Osteogenic protein-1 attenuates nucleus pulposus cell apoptosis through activating the PI3K/Akt/mTOR pathway in a hyperosmotic culture.

BACKGROUND: Previous studies have indicated that osteogenic protein-1 has protective effects on the biological functions of intervertebral disc cells. Hyperosmolarity is an important physicochemical factor within the disc nucleus pulposus (NP) region, which obviously promotes NP cell apoptosis.
OBJECTIVE: To study the effects of osteogenic protein-1 (OP-1) on NP cell apoptosis induced by hyperosmolarity and the potential signaling transduction pathway.
METHODS: Rat NP cells were cultured in a hyperosmotic medium with or without OP-1 addition for 7 days. Inhibitor 294002 and inhibitor FK-506 were used to investigate the role of the PI3K/Akt/mTOR pathway in this process. NP cell apoptosis were evaluated by cell apoptosis ratio, activity of caspase-3/9 and gene/protein expression of apoptosis-related molecules (Bax, Bcl-2, caspase-3/cleaved caspase-3 and cleaved PARP).
RESULTS: OP-1 addition obviously decreased cell apoptosis ratio and caspase-3/9 activity, down-regulated gene/protein expression of pro-apoptosis molecules (Bax, caspase-3/cleaved casepase-3 and cleaved PARP), up-regulated gene/protein expression of anti-apoptosis molecule (Bcl-2) in a hyperosmotic culture. Moreover, OP-1 addition significantly increased protein expression of p-Akt and p-mTOR. Further analysis showed that addition of LY294002 and FK-506 partly attenuated these protective effects of OP-1 against NP cell apoptosis and activation of the PI3K/Akt/mTOR pathway in a hyperosmotic culture.
CONCLUSION: OP-1 can attenuate NP cell apoptosis through activating the PI3K/Akt/mTOR pathway in a hyperosmotic culture. The present study sheds a new light on the protective role of OP-1 in regulating disc cell biology and provides some theoretical basis for the application of OP-1 in retarding/regenerating disc degeneration.

Introduction

Low back pain is a common and costly physical disease around the world, generating enormous socioeconomic burden and seriously affecting patient’s life quality [1]. Its global prevalence is estimated to reach 12% and even the morbidity increases in the coming years with aging acceleration [2]. Though the etiology of it is not very clear until now, many researchers agree that intervertebral disc degeneration largely contributes to low back pain [3-5].

The interverterbral disc (IVD) contains three distinct regions: nucleus pulpusus (NP), annulus fibrosus (AF) and cartilage endplate (CEP) [6]. The main cause of disc degeneration is the decline in the activity and quantity of NP cells, and the subsequent decrease in extracellular matrix, including proteoglycans and collagens [7]. Therefore, inhibiting decline of NP cell number is a potential approach to retard disc degeneration.

The physicochemical environment of IVD obviously differs from that of other tissues in the body. It has been well established that the microenvironment within the disc tissue is acidity, low nutrition supply, hypoxia and hyperosmolarity [8]. The sulfated glycosaminoglycan (GAG) side chains of proteoglycan contains a high content of fixed negative charge density, which leads to a hyperosmotic microenvironment of the extracellular fluid in the IVD [9]. Previous studies have reported that the baseline osmolarity within a healthy disc changes between 430 and 550 mOsm/l, depending on the disc zone, mechanical load and degeneration stage [9,10]. According to the previous studies, osmolarity alteration significantly affects disc cell biology, such as proliferation and chondrogenic differentiation of NP region-derived mesenchymal stem cells [11], pro-inflammatory cytokine’s production [12] and disc extracellular matrix (ECM) synthesis [10,13-18]. What’s more, hyperosmolarity is reported to induce disc cell apoptosis [19,20].

Osteogenic protein-1 (OP-1), known as bone morphogenetic protein-7, is down-regulated in the degenerative disc tissue [21]. Recently, increasing evidence has demonstrated that OP-1 is effective in promoting disc matrix synthesis and retarding disc degeneration in the animal disc degeneration models [21-24]. Therefore, in the present study, we mainly aimed to investigate the effects of OP-1 on NP cell apoptosis induced by a hyperosmolarity, as well as the role of the PI3K/Akt/mTOR pathway in this process.

Materials and methods

Ethical statement

Animal disc tissue samples were obtained according to the guidelines of the Ethics Committee at Xiangya Hospital affiliated to the Central South University [SAU(X) 2013-0327].

NP cell isolation and culture

NP cells were isolated from the discs (T11-L5) of 23 Sprague Dawley rats, and the isolation and expansion procedure were referred to the method described in a previous method [25]. The passage 2 NP cells were used to perform the present study. Briefly, the control NP cells were cultured in a hyperosmotic medium (550 mOsm/kg) whose osmolarity value was regulated by the addition of sucrose. The exogenous OP-1 (100 ng/ml) was added into the culture medium to investigate its protective effects against NP cell apoptosis. The inhibitor 294002 (1 μM) and inhibitor FK-506 (1 μM) were used to investigate the role of PI3K/Akt/mTOR pathway in this process. All experimental NP cells were cultured for 7 days in the designed test compounds under standard conditions (37°C, 21% O2 and 5% CO2).

Flow cytometry assay

After 7 days, NP cells were washed with sterile phosphate buffer solution (PBS). Then, they were collected by centrifugation (1000 rpm/min, 5 min, 4°C) after digestion with 0.25% trypsin without EDTA (Gibco, U.S.A.). Subsequently, they were fixed by 75% ethanol overnight at 4°C, followed by staining with Annexin V-FITC and propidium iodide under dark condition according to the manufacturer’s instructions (Beyotime, China). Finally, they were subjected to a flow cytometry machine to analyze the apoptotic cell ratio. Here, both the early and terminal apoptotic NP cells were regarded as apoptotic NP cells.

Caspase-3/9 activity measurement

After 7 days, NP cells were incubated with PBS for 2 to 3 times. Then, they were lysed using the lysis buffer, and then the supernatant protein sample was isolated by centrifugation at 12000 rpm for 15 min. Finally, caspase-3 and caspase-9 activities were measured according to the manufacturer’s instructions (Beyotime, China).

Real-time polymerase chain reaction

Gene expression of apoptosis-related molecules (Bcl-2, Bax and caspase-3) was analyzed on day 7. Total RNA was extracted using Trizol (Invitrogen, U.S.A.) reagent. Then, 1 μg of RNA was reversed-synthesized into cDNA using a Reverse Transcription Kit (TIANGEN, China). Finally, SYBR Green PCR was used to perform real-time PCR on a C1000™ PCR machine. The gene primers (Table 1) were synthesized by a domestic bio-company. The PCR parameters and conditions were: 3 min at 95°C, followed by 35 cycles of 15 s at 95°C, 10 s at 56°C and 12 s at 72°C. β-Actin was regarded as an internal control. The method of 2−ΔΔT was used to calculate the levels of relative gene expression.

Table 1

Primers of target genes

Gene	Forward (5’-3’)	Reverse (5’-3’)
β-Actin	CCGCGAGTACAACCTTCTTG	TGACCCATACCCACCATCAC
Bcl-2	GGGGCTACGAGTGGGATACT	GACGGTAGCGACGAGAGAAG
Bax	GGCGAATTGGCGATGAACTG	CCCAGTTGAAGTTGCCGTCT
Caspase-3	GGAGCTTGGAACGCGAAGAA	ACACAAGCCCATTTCAGGGT

Western blot analysis

Protein expression of several molecules (Bcl-2, Bax, cleaved caspase-3 and cleaved PARP) was detected after culture. Briefly, the cultured NP cells were washed with PBS and lysed by the ice-cold RIPA lysis buffer (Beyotime, China). After measuring protein concentration using a BCA Protein Assay Kit (Beyotime, China), equal amounts of protein samples in each group were separated by 10% SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto the PVDF membranes. Then, the PVDF membranes were probed with diluted primary antibodies overnight (β-actin:Proteintech, 60008-1-Ig;cleaved caspase-3: Cell Signaling Technology, #9661; cleaved PARP: Cell Signaling Technology, #5625; Akt: Cell Signaling Technology, #4685; p-Akt: Cell Signaling Technology, #4060; mTOR: Cell Signaling Technology, #2972; p-mTOR: Cell Signaling Technology, #5536), followed by incubation with secondary antibodies (Abcam, U.S.A.). Finally, the protein bands on the PVDF membranes were visualized using a BeyoECL Plus Kit (Beyotime, China). Protein expression normalized to β-actin was expressed as the relative amounts of immunoreactive protein that was quantified by densitometry using the ImageJ software.

Statistical analysis

Each experiment was performed in duplicate using independent samples. All data were analyzed by the one-way ANOVA using SPSS 17.0 software. A statistical significance was set when P<0.05.

Results

NP cell apoptosis ratio

Results showed that OP-1 addition significantly decreased cell apoptosis ratio in a hyperosmotic culture. However, the protective effects of OP-1 against hyperosmotic culture-induced cell apoptosis were partly attenuated by the inhibitor LY294002 and inhibitor FK-506 (Figure 1).

Figure 1

Nucleus pulposus (NP) cell apoptosis was measured by flow cytometry

Data are showed as mean ± SD, n=3. ‘HypOsm’ means a hyperosmolatic culture; ‘Inhs’ means addition of inhibitor LY294002 and inhibitor FK-506. * indicates a significant difference (P<0.05).

Caspase-3/9 activity

Results showed that activity of both caspase-3 and caspase-9 were significantly decreased by OP-1 addition in a hyperosmotic culture. However, the inhibitor LY294002 and inhibitor FK-506 partly increased their activities in a hyperosmotic culture with OP-1 addition (Figure 2).

Figure 2

Analysis of caspase-3 activity and caspase-9 activity

Data are showed as mean ± SD, n=3. ‘HypOsm’ means a hyperosmolatic culture; ‘Inhs’ means addition of inhibitor LY294002 and inhibitor FK-506. * indicates a significant difference (P<0.05).

Gene expression of apoptosis-related molecules

Results showed that gene expression of anti-apoptotic molecule (Bcl-2) was up-regulated by OP-1 addition in a hyperosmotic culture, whereas gene expression of pro-apoptotic molecules (Bax and caspase-3) was down-regulated by OP-1 addition a hyperosmotic culture. Further analysis showed that inhibitor LY294002 and inhibitor FK-506 reversed gene expression profile of these molecules in a hyperosmotic culture with OP-1 addition (Figure 3).

Figure 3

Gene expression of apoptosis-related molecules (Bcl-2, Bax and caspase-3) in nucleus pulposus (NP) cells in a hyperosmotic culture

Data are showed as mean ± SD, n=3. ‘HypOsm’ means a hyperosmolatic culture; ‘Inhs’ means addition of inhibitor LY294002 and inhibitor FK-506. * indicates a significant difference (P<0.05).

Protein expression of apoptosis-related molecules

Results showed that protein expression of apoptosis markers (cleaved caspase-3 and cleaved PARP) was down-regulated by OP-1 addition in a hyperosmotic culture. In addition, inhibitor LY294002 and inhibitor FK-506 reversed protein expression profile of these apoptosis markers in a hyperosmotic culture with OP-1 addition (Figure 4).

Figure 4

Protein expression of apoptosis markers (cleaved caspase-3 and cleaved PARP) in nucleus pulposus (NP) cells in a hyperosmotic culture

Data are showed as mean ± SD, n=3. ‘HypOsm’ means a hyperosmolatic culture; ’Inhs’ means addition of inhibitor LY294002 and inhibitor FK-506. * indicates a significant difference (P<0.05).

Activity of the PI3K/Akt/mTOR pathway

Results showed that protein expression of p-Akt and p-mTOR was significantly increased by OP-1 addition in a hyperosmotic culture. Predictably, their protein expression levels were significantly decreased by the inhibitor LY294002 and inhibitor FK-506 in a hyperosmotic culture with OP-1 addition (Figure 5).

Figure 5

Activation of the PI3K/Akt/mTOR pathway in nucleus pulposus (NP) cells in a hyperosmotic culture

Data are showed as mean ± SD, n=3. ‘HypOsm’ means a hyperosmolatic culture; ‘Inhs’ means addition of inhibitor LY294002 and inhibitor FK-506. * indicates a significant difference (P<0.05).

Discussion

Intervertebral disc degeneration is a main contributor of low back pain [26]. To date, there are increasing number of researchers who have devoted themselves to exploring the pathogenesis of disc degeneration and the effective approaches to retard disc degeneration [27-31]. As an important physicochemical microenvironment within the disc tissue, osmolarity significantly affects disc biology from disc cell viability to disc matrix metabolism [10-16,18-20]. Importantly, a hyperosmolatic environment can induce disc NP cell apoptosis [19,20]. Therefore, inhibiting hyperosmotic microenvironment-induced NP cell apoptosis has profound significance in retarding disc degeneration.

Because hyperosmolatic can induce NP cell apoptosis, the present study directly investigated that whether OP-1 can inhibit hyperosmolatic culture-induced NP cell apoptosis. We found that OP-1 addition significantly decreased NP cell apoptosis ratio and caspase-3/9 activity, up-regulated expression of anti-apoptosis molecules (Bcl-2) and down-regulated expression of pro-apoptosis molecules (Bax, caspase-3, cleaved capse-3 and cleaved PARP) in a hyperosmolatic culture. These results indicating that OP-1 has protective effects against hyperosmolatic culture-caused NP cell apoptosis. This is in line with the previous reports that OP-1 is helpful to protect the healthy disc cell biology in vitro and retard disc degeneration in vivo [21-24].

We also investigated the signaling transduction pathway in the protective effects of OP-1 against hyperosmotic environment-induced NP cells apoptosis. According to the previous studies, PI3K/Akt/mTOR pathway is an important pathway that regulates cell biology in many cells [32-39]. Importantly, it also plays an important role in regulating disc cell’s biology [40-47]. Therefore, we tentatively explored whether it functions in this process by using the specific inhibitors. Results showed that when the PI3K/Akt/mTOR pathway was inhibited by the inhibitor LY294002 and inhibitor FK-506, the effects of OP-1 were partly attenuated in a hyperosmotic culture. These findings indicate that OP-1 may protect NP cell apoptosis through activating the PI3K/Akt/mTOR pathway in a hyperosmolatic culture.

The present study has some limitations. First, because it is difficult to establish an animal model that can always maintain a hyperosmotic environment, the present study did not further verify the protective effects of OP-1 against NP cell apoptosis-induced by the hyperosmotic environment in vivo. Second, the NP cells were isolated from the rat disc NP tissues that contain a lot of notochordal cells. Though rat is a classical experimental animal in the current basic researches, the existence of notochordal cells may interfere the present results to some extent.

In conclusion, the present study investigated for the first time the effects of OP-1 on NP cell apoptosis and the potential signaling transduction pathway in a hyperosmolatic culture. Our results suggest that OP-1 attenuates NP cell apoptosis through activating the PI3K/Akt/mTOR pathway in a hyperosmolatic culture. The present study provides some theoretical basis for the application of OP-1 in retarding/regenerating disc degeneration.