before fixing? Why was such a long time chosen? Do shorter treatments affect projections? Is there a strategy that the authors could use to block microtubule function in tenocytes specifically? If not, they should certainly state the caveats of whole-embryo treatment with nocodazole, and they should modify their interpretations accordingly, especially regarding their claim that microtubules are required for tenocyte projection formation and tenocyte gene expression.5) LA treatment should be done on its own. Maybe the tenocyte projections are dependent on both MT and F-actin? The no-enhancement observation does not exclude this. If true, this would also give the authors genetic tools to specifically affect actin and thus projections in the tenocytes.6) Ubiquitous Tsp4b-GFP expression and force: The authors postulate that Tsp4b is secreted by tenocytes upon force generation by muscles. However, this experiment is testing only if force affects the localization of Tsp4-GFP/Tsp4b but not its secretion by tenocytes. In fact, the presence (albeit diffuse) of Tsp4b protein in αBTX embryos shows that force does not induce secretion of Tsp4b per se (though it might enhance it).7) Depth-coding color scale is inconsistent, sometimes pink=0μm, sometimes blue=0μm. It is important to fix this because without a consistent scale one cannot judge changes in tenocyte projection length. Also, please adjust scale such that the soma of the tenocytes is always at the same depth/color to judge length defects.8) Quantification of antibody fluorescence is tricky/error-prone. Ratio images between mCherry signal from scx:mCherry and pSMAD3 signal would be helpful to visualize changes. Ratio image of panels C divided by B and panels G divided by F would be informative in Figure 5 and 6.9) Force-dependent gene expression: αBTX looks convincing but SB431542-treated embryos show a mild reduction only. Nocodazole affects gene expression inconsistent with hypothesis/conclusion (scx goes up, ctgfa2 goes up – maybe because nocodazole just makes the embryos very sick?). If force induces TGFβ signaling which induces gene expression, then the changes in gene expression should be roughly equivalent in αBtx (no force) and SB431542-treatments (no TGFβ signaling). This is not the case, so force does not only act through TGFβ signaling (or the inhibitor does not fully inhibit – unlikely though since pSMAD3 is more reduced than in αBtx injections). Since qPCR is a global (and fairly noisy) assay, is there another way to look at gene expression (antibodies, reporter transgenes)? If so, scx:mCherry reporter/antibody embryos could be analyzed in the different conditions and mCh could serve as a reference/normalization (not in the case of nocodazole though).10) If αBTX injection nearly completely suppresses tsp4bmRNA expression by qPCR, why is there Tsp4b protein (Figure 3—figure supplement 1) in these embryos? The reduction in Tsp4b protein is by far not as striking. Could this be clarified? Also, is there a way to control for both initial levels of expression and the rate of decline of mRNA in different embryos? Is it possible that electrical stimulation not only results in restoring force but also signaling?11) The authors contend that ECM organization of the vertical myosepta is under the control of tenocytes. However, they only look at one specialized component of the ECM, thrombospondin4. It would be helpful if Figure 3 could better address the issue of tenocytes' contribution to ECM organization as a whole. Although the authors have previously shown that Thrombospondin4 is an important regulator of muscle cell adhesion, it is unlikely to be the major component of the muscle extracellular matrix. The majority of the matrix is already secreted directly from the muscles themselves, and initial muscle attachment occurs in the absence of tenocytes. How do tenocytes reinforce or mature the ECM generally? Would it be feasible to stain for two or more major ECM components in the vertical myosepta, such as laminin, fibronectin or collagen? TEM could also be an excellent readout.12) Image analysis/stats: The authors are lauded for attempting to quantify their data. However, the details provided do not necessarily provide confidence in how the data were analyzed.a) The image analysis section does not specifically address the issue of blinding, and certainly many of the measurements done depend tremendously on user input.b) How exactly were projections segmented and branch length was quantified? Was this done manually? If images were segmented in Fiji then the parameters of masking, etc. should be detailed.c) The t-test is appropriate for normal distributions, was this the case with the data obtained?d) The authors said power analyses were done but still 3 embryos per conditions seems quite low. Also, how were the 50 data points/embryo chosen? Were they always from the same anterior-posterior location? There could be a great deal of subjectivity in the choosing of those data points as well and theoretically they should have been randomly chosen.e) Given that the relevant details were not provided, it is likely that the analysis and stats were done in a less than ideal fashion. Rather than spend 2 months redoing them, one option would be for the authors to provide supplemental data with multiple image examples of each experiment.Essential revisions:1) The Introduction does not quite accurately describe the state of the field. For example, the authors state: "Despite recent insights into the nature of such responses, few studies have investigated how cells adapt to force and alter the ECM landscape to strengthen or weaken it accordingly". Collagen synthesis at tendons has been linked to mechanical loading and inactivity decreasing collagen turnover has been identified since the early 2000s. (One example is "Role of Extracellular Matrix in Adaptation of Tendon and Skeletal Muscle to Mechanical Loading", 2004). It would be helpful to modify the text to highlight that there is a fair amount known about how cells in culture respond to force and change the matrix accordingly, but less is known in vivo (with appropriate references).1a) We have modified the text to clarify these points and include additional references. However, while in vitro studies in collagen gels have shown that force is necessary for tendon ECM turnover, exercise paradigms have given mixed results on the effect of force on tendon ECM. In general, a systematic analysis of the role of force on developing tendons in vivo is lacking, particularly its influence on tenocyte differentiation.1b) Introduction, first paragraph: We have added references that appropriately show the role of force in ECM organization (Maeda et al., 2011; Ng et al., 2014).1c) Introduction, first paragraph: We have also added the word “in vivo” to stress the fact that there are very few in vivo studies that have investigated the role of force in ECM organization and cellular morphogenesis.2) The manuscript seems to be written for a reader who is quite familiar with the zebrafish system. The impact of the manuscript would be much higher if the authors made it more accessible for a broader range of readers (explaining the difference between what they are calling embryonic and larval development, what are the horizontal and vertical myosepta, what is a hemisegment, etc.). Also, while there is controversy amongst zebrafish investigators at which point the somite boundaries should be called vertical myosepta versus myotendinous junctions, it is also potentially true that the impact outside the field would be higher if the authors decided to call them MTJs.2a) We have explained zebrafish-specific developmental time points and anatomical terms.2b) Subsection “Tenocytes elongate with the onset of muscle contraction”, first paragraph: Explains the difference between embryonic and larval time points.2c) Subsection “Tenocytes elongate with the onset of muscle contraction”, first paragraph: Explains the terms VMS and HMS.2d) Subsection “Tenocytes elongate with the onset of muscle contraction”, first paragraph: We have removed the term hemisegment to avoid confusion and have used the term MTJ to refer to muscle attachment sites.3) The authors see a reduction in the length of the projections from 70 μm to 50 μm. They imply that this is causal for mechanical sensing and gene expression by tenocytes. However, there is no evidence for this. They should tone down this statement a little. They should also clarify why they think that a reduction by 20% or so is consequential to the MTJ.3a) We find a strong correlation between force-induced changes in both projection length and branching with associated gene expression, including ECM proteins we know are vital for MTJ integrity. However, proving experimentally that this is causal is extremely difficult, and we have toned down our arguments accordingly. Reduced length implies that projections sense force changes and respond by penetrating and traversing through the ECM. While the roles of such projections in tenocytes are not well understood, similar responses to force have been shown for osteocytes, as we already mention in the text. We include data on projection length, number, and branching at additional stages. While 20% may not seem like much, this combined with reduced branching leads to many fewer projections per unit area, which we have quantified and added to the Results.3b) Subsection “Tenocyte elongation requires muscle contraction”: We have performed further analyses to show that in addition to length of projections and branching complexity, the density of projections along the VMS is also affected in a significant manner. We include the data as Figure 2—figure supplement 1.3c) Subsection “Tenocyte elongation requires muscle contraction”: We also stress that our results only show a strong correlation between mechanical force and tenocyte morphogenesis.4) Nocodazole treatment is a very harsh way of assessing the role of microtubules in tenocyte projection formation and mechanical tension. Treatment with Noco for 12 hours will most likely block many biological processes besides tenocyte projection formation, and some of these processes could indirectly impact tenocytes. Was this blocking performed for 12 hours directly before fixing? Why was such a long time chosen? Do shorter treatments affect projections? Is there a strategy that the authors could use to block microtubule function in tenocytes specifically? If not, they should certainly state the caveats of whole-embryo treatment with nocodazole, and they should modify their interpretations accordingly, especially regarding their claim that microtubules are required for tenocyte projection formation and tenocyte gene expression.4a) We have done shorter nocodazole treatments [our original experiments were based on published studies that treated up to 6 hrs (Mendieta-Serrano et al., 2013)] but these did not show strong effects on tenocytes and treated embryos appeared similar to siblings.Subsection “Microtubules are essential for tenocyte projection stability and function”: We have added a caveat in the Discussion acknowledging the global effects of Nocodazole on the whole embryo and the possibility of indirect effects on tendon ECM and tenocyte morphology.5) LA treatment should be done on its own. Maybe the tenocyte projections are dependent on both MT and F-actin? The no-enhancement observation does not exclude this. If true, this would also give the authors genetic tools to specifically affect actin and thus projections in the tenocytes.5a) Injection of LifeAct DNA results in high mortality. However, in the few embryos that survive F-actin is well labeled elsewhere but there is no visible fluorescence in tenocyte projections, suggesting that they lack actin fibrils. We have performed LifeAct treatments alone and did not observe any effect on tenocytes at low doses. In addition, several attempts in injecting F-actin-GFP showed no expression in tenocytes. Hence, we are confident that F-actin is not a major player in tenocyte projection growth and maintenance. To avoid further confusion, we have removed the Latrunculin results from the manuscript and the figure.6) Ubiquitous Tsp4b-GFP expression and force: The authors postulate that Tsp4b is secreted by tenocytes upon force generation by muscles. However, this experiment is testing only if force affects the localization of Tsp4-GFP/Tsp4b but not its secretion by tenocytes. In fact, the presence (albeit diffuse) of Tsp4b protein in αBTX embryos shows that force does not induce secretion of Tsp4b per se (though it might enhance it).6a) Even though some Tsp4b protein remains at MTJs in αBTX-treated paralyzed embryos, this is likely produced by myoblasts prior to the onset of muscle contraction. We have previously shown that Tsp4b is first expressed throughout the myotome at the 18-somite stage (20 hpf), prior to muscle differentiation, and only later becomes restricted to tenocytes after 24 hpf (Subramanian and Schilling, 2014). Presumably any protein synthesized at these early stages later localizes to MTJs. Consistent with this, transplants of muscle progenitors locally produce Tsp4b, which can rescue muscle attachments (Subramanian and Schilling 2014). Later it appears that tenocytes take over production of Tsp4b and other ECM proteins to strengthen and maintain attachments.6b) To further clarify this force-dependent versus -independent Tsp4b expression we have performed qPCR on αBTX-treated paralyzed embryos at 24 and 48 hpf.Subsection “Tenocyte projections are force sensors in the tendon ECM”, second paragraph: Due to technical issues with the FAC sorter and the weak fluorescence of our transgene at 24 hpf we were unable to FACS sort tenocytes for PCR. Therefore, we performed a real-time PCR analysis on 24 hpf and 48 hpf embryos (control and αBtx injected). We observed significant reductions in Tsp4b expression in αBtx samples only at 48 hpf. We include these results in Figure 3—figure supplement 3.7) Depth-coding color scale is inconsistent, sometimes pink=0μm, sometimes blue=0μm. It is important to fix this because without a consistent scale one cannot judge changes in tenocyte projection length. Also, please adjust scale such that the soma of the tenocytes is always at the same depth/color to judge length defects.Due to limitations in the software of the confocal microscope, we were unable to select for a range in the image stack to obtain uniform color coding. We have instead provided a scale bar that uses a uniform gradient bar where Blue is 0 and Red/Yellow is 95 μm.8) Quantification of antibody fluorescence is tricky/error-prone. Ratio images between mCherry signal from scx:mCherry and pSMAD3 signal would be helpful to visualize changes. Ratio image of panels C divided by B and panels G divided by F would be informative in Figure 5 and 6.In order to visualize the fine details of the projections, we have to overexpose the cell bodies in the red channel (mCherry). Hence, we normalized the green channel (pSMAD3 signal) with background fluorescence signal in the same channel. The background signal was obtained from a ROI that was similar in area to the nucleus but in an anuclear region. This was performed blindly by two authors (LK and AS) to avoid any user bias. The statistics were performed with these new normalized data points.9) Force-dependent gene expression: αBTX looks convincing but SB431542-treated embryos show a mild reduction only. Nocodazole affects gene expression inconsistent with hypothesis/conclusion (scx goes up, ctgfa2 goes up – maybe because nocodazole just makes the embryos very sick?). If force induces TGFβ signaling which induces gene expression, then the changes in gene expression should be roughly equivalent in αBtx (no force) and SB431542-treatments (no TGFβ signaling). This is not the case, so force does not only act through TGFβ signaling (or the inhibitor does not fully inhibit – unlikely though since pSMAD3 is more reduced than in αBtx injections). Since qPCR is a global (and fairly noisy) assay, is there another way to look at gene expression (antibodies, reporter transgenes)? If so, scx:mCherry reporter/antibody embryos could be analyzed in the different conditions and mCh could serve as a reference/normalization (not in the case of nocodazole though).While our results suggest that TGFβ signaling is a primary mechanotransduction pathway in tenocyte morphogenesis, they do not exclude other signaling pathways such as YAP/TAZ etc., which can also induce CTGF. Hence, reducing force has a stronger effect on gene expression because it shuts down all mechanotransduction pathways, while inhibitor treatments specifically affect TGFβ-dependent expression. To address this we made several attempts at isolation of mCherry positive tenocytes using FACS. The experiment involved dissociation of embryos to produce a cell suspension for sorting, which took about 45’ of enzymatic and mechanical dissociation. The process of sorting took another 2 hours as we had four samples to sort for each experiment. Hence, the tenocytes were dissociated from their native ECM environment for a prolonged period of time, which we believe must have stressed the cells. Hence, ddPCR and qPCR results from the extracted RNA showed random expression levels of genes (including housekeeping genes).Subsection “Tenocyte projections regulate force-dependent gene expression”: Hence, we opted to perform a ddPCR reaction on RNA extracted from whole embryos, which showed absolute expression levels of genes that matched the pattern observed in our qPCR experiment. We have included these ddPCR data in Figure 6—figure supplement 2.10) If αBTX injection nearly completely suppresses tsp4b mRNA expression by qPCR, why is there Tsp4b protein (Figure 3—figure supplement 1) in these embryos? The reduction in Tsp4b protein is by far not as striking. Could this be clarified? Also, is there a way to control for both initial levels of expression and the rate of decline of mRNA in different embryos? Is it possible that electrical stimulation not only results in restoring force but also signaling?Muscle progenitors produce some Tsp4b prior to differentiation (see comment #6). Electrically stimulating muscle contractions in control embryos does not alter gene expression, suggesting that the changes we observe are due to mechanical force. As mentioned in the response to comment #6, we have performed a qPCR at an early embryonic stage – 24 hpf – and a later stage – 48 hpf – in both control and αBtx injected embryos. We observe a force-independent basal expression of Tsp4b at 24 hpf similar to the expression of Tsp4b in paralyzed 48 hpf embryos. From our previous work (Subramanian and Schilling, 2014) we know that Tsp4b is robustly expressed in the entire myotome until 30 hpf and that ectopic expression of Tsp4b RNA always produces protein that localizes to MTJs. Hence, we do not see a strong correlation between the protein level and RNA levels at later stages.11) The authors contend that ECM organization of the vertical myosepta is under the control of tenocytes. However, they only look at one specialized component of the ECM, thrombospondin4. It would be helpful if Figure 3 could better address the issue of tenocytes' contribution to ECM organization as a whole. Although the authors have previously shown that Thrombospondin4 is an important regulator of muscle cell adhesion, it is unlikely to be the major component of the muscle extracellular matrix. The majority of the matrix is already secreted directly from the muscles themselves, and initial muscle attachment occurs in the absence of tenocytes. How do tenocytes reinforce or mature the ECM generally? Would it be feasible to stain for two or more major ECM components in the vertical myosepta, such as laminin, fibronectin or collagen? TEM could also be an excellent readout.To measure effects of force on other tendon ECM proteins, we have performed immunohistochemical staining for fibronectin (Fn) and laminin (Lam) in paralyzed and stimulated embryos, which can be done in a few weeks. TEM would require 3-6 months minimum as UCI does not have a facility and we would rely on a core facility at UCSD (previously used to examine MTJ ultrastructure in Tsp4b-deficient or stimulated zebrafish). It is also unclear that TEM analyses would add critical additional information other than a higher resolution readout of ECM organization.Subsection “Tenocyte projections are force sensors in the tendon ECM”, second paragraph: To analyze additional force dependent effects on MTJ ECM organization, we stained for Laminin and Fibronectin proteins that have been well studied in the context of MTJ development. We did not observe any significant changes in their localization pattern or fluorescence intensity at MTJs for either Lam or Fn in control versus αBtx-injected embryos. We have included a supplement figure showing the quantified data – Figure 3—figure supplement 1. Since, previous studies have shown that Fn is secreted from the developing myotome prior to muscle attachment and is later replaced by Lam between 24 hpf to 48 hpf, we hypothesize that these ECM components are not dependent on mechanical force from muscle contraction for their localization.12) Image analysis/stats: The authors are lauded for attempting to quantify their data. However, the details provided do not necessarily provide confidence in how the data were analyzed.a) The image analysis section does not specifically address the issue of blinding, and certainly many of the measurements done depend tremendously on user input.b) How exactly were projections segmented and branch length was quantified? Was this done manually? If images were segmented in Fiji then the parameters of masking, etc. should be detailed.c) The t-test is appropriate for normal distributions, was this the case with the data obtained?d) The authors said power analyses were done but still 3 embryos per conditions seems quite low. Also, how were the 50 data points/embryo chosen? Were they always from the same anterior-posterior location? There could be a great deal of subjectivity in the choosing of those data points as well and theoretically they should have been randomly chosen.e) Given that the relevant details were not provided, it is likely that the analysis and stats were done in a less than ideal fashion. Rather than spend 2 months redoing them, one option would be for the authors to provide supplemental data with multiple image examples of each experiment.1) We provide a detailed account of our statistical methods and quantification including the use of Image J plugins for branch point quantification, projection length measurements etc.2) We have included detailed descriptions of all the statistical tests that were conducted and the conditions for choosing the appropriate tests. We have consulted multiple statisticians familiar with biological sampling to verify our statistical tests.3) Wherever feasible we have included actual data points as dot plots to show variance within and across embryos in each sample.4) Two authors, LK and AS, performed the measurements from image files with no knowledge of sample identity or condition. This helped limit user bias.5) The projection length was measured manually using Simple Neurite Tracer. This plugin allows the user to map the projection across Z planes, computes the length of the projection and provides a visual representation of the track chosen by the software. We compared this track with the actual path of the project in a 3D reconstruction to confirm validity of the traces. Once confirmed the measurements were recorded for later analysis.6) Before conducting a statistical test, we computed the variance and normality in the sample. For samples that lacked normality, we used Wilcoxon Rank Sum Test. For experiments where only two samples were compared, a t-test was only used when normality was established. For experiments involving more than 2 samples, we employed an ANOVA 1-way analysis with Tukey Post-Hoc test for individual comparisons, when equal variance was satisfied. In cases where equal variance was not satisfied, we used the Kruskal-Wallis test.7) All images were captured at similar anatomical locations, between somites 16-19 in the embryos. We always quantified our data from the ventral VMS (MTJ) in these 4 somites. Datapoints were never controlled by the user. We collected all data from each tenocyte in the ventral VMS – projection length, fluorescence intensity, pSMAD3 fluorescence intensity. Hence, there is a variation in the number of datapoints between VMSs in an embryo and between embryos in the same sample.We have provided these descriptions on our statistical methods under the Materials and methods section.
Key resources table
Reagent type (species) or resource
Designation
Source or reference
Identifiers
Additional information
Antibody
Rabbit anti Tsp4b
Schilling lab
RRID: AB_2725793
1:500 dilution
Antibody
Mouse anti Myosin heavy chain
DSHB
Cat# A4.1025, RRID: AB_528356
1:250 dilution
Antibody
Chicken anti GFP
Abcam
Cat# ab13970, RRID: AB_300798
1:1000 dulution
Antibody
Rat anti mCherry
Molecular Probes
Cat# M11217, RRID: AB_2536611
1:500 dilution
Antibody
Rabbit anti Fibronectin
Abcam
Cat# ab2413, RRID: AB_2262874
1:200 dilution
Antibody
Rabbit anti Laminin
Abcam
Cat# ab11575, RRID: AB_298179
1:200 dilution
Antibody
Rabbit anti pSMAD3
Antibodies-online
Cat# ABIN1043888, RRID: AB_2725792
1:500 dilution
Antibody
Alexa Fluor 488 conjugated Donkey anti Chicken IgY
Authors: Stephen G Szeto; Masahiro Narimatsu; Mingliang Lu; Xiaolin He; Ahmad M Sidiqi; Monica F Tolosa; Lauren Chan; Krystale De Freitas; Janne Folke Bialik; Syamantak Majumder; Stellar Boo; Boris Hinz; Qinghong Dan; Andrew Advani; Rohan John; Jeffrey L Wrana; Andras Kapus; Darren A Yuen Journal: J Am Soc Nephrol Date: 2016-03-09 Impact factor: 10.121
Authors: Neal L Millar; Karin G Silbernagel; Kristian Thorborg; Paul D Kirwan; Leesa M Galatz; Geoffrey D Abrams; George A C Murrell; Iain B McInnes; Scott A Rodeo Journal: Nat Rev Dis Primers Date: 2021-01-07 Impact factor: 52.329
Authors: R Wilder Scott; Martin Arostegui; Ronen Schweitzer; Fabio M V Rossi; T Michael Underhill Journal: Cell Stem Cell Date: 2019-12-05 Impact factor: 24.633